ID: 1060851532

View in Genome Browser
Species Human (GRCh38)
Location 9:126880690-126880712
Sequence CCATTCCGCTGTGAGATCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060851528_1060851532 5 Left 1060851528 9:126880662-126880684 CCACATCCGGGGCCATACAGATG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG 0: 1
1: 0
2: 1
3: 9
4: 134
1060851529_1060851532 -1 Left 1060851529 9:126880668-126880690 CCGGGGCCATACAGATGATAAAC 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG 0: 1
1: 0
2: 1
3: 9
4: 134
1060851525_1060851532 17 Left 1060851525 9:126880650-126880672 CCAACTGGAGTACCACATCCGGG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG 0: 1
1: 0
2: 1
3: 9
4: 134
1060851530_1060851532 -7 Left 1060851530 9:126880674-126880696 CCATACAGATGATAAACCATTCC 0: 1
1: 0
2: 2
3: 7
4: 146
Right 1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG 0: 1
1: 0
2: 1
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060851532 Original CRISPR CCATTCCGCTGTGAGATCTG CGG Exonic
900226881 1:1537100-1537122 CCTTCCCTCAGTGAGATCTGGGG + Intronic
903318029 1:22524319-22524341 ACCTTCCCCTGTGAGCTCTGTGG + Exonic
904717647 1:32481001-32481023 CCCTACCCCTGTGAGACCTGCGG + Exonic
904762918 1:32818097-32818119 CCATTCCCTGGGGAGATCTGAGG + Exonic
905733309 1:40310989-40311011 CCCTTCCCCTGTGGGTTCTGGGG - Intronic
905974681 1:42165731-42165753 CAATTCCCCAGTGAGATCCGCGG - Intergenic
906048480 1:42851457-42851479 CCATACCGCTGTGACATCTGTGG + Exonic
906290147 1:44614445-44614467 CCATTCAGCGGAAAGATCTGAGG - Intronic
908085723 1:60631695-60631717 CCAGTCCAGTGTGAGATCTTGGG + Intergenic
920312306 1:205055733-205055755 CCTTCTCGCTGTGGGATCTGGGG + Intronic
921411862 1:214844663-214844685 CCATTCCCCTTCCAGATCTGAGG + Intergenic
921694788 1:218195878-218195900 GCATTCCTCTGTCAGATATGAGG + Intergenic
1064005066 10:11692836-11692858 CCTTTCCTCTGTGGGCTCTGTGG + Intergenic
1069907162 10:71738696-71738718 CCCTCCAGCTGTGAGAGCTGTGG - Intronic
1073640174 10:105244521-105244543 CCAATCCTCTGTGAATTCTGAGG + Intronic
1074770970 10:116733531-116733553 CCATTTCCCTCTGAGATCTTGGG + Intronic
1076365791 10:129920396-129920418 CCACCCCGCTGTGTGATCTAGGG + Intronic
1083162950 11:60867038-60867060 CCATTCCGCTGCCAGCTCTGAGG + Intergenic
1083168517 11:60907033-60907055 CCATTTCGCTCTGTGATTTGGGG + Intergenic
1084022323 11:66425046-66425068 CCATTCCTCACTGGGATCTGGGG - Exonic
1087289412 11:96303460-96303482 CCATTATTCTGTGAGTTCTGAGG + Intronic
1088841213 11:113629068-113629090 CAGTTCTGCTGTGAGATCTGTGG - Intergenic
1089598823 11:119600482-119600504 CCAGGCCCCTGAGAGATCTGGGG + Intergenic
1089970537 11:122689658-122689680 CCCTCCCACTGTGGGATCTGAGG - Intronic
1091099119 11:132853986-132854008 CCCTTACCCTGTGTGATCTGAGG - Intronic
1095412631 12:41940734-41940756 ACATTCCACTCTGAGAGCTGCGG + Intergenic
1097699773 12:62808214-62808236 CCACTCCTCTGTGAGAGGTGTGG + Intronic
1098468265 12:70813952-70813974 CCATTCCTGTGTGAACTCTGAGG - Intronic
1104079192 12:125415396-125415418 CCCTTCCTCTGGGAGATGTGGGG - Intronic
1104163339 12:126202247-126202269 TCACTGCCCTGTGAGATCTGAGG - Intergenic
1110637614 13:77784362-77784384 CCATTCCTCTGTGAAATCATTGG + Intergenic
1113038224 13:106074609-106074631 CCATTCCCGTGTGAGATAAGTGG - Intergenic
1113094953 13:106653650-106653672 CCACTTAGCTGTGGGATCTGCGG + Intergenic
1115243087 14:31268680-31268702 GCATTCCACTGTGTGATCTTAGG - Intergenic
1116932564 14:50704535-50704557 GCCTTTCGCTGTGAGACCTGCGG - Intergenic
1118177461 14:63455775-63455797 CCATTCGGCTGCTAGGTCTGGGG - Intronic
1119127074 14:72137426-72137448 CCCTTTACCTGTGAGATCTGAGG - Intronic
1123042901 14:105497697-105497719 CCAGCCCGCTGTGGGACCTGGGG + Intronic
1125226163 15:37398685-37398707 CCATTCAACTGTGTGATCTTAGG - Intergenic
