ID: 1060853871

View in Genome Browser
Species Human (GRCh38)
Location 9:126899513-126899535
Sequence CCAACTTAAGTGCCCATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060853867_1060853871 17 Left 1060853867 9:126899473-126899495 CCTGGCGACAGAGCAAGACTCCG 0: 519
1: 3599
2: 9726
3: 13693
4: 14097
Right 1060853871 9:126899513-126899535 CCAACTTAAGTGCCCATAATGGG No data
1060853868_1060853871 -3 Left 1060853868 9:126899493-126899515 CCGTCTAAAAAAAAAGAAAGCCA No data
Right 1060853871 9:126899513-126899535 CCAACTTAAGTGCCCATAATGGG No data
1060853866_1060853871 21 Left 1060853866 9:126899469-126899491 CCAGCCTGGCGACAGAGCAAGAC 0: 1564
1: 7070
2: 10955
3: 12037
4: 8808
Right 1060853871 9:126899513-126899535 CCAACTTAAGTGCCCATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060853871 Original CRISPR CCAACTTAAGTGCCCATAAT GGG Intergenic
No off target data available for this crispr