ID: 1060862051

View in Genome Browser
Species Human (GRCh38)
Location 9:126962482-126962504
Sequence GCCATGCCAGGCGTGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060862046_1060862051 -10 Left 1060862046 9:126962469-126962491 CCTAAGGCCCCTGGCCATGCCAG 0: 1
1: 0
2: 0
3: 28
4: 306
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1060862044_1060862051 4 Left 1060862044 9:126962455-126962477 CCATTCTTAGCACTCCTAAGGCC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1060862042_1060862051 7 Left 1060862042 9:126962452-126962474 CCACCATTCTTAGCACTCCTAAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1060862051 9:126962482-126962504 GCCATGCCAGGCGTGAGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060862051 Original CRISPR GCCATGCCAGGCGTGAGATT TGG Intronic