ID: 1060862051

View in Genome Browser
Species Human (GRCh38)
Location 9:126962482-126962504
Sequence GCCATGCCAGGCGTGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060862046_1060862051 -10 Left 1060862046 9:126962469-126962491 CCTAAGGCCCCTGGCCATGCCAG 0: 1
1: 0
2: 0
3: 28
4: 306
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1060862042_1060862051 7 Left 1060862042 9:126962452-126962474 CCACCATTCTTAGCACTCCTAAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1060862044_1060862051 4 Left 1060862044 9:126962455-126962477 CCATTCTTAGCACTCCTAAGGCC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060862051 Original CRISPR GCCATGCCAGGCGTGAGATT TGG Intronic
900982332 1:6053353-6053375 GCCATGGCTGCCGTGAGGTTGGG - Intronic
904983675 1:34527081-34527103 CCCCTGCCAGGCCTGAGATTTGG + Intergenic
914413689 1:147457360-147457382 ACCATGCCTGGCCTGAGATGGGG - Intergenic
914721032 1:150289214-150289236 GCCATCCCAGGGGAAAGATTGGG - Intergenic
1066040244 10:31542022-31542044 GCCATGATGGGAGTGAGATTGGG + Intergenic
1068920364 10:62477051-62477073 CCCATGCCAGGCGTGGTATCTGG - Intronic
1083089187 11:60182484-60182506 GCAATGCCAGGTGGGAAATTAGG - Intronic
1096594462 12:52685743-52685765 GCCCTTCCAGGCTTGGGATTGGG + Intergenic
1098364085 12:69684135-69684157 GCTATGCCAGGGGTGTGATGGGG - Intronic
1101409024 12:104454087-104454109 GCCATGCCAGGCTTTAAAATGGG + Intergenic
1104246563 12:127048223-127048245 GCAATGCCAGGAGTGAGAAAAGG + Intergenic
1104393993 12:128415653-128415675 GGCATGCCTGGTGTGAGACTGGG + Intronic
1104772404 12:131371747-131371769 GACATGGCAGGCGGGAGATGTGG - Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1109562724 13:64075063-64075085 ACCCTTACAGGCGTGAGATTTGG - Intergenic
1112715810 13:102183747-102183769 GCCATGCCAGACTTGGGAATCGG + Intronic
1113250782 13:108450318-108450340 GCCAAGCCAAGAGTGAGAGTGGG + Intergenic
1113646447 13:111999871-111999893 GCCATGCCATGCAGGAGATGTGG - Intergenic
1122318047 14:100837193-100837215 GCCATGCCAGGCTGAAGTTTGGG + Intergenic
1127776293 15:62266702-62266724 ATCATGCCCGGCCTGAGATTTGG - Intergenic
1130918228 15:88322782-88322804 GCCCTCCCAGGCCTGAGCTTTGG - Intergenic
1131389411 15:92034723-92034745 GCCTTCCCAGGCGTGAAAGTGGG - Intronic
1131966289 15:97847679-97847701 GTGATGCCAGGCCTGACATTAGG + Intergenic
1138488448 16:57361734-57361756 GCCTCCCCAGGTGTGAGATTTGG - Intronic
1139297888 16:65918933-65918955 ACCATGCCAGGTGAGGGATTTGG + Intergenic
1145802377 17:27696522-27696544 GCCATGGCAGGACTGAGAGTGGG + Intergenic
1147400466 17:40177729-40177751 GCCGTGCCAGGCGCCAGACTGGG - Intronic
1148337722 17:46852326-46852348 CCCATGCCAGGTCTGAGATGTGG - Intronic
1148438482 17:47699586-47699608 GCCCTGGCAGGGGTGAGCTTGGG + Intronic
1148856959 17:50584155-50584177 GCCATCCCAGGAGGGAGATCAGG + Intronic
1149565499 17:57638107-57638129 GCAGTGCCAGGCCTGAGGTTCGG + Intronic
1151519460 17:74617761-74617783 CCTCTGCCAGGCATGAGATTTGG + Intronic
1152545077 17:80996364-80996386 TCCATGCCCGGCCTGAGATGAGG - Intronic
1156434001 18:37106644-37106666 GCCAAGCCAGGCTTGAGGTCAGG - Intronic
1157339994 18:46770043-46770065 GTTATACCAGGAGTGAGATTAGG + Intergenic
1164221559 19:23199077-23199099 ACCATGCCCGGCCTGAGATGAGG - Intergenic
1164930049 19:32168379-32168401 GCCAGGCCAGGTGGGAGAGTAGG - Intergenic
1165426614 19:35749393-35749415 ACCATGCCAGGCCTGGGATCCGG - Intronic
1166054963 19:40283090-40283112 CCCATGCCAGGCGTGTGACAGGG - Intronic
1167315569 19:48761108-48761130 GCCATGCCAGGCTGGAGACCAGG + Intergenic
926150766 2:10424560-10424582 GCCAAGCCAGGAGGCAGATTCGG - Intronic
926968300 2:18440484-18440506 ACCCTGCCAGATGTGAGATTTGG + Intergenic