1128688487 15:69705362-69705384 CCATTCCCCTGTAAGACCTTAGG - Intergenic
1132796671 16:1727838-1727860 CCATCCTGCTCTGTGATCTGGGG - Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136477923 16:30524920-30524942 CCCTTCAGCTGTGGCATCTGCGG - Exonic
1136564496 16:31061819-31061841 CCCTTCCGCTGTGAGGAGTGCGG - Exonic
1136567181 16:31077441-31077463 CCTTTCCGCTGTGGGGACTGTGG + Exonic
1137248128 16:46722015-46722037 CCATTCTGCAGTGACAGCTGTGG + Intronic
1139166280 16:64568283-64568305 CCTTTCAGCTGGGACATCTGTGG + Intergenic
1141726467 16:85792511-85792533 CCCTGCCGCTGTGAGTGCTGAGG - Intronic
1144344499 17:14337932-14337954 CCATTATGCTGTGGCATCTGTGG - Intronic
1148462369 17:47846111-47846133 CCCTTCCCCTGTGAGATGAGGGG + Exonic
1150043333 17:61886602-61886624 CCTTTACTCTGTGTGATCTGAGG - Intronic
1150506480 17:65703659-65703681 ACATTGCCCTGTGAGCTCTGTGG + Intronic
1151406408 17:73889985-73890007 CCACTCAGCTGTGAGCCCTGGGG - Intergenic
1154945686 18:21159352-21159374 CCAATCCTCTGTGAGTTATGGGG + Intergenic
1158190932 18:54828186-54828208 CCAGGGCGCTGTGAGAACTGGGG - Exonic
1160139310 18:76306770-76306792 CCATTCAGAGGTGAAATCTGGGG + Intergenic
1160965440 19:1745216-1745238 CTATTCCCCTCTGAGAGCTGGGG + Intergenic
1162417095 19:10544497-10544519 CCATTCCCCTGTGTGACCTTGGG + Intronic
1163362132 19:16853297-16853319 CCCTTCCGCAGTGAAAGCTGGGG - Intronic
1164656336 19:29924723-29924745 CCATGCCCCTGTGAGAGCCGGGG + Intronic
1164881103 19:31733678-31733700 CCATTGCACAGTGGGATCTGAGG - Intergenic
927499514 2:23573430-23573452 CCACTCTGCTGAGTGATCTGGGG - Intronic
927917387 2:26945823-26945845 CCATCCTGCTGTGAGAACAGAGG + Intronic
931105421 2:59049788-59049810 CCATTCTGCTGTTAGCTGTGTGG - Intergenic
936993487 2:118389805-118389827 CCTTTCAGCTGTGAGATCTCAGG + Intergenic
946061964 2:216950313-216950335 CCAGTCCCCTGAGAGATCAGTGG + Intergenic
948333052 2:237185346-237185368 GCAGTCAGCTTTGAGATCTGCGG - Intergenic
948358281 2:237398193-237398215 TCATTCCACTGTGAGATTGGAGG - Intronic
1168836243 20:879699-879721 CCATTCTGCTCTGAAACCTGGGG - Intronic
1172925736 20:38533168-38533190 CCACTACACTGTGAGCTCTGAGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174645830 20:52084738-52084760 GCCTTCCGCTGTGAGACCTGCGG - Intronic
1174986359 20:55457958-55457980 CCATCCCTCAGTGAGATCTTGGG + Intergenic
1176181760 20:63752729-63752751 CCCTACCCCTGCGAGATCTGCGG - Exonic
1179840533 21:44070054-44070076 CCAGTCTGCTGTGAGCTCTCTGG + Intronic
1180948071 22:19707741-19707763 CTGTGCCGCTGTGAGATTTGCGG + Intergenic
952084595 3:29802416-29802438 TCTTTCTGCTGTGAGAACTGGGG - Intronic
953913369 3:46903904-46903926 CCATTCTGAAGTGAGACCTGAGG - Intergenic
961378090 3:126480344-126480366 CAATTCCGCTGTGAGCCCCGTGG + Intergenic
961491893 3:127262260-127262282 CTCCTCGGCTGTGAGATCTGGGG - Intergenic
961537381 3:127578374-127578396 CCATGCTGCTGTGTGACCTGGGG - Intronic
966882651 3:184358962-184358984 CGATGCCGCGGTGAGAACTGGGG - Exonic
969042685 4:4313086-4313108 CCATACATCTGCGAGATCTGTGG + Exonic
969176290 4:5401559-5401581 TCATTCTGCTCTGAGATTTGAGG + Intronic
969218532 4:5743592-5743614 TCCTACCACTGTGAGATCTGGGG + Intronic
970191430 4:13522831-13522853 CCTCTCCTCTGGGAGATCTGGGG + Intergenic
974853968 4:67437324-67437346 CCACTGAGCTGTGAGATCTGGGG - Intergenic
981865324 4:149410219-149410241 CCTTTTGGCTGTGAGAACTGTGG - Intergenic
982436525 4:155387246-155387268 CCATTCTTCTGTGAGATATTTGG + Intergenic
