ID: 1060867719

View in Genome Browser
Species Human (GRCh38)
Location 9:127013253-127013275
Sequence ACAGAACCAAGGCCATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060867719_1060867726 5 Left 1060867719 9:127013253-127013275 CCCCACTATGGCCTTGGTTCTGT 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1060867726 9:127013281-127013303 CTGGCAGAGCAAGTGTTGTTTGG No data
1060867719_1060867727 6 Left 1060867719 9:127013253-127013275 CCCCACTATGGCCTTGGTTCTGT 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1060867727 9:127013282-127013304 TGGCAGAGCAAGTGTTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060867719 Original CRISPR ACAGAACCAAGGCCATAGTG GGG (reversed) Intronic
901557130 1:10040571-10040593 AGAGCACCAAGGCCAGAGTGGGG - Intronic
903447203 1:23430302-23430324 ACACAACCAATGCCATTCTGAGG + Intronic
905919420 1:41709587-41709609 ACAGAACCAAGCCCCAAGTGGGG + Intronic
906474175 1:46156746-46156768 GCAGTACCAGGGCCAGAGTGTGG - Intronic
907718894 1:56953249-56953271 ACAGAACCAAGGCCAATAAGTGG - Intronic
908122046 1:60995060-60995082 ACAGTACCAAGGCCATACCAAGG - Intronic
910151071 1:84146819-84146841 ACAGAACAAAGGCCACATAGTGG + Intronic
912804106 1:112742388-112742410 CCAGAGCCTAGGCCATAGTGGGG + Intergenic
913144915 1:115978953-115978975 ACAGCAACAAGGCCAGAGAGAGG + Intronic
914349664 1:146830077-146830099 AAAGGAGCAAGGTCATAGTGAGG - Intergenic
915296739 1:154926552-154926574 ACAGAACCCAGGGCAGTGTGGGG + Intronic
916235916 1:162587923-162587945 ACAGAACCTAGCACATAGTTGGG - Intronic
916443262 1:164848020-164848042 TCAGGACCAAGAACATAGTGTGG - Exonic
917642469 1:176996470-176996492 ACAGAATGTAGGGCATAGTGAGG - Intronic
917847181 1:179029704-179029726 ACAGAACCAAGTACAGAGGGAGG + Intronic
922183917 1:223257642-223257664 ACAGAAGAAAGGTCATATTGGGG - Intronic
1064409517 10:15092955-15092977 ACAGAGCCAAGGCCTGACTGCGG + Intergenic
1064994674 10:21286079-21286101 AAAGAGCCAAGGTCATAGTGAGG - Intergenic
1067265576 10:44740169-44740191 ACAGTACCAAGACCATTGAGGGG + Intergenic
1071502731 10:86215080-86215102 AGAGAACCAAGGGGACAGTGGGG + Intronic
1071524865 10:86352741-86352763 GCAAAACCAAGGCCAGACTGGGG - Intronic
1071853385 10:89598693-89598715 ACAGCCCCATGGCCATGGTGGGG - Intronic
1073435797 10:103514901-103514923 ATAGAACTAAGGCCACAGGGTGG - Intronic
1075173951 10:120142450-120142472 ACAGCATCATGGCCCTAGTGAGG + Intergenic
1076388740 10:130079759-130079781 CCAGCACCAAGGCCAGAGAGTGG - Intergenic
1076550788 10:131277085-131277107 ACAGAATCAAGGCATTGGTGGGG + Intronic
1076864895 10:133161643-133161665 ACCGAATCCAGGCCATGGTGGGG - Intronic
1077769520 11:5200307-5200329 ACCGGTCAAAGGCCATAGTGAGG + Exonic
1078408807 11:11094565-11094587 GCAGAACCAAGACCAAGGTGTGG + Intergenic
1078665951 11:13325357-13325379 AAAGAACCAATGACTTAGTGTGG - Intronic
1079288341 11:19161344-19161366 ACAGAAACAAGCTCATGGTGTGG + Intronic
1079822748 11:25151485-25151507 TGAGAACAAAGGCCACAGTGTGG - Intergenic
1081082063 11:38754317-38754339 ACAGATGCAAGGCCATTATGTGG - Intergenic
1085720490 11:78908111-78908133 CCTGAACCAAGATCATAGTGAGG + Intronic
1091262301 11:134244457-134244479 GCAGAACTGAGGCCATAGTGAGG + Intronic
1092641104 12:10510741-10510763 ACAGACCCAAGGCCACTGTTAGG + Intronic
1094168164 12:27463932-27463954 ACAGAAGCAAAGCAACAGTGCGG + Intergenic
1095747556 12:45676461-45676483 ACAGAACTAAGGTCAGAGTGGGG - Intergenic
1095840237 12:46684675-46684697 ACAGAACTTGGCCCATAGTGGGG - Intergenic