927433273 2:23045002-23045024 GCCTTGCTGGGCGTGTGATTTGG - Intergenic
928319478 2:30271708-30271730 CCAATGCCAGCAGTGAGATTTGG + Intronic
934900964 2:98159583-98159605 GTCATGCAAGGCGGGGGATTGGG + Intronic
938721970 2:134075429-134075451 CCCTTGGCAGGCATGAGATTTGG - Intergenic
939802032 2:146721702-146721724 CCCTTGGCAGGCATGAGATTCGG + Intergenic
939862532 2:147436844-147436866 ACCAAGCCAGGAATGAGATTTGG + Intergenic
942044422 2:172091001-172091023 CCCCTTCCAGGCCTGAGATTGGG + Intergenic
948462019 2:238134366-238134388 GCCAGGCGAGGGGTGAGATGTGG + Intergenic
1179800470 21:43809430-43809452 GCCATGCCAGGCAGGAAAATGGG - Intergenic
1180958470 22:19751549-19751571 TCCAGGCCTGGCGTGAGGTTTGG - Intergenic
949526431 3:4909325-4909347 GCCATGCCAGGCTTGAGCCTGGG + Intergenic
960180013 3:114564896-114564918 CCCATGCAAGGCGTGACATAAGG - Intronic
963768225 3:149361119-149361141 GCCATGCCAGGTGGGAGAACTGG - Intergenic
967123702 3:186406321-186406343 GCACTGGCAGGGGTGAGATTTGG - Intergenic
967288496 3:187896819-187896841 GCCAAGCCAGGCCTGTGATTTGG + Intergenic
967904907 3:194491552-194491574 GGCATGCCAGGTGAGAGATGAGG - Intronic
967904911 3:194491576-194491598 GACATGCCAGGTGAGAGATGAGG - Intronic
967904936 3:194491675-194491697 GGCATGCCAGGTGAGAGATGAGG - Intronic
967904940 3:194491699-194491721 GACATGCCAGGTGAGAGATGAGG - Intronic
967904965 3:194491798-194491820 GGCATGCCAGGTGAGAGATGAGG - Intronic
967904971 3:194491822-194491844 GACATGCCAGGTGAGAGATGAGG - Intronic
967904976 3:194491846-194491868 GGCATGCCAGGTGAGAGATGAGG - Intronic
970400048 4:15708587-15708609 ACCATGCCCGGCCTGATATTAGG - Intronic
973534535 4:51867793-51867815 GCCATTCCAGGCTTGAAGTTGGG + Intronic
974552507 4:63396430-63396452 GCCATGGCAGGCATGGGATCTGG + Intergenic
979946048 4:126832092-126832114 GCCAAGACAGGCCTGAGGTTGGG - Intergenic
981205391 4:142034380-142034402 GCTATGCCAGCAGTGACATTCGG - Intronic
982653437 4:158117011-158117033 TCCAGGGCAGACGTGAGATTAGG + Intergenic
988126772 5:27049872-27049894 GCCCTGCAAGCTGTGAGATTTGG - Intronic
994060561 5:95472177-95472199 GCAATGCCAGTGGTGAGAGTGGG - Intronic
997605740 5:135174571-135174593 TCCATGCCAGGCATGATGTTTGG - Intronic
999275480 5:150327121-150327143 GCCATGCCAGGGGTCTGCTTAGG + Intronic
1008593962 6:53022805-53022827 TCCATGCCAGGCAACAGATTAGG + Intronic
1013130753 6:107230412-107230434 TCTAGGCCAAGCGTGAGATTAGG - Intronic
1017778151 6:157695598-157695620 GCCGTGCCAGGCCCGAGGTTTGG - Intergenic
1020481703 7:8669428-8669450 CCCAAGCCAGGTCTGAGATTCGG - Intronic
1021110719 7:16691597-16691619 GCCATGCCTGGCAATAGATTGGG + Intronic
1022539397 7:31121873-31121895 GCAACACCAGGCCTGAGATTGGG + Intergenic
1035705311 8:1670362-1670384 GCCATGCCAGGGGTGGGAGCTGG - Intronic
1040542249 8:48370660-48370682 GCCATGACAGGCCTGCAATTCGG - Intergenic
1041201706 8:55455763-55455785 GCCATGGCAGACTTGAGAATGGG + Intronic
1041536986 8:58937719-58937741 CCCATGGTAGGAGTGAGATTGGG - Intronic
1045782776 8:105886930-105886952 TCCTTGGCAGGCGTGAGATTCGG + Intergenic
1048598821 8:135896683-135896705 GCCATTCCAGCAGTGACATTTGG - Intergenic
1049395586 8:142398670-142398692 GCCATGCCTGGCATGAGTCTTGG - Intronic
1050171015 9:2816657-2816679 GCCAGGCCAGGTGTGAGACAAGG - Intronic
1050564693 9:6869768-6869790 GCCTTGCCAGGAGTGGGACTTGG + Intronic
1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG + Intronic
1187791168 X:22951577-22951599 GCCATGCCAGGTGTGGGAGTAGG - Intergenic
1193826907 X:86237639-86237661 CCCTTGCCATGTGTGAGATTCGG - Intronic
1195636946 X:107128449-107128471 GCAATGCCTGGCATGAGCTTGGG - Intronic
1200100430 X:153687289-153687311 CCCCTGCCTGGCGTGAGAGTGGG - Intronic