ID: 1060862313

View in Genome Browser
Species Human (GRCh38)
Location 9:126964605-126964627
Sequence CCTCTGAGGTCAGATAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060862313_1060862317 -8 Left 1060862313 9:126964605-126964627 CCAGGCCTATCTGACCTCAGAGG 0: 1
1: 0
2: 3
3: 36
4: 306
Right 1060862317 9:126964620-126964642 CTCAGAGGTCTTAACCACTATGG No data
1060862313_1060862319 28 Left 1060862313 9:126964605-126964627 CCAGGCCTATCTGACCTCAGAGG 0: 1
1: 0
2: 3
3: 36
4: 306
Right 1060862319 9:126964656-126964678 AAGATCATCTTAAGAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060862313 Original CRISPR CCTCTGAGGTCAGATAGGCC TGG (reversed) Intronic
902103924 1:14017577-14017599 ACTCTGTGGTCAGACAGGCTGGG - Intergenic
902257185 1:15197473-15197495 CCTCTTCAGTCAGAGAGGCCGGG - Intronic
902558563 1:17261488-17261510 GCTCTGAGGTCAGATGGCCTGGG - Intronic
903290624 1:22311874-22311896 CCTCAGAAGTCAGAAAGTCCAGG + Intergenic
903355196 1:22742149-22742171 CCTCTGGGCTCATATGGGCCAGG - Intronic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
904615802 1:31748960-31748982 CCTCTGGAGTCAGGCAGGCCTGG - Intronic
905182739 1:36176830-36176852 CCTCTGAGCTCAGGTGGGCGCGG + Exonic
905257445 1:36694146-36694168 CCACAGAGGTCACAGAGGCCAGG + Intergenic
905407880 1:37748855-37748877 GCTTTGAGGTCAGACAGACCTGG + Intronic
905514937 1:38555733-38555755 GCTCTGTGGTCAGACAGGCTTGG - Intergenic
906813396 1:48852194-48852216 ACTTTGAGATCAGTTAGGCCAGG - Intronic
907078337 1:51598190-51598212 TCTCTGAAGTCAGACAGACCTGG - Intronic
907691488 1:56671731-56671753 GCTCTGAAGTCAGACAGCCCAGG + Intronic
907747267 1:57225510-57225532 GAACTGAAGTCAGATAGGCCTGG - Intronic
908254318 1:62290400-62290422 GCTTTGAGGTAAGACAGGCCAGG + Intronic
908430313 1:64050206-64050228 GCTCTGAGGTCAGAAAGATCCGG - Intronic
908805024 1:67921488-67921510 CTTCTGAGGTCAAATAAGTCTGG - Intergenic
911562563 1:99424319-99424341 CATATGAGGTAAGATAGGACAGG + Intergenic
911663624 1:100530668-100530690 CCTCTGAAGTCTGGTAGGGCAGG + Intergenic
915357366 1:155263382-155263404 CCTCTGAGGTCAGATACCGCTGG + Exonic
915638400 1:157202643-157202665 ATTCTGAGCTCAGAGAGGCCAGG - Intergenic
915658494 1:157381321-157381343 ATTCTGAGCTCAGAGAGGCCAGG - Intergenic
916865530 1:168853391-168853413 CCACTGAAGTCATATGGGCCTGG - Intergenic
919849977 1:201666062-201666084 CCTCTGAGGTCAGAGGGAGCGGG + Intronic
920312806 1:205058446-205058468 CATGTGAGGTCAGGAAGGCCCGG - Intronic
920516975 1:206592436-206592458 CCTCTGAGGTCAGGTGGGCTTGG + Intronic
921936481 1:220801256-220801278 CCTGTGAGGGAAGATATGCCAGG - Intronic
921937812 1:220810831-220810853 ACTCTGAAGTCAGCCAGGCCTGG + Intronic
923264614 1:232302297-232302319 CCCCTGAGGCCAGAGAGACCTGG - Intergenic
1064130047 10:12701503-12701525 CCTCTGTGGCCAGAGAGGGCTGG - Intronic
1064580750 10:16790580-16790602 TCTCTGTGCTCAGATAAGCCTGG - Intronic
1065491751 10:26289347-26289369 CCTCTGTTGTCAGACATGCCTGG + Intronic
1065773811 10:29101306-29101328 GCTGTGAGGTCAGAATGGCCAGG + Intergenic
1065866777 10:29921292-29921314 CCTGTGAGGCCAGATAGCACAGG + Intergenic
1067431662 10:46249591-46249613 ACTCTGAGGAGAGACAGGCCTGG + Intergenic
