ID: 1060860215

View in Genome Browser
Species Human (GRCh38)
Location 9:126947864-126947886
Sequence AAATATATGTAGCTACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060860211_1060860215 -8 Left 1060860211 9:126947849-126947871 CCCCTACTATTACTCAAATATAT 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG No data
1060860207_1060860215 29 Left 1060860207 9:126947812-126947834 CCTTGTCTATAGAATGAAGGGTG 0: 1
1: 0
2: 3
3: 17
4: 182
Right 1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG No data
1060860212_1060860215 -9 Left 1060860212 9:126947850-126947872 CCCTACTATTACTCAAATATATG 0: 1
1: 0
2: 3
3: 33
4: 294
Right 1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG No data
1060860213_1060860215 -10 Left 1060860213 9:126947851-126947873 CCTACTATTACTCAAATATATGT 0: 1
1: 0
2: 3
3: 22
4: 280
Right 1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060860215 Original CRISPR AAATATATGTAGCTACTGCA GGG Intronic
No off target data available for this crispr