ID: 1060849594

View in Genome Browser
Species Human (GRCh38)
Location 9:126862694-126862716
Sequence CGAGTGCCACAAAGCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060849594_1060849601 26 Left 1060849594 9:126862694-126862716 CCCCCATGGCTTTGTGGCACTCG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1060849601 9:126862743-126862765 GAACTTGTTCTTGTCCCAACTGG No data
1060849594_1060849599 -2 Left 1060849594 9:126862694-126862716 CCCCCATGGCTTTGTGGCACTCG 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1060849599 9:126862715-126862737 CGGATTCAGCACTTGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060849594 Original CRISPR CGAGTGCCACAAAGCCATGG GGG (reversed) Intronic
900296939 1:1956594-1956616 AGTGTGCCACTCAGCCATGGGGG - Intronic
900958064 1:5900396-5900418 CGAGACACAAAAAGCCATGGAGG + Intronic
902614019 1:17614018-17614040 AGAGTGCCACAAGGACAGGGCGG - Intronic
913939249 1:125086750-125086772 CGAGGGGCACAAAGCCGTGGCGG + Intergenic
913979572 1:143497419-143497441 CGAGGGGCACAAAGCCCCGGCGG - Intergenic
923042233 1:230327566-230327588 CAAGGGCCAGAAAACCATGGCGG + Intronic
1063529694 10:6819338-6819360 CGAGTGACCCAATCCCATGGAGG - Intergenic
1064904475 10:20330881-20330903 TGAGCCCCACAAAGCCATAGGGG + Intergenic
1066956448 10:42177665-42177687 CGAGGGGCAAAAAGCCGTGGCGG - Intergenic
1067190182 10:44062182-44062204 CGTGTGTCACAACACCATGGGGG - Intergenic
1071813767 10:89210173-89210195 AAAGTGCCACAAAGTCACGGGGG - Intergenic
1073539210 10:104304705-104304727 CTAGTTCCACAAAGTGATGGGGG - Intronic
1074721695 10:116270924-116270946 TGAGTGCCGCAGCGCCATGGAGG - Exonic
1074832011 10:117255826-117255848 TGAGTGTCAGAAAGCAATGGCGG - Intronic
1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG + Intronic
1078916761 11:15785615-15785637 CAACATCCACAAAGCCATGGAGG + Intergenic
1080384821 11:31805121-31805143 CGAGCGGCACAAAGCCCTGCCGG + Intronic
1080433094 11:32216444-32216466 CGAGGCCCACAAGGCAATGGGGG + Intergenic
1080522065 11:33076195-33076217 CCAGTCCCAAAAAGCCATTGGGG + Intronic
1089583426 11:119495556-119495578 CAAGTGACAGAAAGCCAAGGAGG - Intergenic
1091658355 12:2362428-2362450 CGCGTGCCACAAAAACATGTAGG - Intronic
1094413465 12:30192279-30192301 GGACTGACCCAAAGCCATGGGGG + Intergenic
1096305797 12:50474085-50474107 CAAGTACTACAAAGCCATCGAGG + Exonic
1098050981 12:66452337-66452359 CAAGTGTCACAAAGCCCTGGAGG - Intronic
1100151112 12:91738903-91738925 CCAGGTCCACACAGCCATGGAGG - Intergenic
1106261116 13:28067539-28067561 TGAGTCCCACAGAGCCATGAAGG + Intronic
1121466412 14:94118147-94118169 TGAGAGCCACAAAACCAAGGTGG - Intergenic
1123019761 14:105392176-105392198 CAAGTGGAACTAAGCCATGGGGG + Intronic
1123600365 15:21962141-21962163 CGCATGCCATAAAGCCAAGGTGG + Intergenic
1124823023 15:33066713-33066735 GGAGTACCACAAACCCAGGGTGG - Intronic
1125158717 15:36618849-36618871 CAAGTACTACAAAGCCATGGAGG + Intronic
1130902859 15:88220180-88220202 CATGTGGCTCAAAGCCATGGTGG - Intronic
1131994454 15:98120639-98120661 GGAGTGGCACAAAGGCCTGGTGG - Intergenic
1136957438 16:34802956-34802978 CGGGGGTCAAAAAGCCATGGTGG - Intergenic
1137344622 16:47644780-47644802 CCAGTGCCAAAAAGCCATTGAGG + Intronic
1137394442 16:48106831-48106853 CAAATGCCACAGAGCCATGGGGG - Intronic
1139667047 16:68464597-68464619 AGAGTTTGACAAAGCCATGGTGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143995813 17:11005648-11005670 CAAGTGCCCCAGGGCCATGGAGG - Intergenic
1155352840 18:24923926-24923948 GGATTGAAACAAAGCCATGGAGG - Intergenic