1067441758 10:46312583-46312605 ACTCTGAGGAGAGACAGGCCTGG - Intronic
1069589510 10:69633060-69633082 CCTCTGAGGGCTGATAGGGGTGG + Exonic
1069900053 10:71701937-71701959 CGTCTGAGCTCAGATACTCCCGG + Intronic
1069987001 10:72291300-72291322 ACTCTGAAGTCAGATACACCTGG + Intergenic
1071528511 10:86372262-86372284 GCCCTGGGGTCAGAGAGGCCAGG - Intergenic
1071989427 10:91086557-91086579 ACTGTGAGTTCAGATAGCCCTGG + Intergenic
1072521684 10:96235467-96235489 ACTCTGAGGTCCTTTAGGCCTGG - Intronic
1073285017 10:102382320-102382342 CCTCTGAGGTCAACTAAGGCAGG + Exonic
1073938834 10:108669926-108669948 CCTCTCAGGTCCCATTGGCCTGG + Intergenic
1074008625 10:109454706-109454728 CCTGTGAGGACAGATAGTGCAGG + Intergenic
1074884983 10:117686226-117686248 TCTCTAAGGTCAGATGGGTCTGG + Intergenic
1075168018 10:120086664-120086686 CCTTTGAGGTCAGTTGGACCGGG + Intergenic
1075676465 10:124299270-124299292 GCTCTGGGGTCAGACAGGCTAGG + Intergenic
1076566911 10:131405108-131405130 CCTCTGAGGCCTGGTAGGCCGGG + Intergenic
1076797629 10:132805870-132805892 CCTCTGACATCCGAGAGGCCCGG + Intergenic
1077976480 11:7252647-7252669 GCTCTGAGTGCAGATAGCCCGGG - Intronic
1080451043 11:32379270-32379292 CTTCAGAGCTGAGATAGGCCAGG - Intergenic
1081195272 11:40152800-40152822 CGTCTGAGCTCAGACACGCCTGG + Intronic
1081982344 11:47275751-47275773 TCTCTGAGCTCAGATAGGACCGG - Intronic
1083289699 11:61682915-61682937 CCTCTGAGGGCAGACAGGTGTGG + Intronic
1083307684 11:61769636-61769658 CCTCTAAGGTGAGGTGGGCCCGG - Intronic
1087020637 11:93599388-93599410 CCAGTGAGGTCAGAAGGGCCAGG + Intergenic
1088140940 11:106615330-106615352 ACTTTGAGGTTAGATAGGCTGGG + Intergenic
1088311298 11:108463533-108463555 ACTCTGAGGCAAGATAGACCAGG + Intronic
1088463207 11:110104623-110104645 CCTCTGAAATCAGGTAGACCTGG + Intronic
1088706309 11:112467478-112467500 CCTCTGAGGTCAGATGAGAAAGG - Intergenic
1088843223 11:113644041-113644063 CCTTTGAGGTCACATACACCTGG + Intergenic
1089395501 11:118134136-118134158 CCCCTGATGTTAGAGAGGCCTGG - Exonic
1090023503 11:123148255-123148277 GCTTTGAGGTCAGAAAGACCTGG - Intronic
1090407415 11:126485318-126485340 CCTCTGAAGTCAGCTAGTTCAGG - Intronic
1090632742 11:128664495-128664517 CCTCTTGGGGCAGATAGGGCAGG + Intergenic
1090924663 11:131238985-131239007 CCTCTGAAGTCAGCCAGGCTGGG - Intergenic
1091438625 12:495216-495238 GTTCTGAAGTCAGATAGACCTGG - Intronic
1091791606 12:3275141-3275163 CCTCTTAGGTCAGAAACTCCAGG - Intronic
1092123441 12:6060073-6060095 TCTCGGAGGTCAGCTCGGCCAGG + Intronic
1093467830 12:19468293-19468315 CATCTAAAGTCAGATAGGCCAGG - Intronic
1093706656 12:22282185-22282207 CCTTTGAAATCAGACAGGCCAGG + Intronic
1093911978 12:24758770-24758792 CAGCTGAGGTGAGAGAGGCCAGG + Intergenic
1095955967 12:47806267-47806289 GCTTTGCGGTCAGATGGGCCTGG + Intronic
1096103080 12:48981023-48981045 CCCCTGGGCTCAGCTAGGCCTGG + Intronic
1096426216 12:51505643-51505665 CCACTGAGGTCAGAATGGCAAGG - Intronic
1096573563 12:52539025-52539047 CCTCTGAAGCCAGAAAGGCTGGG - Intergenic
1097145382 12:56936152-56936174 CCCCTAAGGTCTGATAGGTCAGG + Intergenic
1097374835 12:58829307-58829329 CCACTGAAGTCATACAGGCCTGG - Intergenic