985373048 4:189307523-189307545 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373057 4:189307565-189307587 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373084 4:189307691-189307713 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373103 4:189307775-189307797 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373121 4:189307859-189307881 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373130 4:189307901-189307923 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373176 4:189308111-189308133 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373185 4:189308153-189308175 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373203 4:189308237-189308259 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373231 4:189308363-189308385 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373269 4:189308531-189308553 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373278 4:189308573-189308595 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373318 4:189308741-189308763 CCAGTCCGCCGTGTGACCTGCGG - Intergenic
985373354 4:189308909-189308931 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373372 4:189308993-189309015 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373381 4:189309035-189309057 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985373450 4:189309329-189309351 CCAGTCCGCCGTGTGACCTGCGG - Intergenic
985373469 4:189309413-189309435 CCAGTCCGCCGTGTGACCTGTGG - Intergenic
985628011 5:1000113-1000135 CGATTCCTCTGAGAGACCTGGGG + Intergenic
987039505 5:14048494-14048516 CCATTCCACAGATAGATCTGAGG + Intergenic
988962025 5:36380008-36380030 CCATGTCGCTGTGATATATGTGG + Intergenic
990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG + Intergenic
991584697 5:68190017-68190039 CCCTTCCTCTCTGAGATCTTGGG - Intronic
992940835 5:81759548-81759570 CCATGTGGCTGTGTGATCTGTGG + Intergenic
992952982 5:81878833-81878855 CCATCCCGCTGTGTGCCCTGTGG - Intergenic
993901588 5:93587749-93587771 CCACACCGCTAGGAGATCTGGGG - Intronic
997562702 5:134862254-134862276 CCATTCTGTTGTGAGAACTTTGG + Intergenic
1007637605 6:43308571-43308593 CCCTTCCTCTGAGAGCTCTGTGG - Intronic
1007842088 6:44724978-44725000 CCACTCCACTGTGAGAAATGAGG - Intergenic
1011300251 6:85865923-85865945 CCCTTTCGAGGTGAGATCTGGGG + Intergenic
1012475945 6:99614520-99614542 CCCTACCGCTGCGAGTTCTGCGG + Exonic
1015420652 6:133004072-133004094 CCATTCCTCCTTGAGATCTGGGG - Intergenic
1022945564 7:35280419-35280441 CCATCCCACTGTGAGAATTGAGG + Intergenic
1024176069 7:46842284-46842306 TCATTCCTCTGTGAGAACGGAGG + Intergenic
1026823763 7:73568225-73568247 CCATCCCACTGTCAGCTCTGTGG - Intergenic
1030503208 7:110386001-110386023 CCTTTCCCTTCTGAGATCTGTGG + Intergenic
1033445270 7:141415825-141415847 CCAATCAGCTGTGAGAGATGTGG + Intronic
1034295205 7:149966276-149966298 CCCATCTGATGTGAGATCTGAGG + Intergenic
1035755131 8:2025293-2025315 CCAGTCTGCTTTGAGATCTGTGG - Intergenic
1037982454 8:23263928-23263950 AAATTCCCCTGTGAGCTCTGTGG - Intergenic
1038387894 8:27166753-27166775 CCATTCCACTGTCAGATCATGGG + Intergenic
1039054517 8:33524849-33524871 ACTTTCCGCTGTGAGATCTTGGG - Intergenic
1042809147 8:72804902-72804924 CCACTCCTCTGTGAAACCTGTGG - Intronic
1043006278 8:74822749-74822771 CCATCCAGCTCTAAGATCTGTGG - Intronic
1045826262 8:106402200-106402222 CAATTCATCTGTGTGATCTGTGG - Intronic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1050380418 9:5022119-5022141 CCATTCCCTTGGGAAATCTGAGG + Exonic
1053073329 9:35113946-35113968 CCCTTTCACTGTGACATCTGGGG + Intronic
1059777935 9:117494700-117494722 CCATTCCACTTGGAGATTTGAGG + Intergenic
1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG + Exonic
1061779845 9:132989121-132989143 CCCTTCGCCTGTGACATCTGCGG + Exonic
1190703389 X:53005150-53005172 CCATCCCTTTGTGAGTTCTGGGG - Intergenic
1195504056 X:105636667-105636689 CCACTAGGCTGTGAGATCTTTGG - Intronic
1198149391 X:133893326-133893348 CCATTGCGCTGTGAGGTATTTGG + Intronic
1198955817 X:142129142-142129164 CCATTCCCTTATTAGATCTGTGG + Intergenic
1201499090 Y:14622300-14622322 CCATTACCCAGTGAGATCTTGGG + Exonic