1157425686 18:47582437-47582459 TGAATGCCACAAAGACTTGGGGG - Intergenic
1159096041 18:63903116-63903138 AGTGTTCCACCAAGCCATGGTGG + Exonic
1162551215 19:11359512-11359534 CGACTGCCACCAAGCCAGGGCGG - Intronic
1168350621 19:55673960-55673982 TGACTGCCAGAAAGCCATGCAGG + Exonic
925329418 2:3046948-3046970 TGAGACTCACAAAGCCATGGAGG - Intergenic
925411628 2:3643054-3643076 GCAGTGCCCCCAAGCCATGGAGG + Intronic
925563117 2:5219820-5219842 CCAGGGCCACAAATCCAAGGGGG + Intergenic
928769926 2:34694503-34694525 CCAGAGCCACAGAGCCAAGGAGG - Intergenic
930618468 2:53619362-53619384 TGGGTACCACAAAGCAATGGGGG + Intronic
932814730 2:74852588-74852610 CTAGTGCCCCACAGCCCTGGAGG + Intronic
934569424 2:95359487-95359509 CGAGCCCACCAAAGCCATGGGGG - Intronic
936674252 2:114696736-114696758 CGCGTGCCATAAAGCCAAGGTGG + Intronic
937124020 2:119461853-119461875 CGAATGCCACAAATCCCTGGAGG + Exonic
939286737 2:140141017-140141039 GGAGTTGCCCAAAGCCATGGAGG + Intergenic
940581222 2:155583850-155583872 GGATTGGCACAAAGCCAAGGGGG + Intergenic
945336219 2:208595681-208595703 AGAGTCCCACAAAGCCTGGGTGG + Intronic
948430526 2:237915695-237915717 AAGGTTCCACAAAGCCATGGGGG + Intergenic
1172700738 20:36852275-36852297 CGAGTGGCCCAGAGCCAGGGTGG - Intronic
1176173974 20:63709015-63709037 GGAGTATCACAACGCCATGGTGG + Exonic
1179873155 21:44253957-44253979 CGAGTGCCGAAAAGGCATGGTGG + Intronic
1180719625 22:17897725-17897747 TGAGTGCCAAAAAGACATGGAGG + Intronic
1184418017 22:44363424-44363446 CCAGTGACACAGGGCCATGGAGG - Intergenic
1185015541 22:48340528-48340550 CCAGGGCCACACAGCCATGGAGG + Intergenic
964919677 3:161881429-161881451 CAGGTACTACAAAGCCATGGTGG - Intergenic
965884706 3:173430684-173430706 AGAATGCCACTAAGCCATGAGGG - Intronic
967499900 3:190185508-190185530 CCAGTGCCAAAACGCCAAGGCGG + Intergenic
968425310 4:519378-519400 AGAGAGTCACAAAGCTATGGGGG - Intronic
969071155 4:4540602-4540624 CAAGTGCCATAAAGCCTTGCAGG - Intronic
974716590 4:65676174-65676196 CGTGAGCCACAAAGCCCAGGAGG + Intergenic
978111014 4:104964041-104964063 CTACTGCCACCAAGGCATGGGGG - Intergenic
981640844 4:146941968-146941990 CTAGTGCTACAAAGCCATGGTGG + Intronic
985445298 4:190018337-190018359 CGAGAGCCATAGAGCCTTGGAGG - Intergenic
989440127 5:41461486-41461508 AGTGTGCTACAAAACCATGGTGG + Intronic
989548852 5:42708815-42708837 AAAGTGCAACAAAGCCATGTTGG - Intronic
989802263 5:45557628-45557650 AAAGTGACACAAAGCCATGAAGG - Intronic
998164889 5:139837291-139837313 GGGGTGCCACAAGGCCAGGGCGG - Intronic
1007354997 6:41308234-41308256 CAAGGACCACAAAGCCATTGTGG - Intergenic
1013039909 6:106423011-106423033 TAAGTTCCACAAAGCCTTGGAGG + Intergenic
1026532003 7:71207648-71207670 CGAGTGACACTTACCCATGGTGG - Intronic
1035569487 8:662725-662747 CAGGTTCCACAAGGCCATGGAGG + Intronic
1046764694 8:118056940-118056962 CCATTACCAAAAAGCCATGGAGG + Intronic
1053697278 9:40650300-40650322 CGAGGGGCAAAAAGCCGTGGCGG + Intergenic
1054308530 9:63449525-63449547 CGAGGGGCAAAAAGCCGTGGCGG + Intergenic
1054407235 9:64773414-64773436 CGAGGGGCAAAAAGCCGTGGCGG + Intergenic
1057305448 9:93909722-93909744 GGAATGCCACAATGCCAGGGAGG - Intergenic
1058424171 9:104862436-104862458 CTAGTGCCACAAAGCTCAGGTGG - Intronic
1060849594 9:126862694-126862716 CGAGTGCCACAAAGCCATGGGGG - Intronic
1062268349 9:135697595-135697617 CGAGTGCCACATTTCCTTGGAGG + Exonic
1187003951 X:15213422-15213444 CAAGTGCCCCATAGCCATGTGGG + Intergenic
1195574852 X:106438257-106438279 GGAGCACCACAAACCCATGGTGG - Intergenic