1099404273 12:82241271-82241293 TCTCTGATGTCAGTTAGACCTGG - Intronic
1100568540 12:95823192-95823214 ACTCTGAAGTCAGACAGACCTGG + Exonic
1101736291 12:107465714-107465736 CCCCTGAGGTCAGGTGGGCAAGG - Intronic
1103403746 12:120660391-120660413 CCTCTGCAGTCAGACAGGACTGG + Intronic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1104902875 12:132198630-132198652 CCTTTGGGGTCAGATGGGCTGGG - Intronic
1106804885 13:33295991-33296013 CACCTGAGGTCAGGTAGGTCAGG + Intronic
1107638631 13:42418537-42418559 TCTCTGAAGTCAGACAGACCTGG + Intergenic
1110305691 13:73984462-73984484 CCTCTAACTTCAGAGAGGCCAGG - Intronic
1110444517 13:75564002-75564024 CTTCTGAGATCAGATAGGATTGG + Intronic
1113680613 13:112241526-112241548 CCTGTGAGATCAGATGCGCCTGG - Intergenic
1113975378 13:114224316-114224338 ACTGTGGGGTCAGACAGGCCTGG + Intergenic
1115595252 14:34902993-34903015 CCCCTGAAGTCAGGTAGGCTTGG + Intergenic
1116586237 14:46708320-46708342 CCTCTGGAGTCAGATAGTCCTGG - Intergenic
1117035623 14:51725299-51725321 CCTCTGAAGTCAGATAGATCTGG - Intronic
1118906537 14:70027604-70027626 GCCCTGAAGTCAGATGGGCCTGG + Intronic
1119427354 14:74544339-74544361 CAACTGGAGTCAGATAGGCCGGG + Intronic
1121205084 14:92157993-92158015 CCTATGAGGTCTGCTAGGGCAGG - Intronic
1121432546 14:93898184-93898206 CTGCTGGGGTCAGAGAGGCCAGG + Intergenic
1124380730 15:29162669-29162691 AGTCTGAGCTCAGATACGCCTGG + Intronic
1124719625 15:32100010-32100032 CCTCTGGGGTGAGATGGGCCAGG - Intronic
1125249625 15:37684915-37684937 ACTCTGAGGTCAGATAGAGCAGG + Intergenic
1125334003 15:38609784-38609806 ACTCTGGGGTCTGATAGGCCTGG + Intergenic
1125812867 15:42556693-42556715 CTTTAGAGATCAGATAGGCCAGG - Intronic
1126382133 15:48059891-48059913 CCTCTGAGGTCAGCCATGCATGG + Intergenic
1127700787 15:61498388-61498410 CCTCTGGTGTCAGATACGCTTGG + Intergenic
1128530488 15:68441881-68441903 GCTCTGTGGTCAGAGAGACCTGG + Intergenic
1128532842 15:68466352-68466374 GCCCTGAGGTCAAATGGGCCTGG + Intergenic
1128548339 15:68581985-68582007 GCTCTGAGCTCAGAGAGGCCTGG + Intronic
1128736206 15:70055342-70055364 CCTCAGAGTTCCCATAGGCCTGG + Intronic
1129866050 15:78909687-78909709 GCTCTGGGGTCAGAAAGGGCAGG - Intergenic
1130547291 15:84866434-84866456 CCTCTGGAGTCAGACAGACCTGG - Intronic
1131223566 15:90605633-90605655 CCGCTGAGATCAGAGAGACCTGG - Intronic
1131397616 15:92098964-92098986 GCTTTGAGGTCAGACAGGCCTGG - Intronic
1132555838 16:572289-572311 CCTCAGTGGTCAGAGAGGGCAGG - Intronic
1132883157 16:2171159-2171181 CCTCAGAGGACAGCCAGGCCTGG + Intronic
1134233751 16:12449701-12449723 GCTCTGAAGTGAGACAGGCCTGG - Intronic
1134467561 16:14492809-14492831 GCTCTGAGGCCACACAGGCCTGG + Intronic
1135651879 16:24213366-24213388 GCTCTGATGTCAGATGGACCTGG + Intronic
1135686906 16:24505115-24505137 GCTCTGAGGCCAGACAGGCTTGG - Intergenic
1136008833 16:27349141-27349163 CCTCTGATGAATGATAGGCCAGG + Intronic
1136618696 16:31413693-31413715 GCTATGAGGTCAGAGAGGCCAGG - Intronic
1137491770 16:48938929-48938951 CCCCAGAGTCCAGATAGGCCAGG + Intergenic
1137661731 16:50213019-50213041 CCTCTGAGGCGAGATGGACCTGG - Intronic
1137764564 16:50967957-50967979 CTTCTGAAGTTGGATAGGCCAGG - Intergenic
1138223766 16:55275305-55275327 CTTCTGAAGTCAGACAGGCCTGG - Intergenic
1138269039 16:55681474-55681496 GCTCTGGGGTCAGACAGACCTGG - Intronic
1138341860 16:56295257-56295279 ACTCTGGGGTCAGACAGTCCTGG + Intronic
1138388502 16:56652777-56652799 GCTCTGAGCTCAGATGGGTCAGG + Intronic
1140504193 16:75460102-75460124 CCACTGAGGTGAGGCAGGCCAGG - Intronic
1140511587 16:75512608-75512630 CCACTGAGGTAAGGCAGGCCAGG - Intergenic
1141113488 16:81289136-81289158 TCGTTGAGGTCAGATTGGCCTGG - Intronic
1142143599 16:88483343-88483365 CCTCTGAGGTCAGCACGGCCAGG + Intronic
1142205491 16:88781041-88781063 TTTCTGAGGCCAGAGAGGCCAGG + Intronic
1143061667 17:4207102-4207124 CCTCTGTGGTTAGATAGGTCGGG - Intronic
1143061673 17:4207126-4207148 CCTCTGTGGTTAGATGGGTCGGG - Intronic
1143061687 17:4207174-4207196 CCTCTGTGGTTAGATAGATCGGG - Intronic
1143061692 17:4207198-4207220 CCTCTGTGGTTAGATAGATCGGG - Intronic
1143526450 17:7475836-7475858 CATCTGGGGTCAGCTGGGCCTGG - Intronic
1144790362 17:17855018-17855040 CCTCTGAAGATAGGTAGGCCAGG + Intronic
1144808685 17:17984739-17984761 GCTGTGAGGTCAGACAGGCGTGG - Intronic
1145009829 17:19361797-19361819 GCTTTGAGGTCAGATAGGCGTGG + Intronic
1145305248 17:21670521-21670543 ACTCTGAAGTCAGAAAGACCTGG + Intergenic
1145757534 17:27403614-27403636 GCTCTGAGGTCAGCCCGGCCTGG - Intergenic
1146399965 17:32494488-32494510 CCTCTGGGGTGAGATTGGTCTGG + Exonic
1146691635 17:34880592-34880614 ACTATGAGGTCAGATAGGCCTGG + Intergenic
1147443254 17:40460265-40460287 CTTTCGAGGTCAGAGAGGCCTGG - Intergenic
1148134603 17:45284214-45284236 ACTCTCAGGTCAGACAGACCTGG + Intronic
1148394699 17:47298763-47298785 CCTCTCAGGTCAGGTAGGAGAGG + Intronic
1148732978 17:49848933-49848955 GCTCTGTGGTCACAGAGGCCTGG + Intergenic
1148819243 17:50350996-50351018 CAGATGAGGTCAGAGAGGCCTGG + Intronic
1151736005 17:75940859-75940881 GCTCCGGGGCCAGATAGGCCGGG - Exonic
1151834549 17:76574275-76574297 GCTATGAGGGCAGAGAGGCCTGG + Intronic
1152236520 17:79141905-79141927 CCTGTGAGGTCAGGTAGGGGAGG - Intronic
1152820944 17:82437370-82437392 CCTCTGAGGACAGACTGGCCAGG - Intronic
1154156101 18:11945430-11945452 CCCCTTAGCTCAGATAGGTCTGG - Intergenic
1156269729 18:35519711-35519733 CTTGTGAGGTCAGATGGGCTGGG + Intergenic
1156363418 18:36404135-36404157 CCCAGGAGGTCAGAGAGGCCTGG - Intronic
1157233028 18:45937028-45937050 TCTCTAAGGTCAGTTGGGCCAGG + Intronic
1160334780 18:78029158-78029180 CCTCTGGAGTCTGATGGGCCTGG + Intergenic
1160587905 18:79922872-79922894 CATCAGAGGGCAGAGAGGCCAGG + Intronic
1161309647 19:3586542-3586564 CCTGGGGGGTCAGATAGGCCTGG + Exonic
1161485645 19:4534325-4534347 TCTCTGAGGTGAGAAAGACCTGG + Intronic
1161615655 19:5268815-5268837 CTTCTGAGCTCAGCCAGGCCTGG - Intronic
1162031613 19:7919977-7919999 GCTCTGGGGTCAGACAGGCCTGG - Intergenic
1163007473 19:14405967-14405989 GCTCTGGGGTCAGGGAGGCCTGG + Intronic
1163459810 19:17430236-17430258 CCTCTGAGCCCAGGCAGGCCTGG + Intronic
1164587252 19:29483781-29483803 CAGCTGAGGTCAGATAGACCTGG - Intergenic
1165063149 19:33214656-33214678 CCTCACTGGTCAGCTAGGCCCGG + Intronic
1168070181 19:53945195-53945217 GCTCTGAGGTCAGACAGGCTGGG - Intergenic
1168115710 19:54220491-54220513 CCTTTGAGCTCAGAGAGGACGGG + Intronic
1168118696 19:54240237-54240259 CCTTTGAGCTCAGAGAGGACGGG + Intronic
1168125026 19:54278223-54278245 CCTTTGAGCTCAGAGAGGACAGG + Intronic
1168181301 19:54664500-54664522 CCACTGAGCTCAGAGAGGACAGG - Intronic
1168185774 19:54698512-54698534 CCTTTGAGCTCAGAGAGGACAGG - Intronic
925409582 2:3632204-3632226 CCTCTGCCATCAGACAGGCCTGG - Intronic
925685694 2:6470667-6470689 CCTCTCAGGCCAAAAAGGCCAGG - Intergenic
925926002 2:8671171-8671193 ACTTTGAGGTCAGATGGGCGTGG + Intergenic
926754330 2:16223412-16223434 GCTCTGGGGGCAGAGAGGCCTGG - Intergenic
927730449 2:25466427-25466449 GCTCTGAAGTCACCTAGGCCTGG - Intronic
929123752 2:38504265-38504287 CCTCTCAGGTCACATAGGCAAGG + Intergenic
933236171 2:79866970-79866992 GCTATGAGGTCAGATTGGTCTGG - Intronic
937082363 2:119149431-119149453 CCTTTGACGTCAGATAGACCTGG + Intergenic
937124552 2:119465164-119465186 CCTCAGAGTTCTCATAGGCCGGG - Intronic
937215998 2:120314004-120314026 CCTCTGAGGTCAGCTTGCTCGGG - Intergenic
937422039 2:121765383-121765405 CCGCTGAGGTCAGCAAGGCCAGG - Exonic
937632191 2:124115549-124115571 ATTCTGAAGTCAGATAGACCTGG + Intronic
941864939 2:170324961-170324983 TCTCTGAGGTGAGACAAGCCAGG - Intronic
943663468 2:190584192-190584214 CCTCTGAGGTCAAAGAGGTAGGG + Intergenic
945040740 2:205741840-205741862 CCTGTGAGGTAAGGTGGGCCAGG + Intronic
945441816 2:209888423-209888445 TCTCTGCAGTCAGAGAGGCCTGG + Intronic
946099011 2:217302813-217302835 GCTTTGGGGTCAGACAGGCCTGG + Intronic
946460490 2:219864296-219864318 CCCCTGAGGTCATAAAAGCCAGG - Intergenic
947500394 2:230667031-230667053 CCTCTGGGGCCAGGCAGGCCTGG + Intergenic
947543737 2:230996062-230996084 CCTGTGAGGTCATAAAAGCCAGG - Intergenic
948020025 2:234724385-234724407 TCTCTCAGGCCAGTTAGGCCTGG - Intergenic
948295366 2:236856543-236856565 CATCTGAGGACAGAAAGGCAGGG + Intergenic
948385394 2:237577681-237577703 CCTTTGAGGACAGCTAGGCGTGG - Intronic
1170425909 20:16235448-16235470 ACTCTGAAGTCAGAGAGGACAGG + Intergenic
1170601719 20:17846434-17846456 CCTCTGGCTTCAGATAGGCTTGG - Intergenic
1171330848 20:24337714-24337736 CCACTGAGGACAGCTTGGCCCGG + Intergenic
1171522764 20:25787994-25788016 ACTCTGAAGTCAGAAAGACCTGG + Intronic
1171530507 20:25849963-25849985 ACTCTGAAGTCAGAAAGACCTGG + Intronic
1171554063 20:26067889-26067911 ACTCTGAAGTCAGAAAGACCTGG - Intergenic
1171723014 20:28584300-28584322 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1171755070 20:29099152-29099174 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1171787617 20:29483740-29483762 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1171860337 20:30395641-30395663 CCTCTGGAGTCAGCTGGGCCTGG - Intronic
1172512528 20:35510347-35510369 CCTCTGAGGGCAGGGAGGCCAGG - Intronic
1172583041 20:36063823-36063845 CCTGTGAGATCAGAGAAGCCAGG - Intergenic
1173159668 20:40643116-40643138 CCTCTGGGGCCAGATGGGGCTGG + Intergenic
1174852862 20:54012865-54012887 CCTCTGAAATCAGCTGGGCCTGG - Intronic
1175160240 20:57002928-57002950 CCTCAGGGGACAGAGAGGCCAGG - Intergenic
1175328098 20:58143609-58143631 CCTTTCAGGTAAGATAGTCCTGG + Intergenic
1175695344 20:61099255-61099277 ACTCTGTGGTCAGATAACCCTGG - Intergenic
1179728085 21:43351626-43351648 GCTCTGAGGTCATCTAGGGCAGG - Intergenic
1180412102 22:12623025-12623047 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1181773931 22:25146270-25146292 GGTCTGAGGTCAGACAGACCTGG - Intronic
1181894387 22:26093921-26093943 CCTCTGGAGTCAGGCAGGCCTGG + Intergenic
1181959216 22:26610867-26610889 GCTTTGAGGTCAGACAAGCCTGG - Intronic
1182511028 22:30820546-30820568 CCTCTGAGGTCAGCCAGACCAGG + Intronic
1182840479 22:33385317-33385339 CACCTGAGGTCAGATTAGCCTGG + Intronic
1183439159 22:37813459-37813481 CCTCTGGGGTCAGCAGGGCCTGG - Exonic
1183798060 22:40137348-40137370 CCTCTGGAGTCAGACAGGCCTGG - Intronic
949552781 3:5125062-5125084 CCTTTGAAGTCAGACAGCCCTGG + Intronic
950107190 3:10395803-10395825 GCACTGAGGTCAGATTGGGCTGG + Intronic
953136870 3:40189370-40189392 CCTCTGAGGTCTGCCAGGGCAGG + Intronic
953440840 3:42915726-42915748 ACTCTGCAGTCAGATAGGCCTGG - Exonic
953970152 3:47341036-47341058 GTTCTGTGGTCAGATAGGCTTGG + Intronic
954191868 3:48968689-48968711 CCTCTGATGGAAGGTAGGCCCGG - Intronic
956051234 3:65250767-65250789 CCTCTGGGGTGAGACAGTCCTGG - Intergenic
956849020 3:73211346-73211368 CTTTTGAGGTCAGATATGCCGGG - Intergenic
957323172 3:78658498-78658520 CATCTGAGGTCAGGCCGGCCTGG - Intronic
957837346 3:85613825-85613847 TCTCTGAAGTCTGACAGGCCAGG + Intronic
960460717 3:117931731-117931753 GCTTTGGGGTCAGAAAGGCCTGG - Intergenic
961042784 3:123689127-123689149 CCTCTGTGGTCACAAAGCCCTGG + Intronic
962199412 3:133389158-133389180 CTTCTGAGGTCAGAGAGGTGGGG - Intronic
962636001 3:137332068-137332090 CCTTTGGGGTCAGAGAGCCCAGG - Intergenic
962837585 3:139202836-139202858 TCCCTGAGGTTAGCTAGGCCAGG + Intronic
962960734 3:140309223-140309245 CCTCGGATGCCAGGTAGGCCAGG - Intronic
963088319 3:141459113-141459135 CCTGTGAGGTCCTATAGGGCTGG - Intergenic
964809379 3:160646948-160646970 CCTCTGGAGTCAGACAGACCTGG - Intergenic
967467232 3:189822007-189822029 GCTTTGTGGTCAGATAGACCTGG + Intronic
969538553 4:7771680-7771702 GCTCTGGGGTCACACAGGCCAGG - Intronic
974397338 4:61354701-61354723 CCTCTGGGTTCAGAGAGGCCAGG + Intronic
977124794 4:93151267-93151289 CATCTGAGGTCTGGTATGCCTGG + Intronic
978424104 4:108564124-108564146 GCTCTGACGTCAGACAGCCCTGG - Intergenic
982297463 4:153844348-153844370 GCTCTGAGGTAAGACATGCCTGG + Intergenic
985438502 4:189959463-189959485 CCTCTGGAGTCAGCTGGGCCTGG - Intronic
988593677 5:32571139-32571161 CCTCTGGAGTCCAATAGGCCTGG + Intronic
990902819 5:60771537-60771559 ACTCTGATGTCAGACAGACCTGG + Intronic
991069545 5:62461299-62461321 CCTATTAGGTCAGTTTGGCCAGG - Intronic
994674765 5:102806297-102806319 TCTCTGAGGGCAGGTAAGCCAGG + Intronic
995648756 5:114343846-114343868 CCTCTGATGTCTGATGGGCAGGG + Intergenic
995725162 5:115174216-115174238 GCTCTGAGATCAGACAGGCAGGG + Intronic
995730033 5:115229143-115229165 GCTATGAGGTTAGATAGGCTGGG - Intronic
996327600 5:122293204-122293226 CTTCTGAGCTCAGATAGGCCAGG + Intergenic
997361339 5:133296989-133297011 CCTCTAAGGTCACATGGGCAGGG + Intronic
998413438 5:141928403-141928425 CCTCTGACTTCAGATAGGAAAGG - Intronic
999250124 5:150177536-150177558 TTTCTGAGGCCAGATAGACCTGG + Intronic
999279194 5:150353832-150353854 CCCCTGAGATCAGAGAGGGCTGG - Intergenic
1000260260 5:159581344-159581366 ACTCTGGAGTCAGATAGGCTGGG + Intergenic
1001639778 5:173236172-173236194 CCTCTGAGCCCAGCTAGGCCAGG + Intergenic
1002349754 5:178575855-178575877 TCTCTGAGGACACATATGCCTGG - Intronic
1002632736 5:180591702-180591724 CCTCTGAGAGCAGGCAGGCCCGG + Intergenic
1003156001 6:3595076-3595098 GCTGTGAGGTCAGACAGGCGTGG - Intergenic
1003184584 6:3819970-3819992 CCTGGTAGGTCAGCTAGGCCTGG - Intergenic
1006727633 6:36211283-36211305 CCTCTGGGGACAAATGGGCCCGG - Exonic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1008515317 6:52313486-52313508 CCTCTGAGATTAGAAATGCCTGG + Intergenic
1008618008 6:53244912-53244934 CCTCTGTGGTCAAATAAGCTTGG - Intergenic
1010856288 6:80844364-80844386 CCTCTGAGGTCAAATAGGCATGG - Intergenic
1015901620 6:138074094-138074116 CCTCTGAGGTCACCTCAGCCTGG - Intergenic
1016350977 6:143166894-143166916 CATTTGAGGCCAGATAGGCCTGG - Intronic
1017080031 6:150659395-150659417 GCTCTGGGGTCAGCTAGACCTGG + Intronic
1018273306 6:162103719-162103741 CTTCTGAGCCCAGAAAGGCCCGG + Intronic
1019950014 7:4364538-4364560 CCTTTGAGGTCAGCGTGGCCAGG - Intergenic
1020108667 7:5435423-5435445 TCACTGAGGTCTGATGGGCCAGG - Intronic
1020242753 7:6408610-6408632 CTTCTGAGGTCAGATTTCCCGGG + Intergenic
1021637885 7:22709362-22709384 CCTCTGAGGTGTGATAAGGCAGG + Intergenic
1021894896 7:25224024-25224046 CCTCTGAGGTGAGAAAGGGGAGG + Intergenic
1022515618 7:30973470-30973492 CCTCTGAGTTCAGTTGGCCCAGG - Intronic
1023168980 7:37372274-37372296 CCTCTGAGGTCAGAAGGCCAGGG + Intronic
1023262336 7:38370503-38370525 TCTCTGTGGTCAGAGAGCCCTGG - Intergenic
1023454767 7:40326253-40326275 GCTTTGGGGTCAGACAGGCCTGG + Intronic
1023865285 7:44235413-44235435 CCTCAGAGGTCAGAGGGGCCTGG + Intronic
1023983575 7:45082826-45082848 GCCCTGAGGTCAGCCAGGCCCGG - Exonic
1024659731 7:51482033-51482055 GCTTTGAAGTCAGACAGGCCTGG - Intergenic
1028802336 7:94980691-94980713 CCTCAGAGATAAGGTAGGCCAGG - Intronic
1032506938 7:132442721-132442743 ACTGTGAGGTCAGGTTGGCCTGG - Intronic
1032643801 7:133798674-133798696 GGTCTGAGGTCAGACAGGCCTGG - Intronic
1034965659 7:155389099-155389121 CCTCTGGGGTCAGATGGGAGCGG + Intronic
1037289637 8:17336918-17336940 GCTCTGGGGTTAGATAAGCCTGG + Intronic
1037776380 8:21838570-21838592 GCCCTGAGGTCAGACAGGCTGGG + Intergenic
1038069560 8:23999052-23999074 CTTCTGAGGACTTATAGGCCTGG + Intergenic
1039742653 8:40396604-40396626 CCTGTGAGGTCAGCTGGGGCTGG - Intergenic
1039953530 8:42190546-42190568 CTTCTGAGGTCACTGAGGCCAGG + Intronic
1040960506 8:53027213-53027235 CCTCTGCAGTCAGAAAGGCAGGG + Intergenic
1041257710 8:55993513-55993535 ACTTTGAGGTCAGACACGCCTGG + Intronic
1043299854 8:78714666-78714688 CCTCTGATTTCGGATAGCCCAGG + Intronic
1043569305 8:81584354-81584376 CCACTCAGATCAGATTGGCCTGG + Intergenic
1044627905 8:94252244-94252266 TCTGTGAGTTCAGTTAGGCCTGG + Intronic
1045045516 8:98272195-98272217 GCTCTGAAGTCAAATAGACCTGG - Intronic
1046533142 8:115472908-115472930 CATCTGAGATCAGCTAAGCCTGG + Intronic
1046947638 8:119988898-119988920 GCTCTGATCTCAGATAGCCCAGG - Intronic
1046998053 8:120546029-120546051 GCTTTAAAGTCAGATAGGCCTGG - Intronic
1047019299 8:120757732-120757754 CCTCTGTGGTCACAGTGGCCAGG - Intronic
1047749172 8:127867078-127867100 CATCTGAGGCCAGCTAAGCCAGG - Intergenic
1048290927 8:133181265-133181287 CCTCTCAGCTCAGATAAGCCTGG - Intergenic
1049859680 8:144890041-144890063 CCTCGAAGGTCAGCTTGGCCTGG + Exonic
1050499001 9:6274584-6274606 CCTGTGAAGTCATTTAGGCCTGG - Intergenic
1053173213 9:35905452-35905474 CCACTGAGCTCAGAGAGGGCAGG - Intergenic
1053276203 9:36785475-36785497 CCTCAGAGGTCATCTAGTCCAGG - Intergenic
1053747521 9:41214799-41214821 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1054338862 9:63835726-63835748 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1054455007 9:65425975-65425997 CCTCAGAGCTCAGATATCCCTGG - Intergenic
1054479764 9:65650569-65650591 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1054783072 9:69184045-69184067 CCTCTGAAGTCAAATAAACCTGG + Intronic
1056220879 9:84449842-84449864 CACCTGAGGTCAGACCGGCCTGG + Intergenic
1057167894 9:92942612-92942634 GCACTGAGGTCAGAGAGCCCAGG + Intergenic
1057702609 9:97374729-97374751 ACTCTGAAGTCAGACAGACCTGG + Intronic
1057834136 9:98430533-98430555 CCTCAGAGCTCAGGCAGGCCTGG - Intronic
1058006229 9:99918338-99918360 GCTTTGAGATGAGATAGGCCTGG - Intronic
1059283280 9:113152289-113152311 GCTTTGTGGTCAGATAGGCAAGG - Intronic
1060819089 9:126651334-126651356 GGTCTGGGGACAGATAGGCCAGG - Intronic
1060862313 9:126964605-126964627 CCTCTGAGGTCAGATAGGCCTGG - Intronic
1061013209 9:127967459-127967481 GCTCTGGGGTCAGACAGCCCTGG - Intronic
1061180663 9:129023358-129023380 CCTCTTAGATCAGAGGGGCCAGG - Intronic
1061478165 9:130883027-130883049 CGTCTGGGCTCAGACAGGCCTGG + Intronic
1062317810 9:135977116-135977138 CCTCTGCGGCCAGCTGGGCCGGG + Intergenic
1062504201 9:136865131-136865153 CCTTTGAGGCCAGTTGGGCCAGG - Intronic
1202783653 9_KI270718v1_random:25570-25592 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1202803422 9_KI270720v1_random:23997-24019 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1203775546 EBV:71183-71205 GCTCTAGGGTCAGAGAGGCCAGG + Intergenic
1203448221 Un_GL000219v1:81220-81242 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1186652013 X:11571306-11571328 ACTCTGATGCCAGATAGGCTGGG + Intronic
1187495245 X:19789791-19789813 CCTCTGGGGTCAAATAGTTCTGG - Intronic
1190496639 X:51033352-51033374 CCTCTGAGAGCAGATAGCACAGG + Intergenic
1190509333 X:51160585-51160607 CCTCTGAGAGCAGATAGCACAGG - Intergenic
1193754111 X:85385383-85385405 GTTTTGCGGTCAGATAGGCCGGG + Intergenic
1196845852 X:119896379-119896401 TCTCAGAGGCCAGATAGGCAGGG - Intronic
1197720129 X:129739308-129739330 CCTCTGAGCTCAGAAAGGGTTGG + Intronic
1197860548 X:130965503-130965525 CCTGTTAGGTCAGATTAGCCAGG - Intergenic
1198098293 X:133401698-133401720 CCTCTCAGATCTGATGGGCCTGG - Intronic
1198191992 X:134316245-134316267 TCTCTGAGGTCAGGTAGAGCTGG - Intergenic
1199850647 X:151723047-151723069 CCGCTGAGGTCAGGAAGGCAAGG - Exonic