1096190775 12:49617119-49617141 ACAGTTCAAAGGCCATAGTTTGG + Intronic
1096539153 12:52294533-52294555 CCAGAGCCAAGACCATAGAGTGG - Intronic
1097622179 12:61952963-61952985 AGAGAACCAAGACCAAAGTCTGG + Intronic
1101063442 12:100995289-100995311 ACAAAACCAAGGCCCTAATCTGG + Intronic
1103353166 12:120299605-120299627 ACAGACCGAGGGCTATAGTGTGG + Intergenic
1104872429 12:132009525-132009547 ACAGCACCGAGGCCAGTGTGAGG + Intronic
1105966772 13:25391779-25391801 ACAGAAGGAAGGCCACAGTGGGG + Intronic
1106199483 13:27524418-27524440 ACAGAACCAGGGACACAGAGGGG + Intergenic
1106639851 13:31572764-31572786 TCTGAACCAATGCCATAATGGGG + Intergenic
1107643228 13:42466307-42466329 TTAGAACCAAGGAAATAGTGCGG + Intergenic
1109361299 13:61298507-61298529 TCAGAACCAAAGCCCTGGTGGGG - Intergenic
1112338191 13:98531807-98531829 ACAGAGCAGAGGCCATTGTGGGG - Intronic
1113254727 13:108495242-108495264 ACAGAACAAAGGCCATCGCGGGG - Intergenic
1115878924 14:37892841-37892863 AGAGAACCAAGGCCAGAATTAGG + Intronic
1121978206 14:98426256-98426278 AGAGAACCAAGGCAATAAAGGGG - Intergenic
1122494517 14:102143105-102143127 AGCGAACCAAGGCCAGAGAGGGG + Intronic
1129776038 15:78237111-78237133 ACAGAAGCAAGGCCCTGGGGAGG + Intronic
1132057057 15:98660315-98660337 GCAGAATCAAGGCCAGAGAGAGG - Intronic
1132165313 15:99581563-99581585 GCAGAACCTAGGCCATTGTATGG - Intronic
1132638323 16:964938-964960 ACAGAACAGACGCCACAGTGCGG + Intronic
1133998080 16:10762716-10762738 AGGGAACCAAGGCCAGTGTGAGG + Intronic
1134245062 16:12533627-12533649 ACAGAACCAAGGCCCCAATTTGG - Intronic
1138600120 16:58049127-58049149 ACAGTGCCCAGGCCACAGTGGGG + Intergenic
1138742910 16:59331516-59331538 TCAAAACCAGGACCATAGTGAGG - Intergenic
1139984371 16:70885469-70885491 AAAGGAGCAAGGTCATAGTGAGG + Intronic
1141235485 16:82211949-82211971 AAAGAACCAAGGAAAAAGTGTGG + Intergenic
1142104732 16:88296172-88296194 ACAGCCCCAAGGCCATAGGGTGG + Intergenic
1142235086 16:88918322-88918344 ACAGGGCCCAGGCCATGGTGGGG - Intronic
1143152553 17:4816546-4816568 ACAGAGCCAGGGCCAAAGAGAGG - Intronic
1148998060 17:51729213-51729235 CCAGCACCAAGGCCTAAGTGTGG - Intronic
1150940836 17:69692403-69692425 ACATCACCAAGCCCAGAGTGAGG + Intergenic
1153823034 18:8848690-8848712 AAAGAAAGAAGGCTATAGTGAGG + Intergenic
1155437898 18:25832237-25832259 ACAGAACCAAGGCCTGGCTGGGG - Intergenic
1156586525 18:38437286-38437308 ACAGAACCTAGGGGATAGTTTGG - Intergenic
1157300018 18:46472525-46472547 ACAGGCCCCAGGGCATAGTGTGG - Intergenic
1160864954 19:1252385-1252407 AGAGAACAAAGGCCAGAGAGAGG - Intronic
1163698687 19:18776503-18776525 TCAGAGCCCAGGCCACAGTGGGG - Intronic
1164502103 19:28828732-28828754 ACGGCACCCAGGCCATGGTGGGG + Intergenic
1166951431 19:46430756-46430778 CCAGAAACCAGGCCATAGTCAGG + Intergenic
1168116824 19:54226384-54226406 ACAAAATCAAGGCCATAACGTGG - Intronic
1168662149 19:58175709-58175731 AAAGAACCAAGGCCATACACTGG + Intergenic
925633999 2:5924833-5924855 AGAGAACTATGACCATAGTGAGG + Intergenic
928243838 2:29610001-29610023 ACAAAACCAGGGCCAATGTGTGG - Intronic
930111052 2:47678982-47679004 AAAGAAAACAGGCCATAGTGAGG + Intergenic
930170069 2:48242388-48242410 ACAGAACCCAGCCCTCAGTGGGG - Intergenic
932886089 2:75550394-75550416 AGAGGACCTAGACCATAGTGGGG - Intronic
935953461 2:108351885-108351907 ACAGAAACAAGGCCAAAGGCTGG + Intergenic
940971275 2:159899614-159899636 TCAGATCCAAGTACATAGTGAGG + Intronic
944932078 2:204530044-204530066 ACACTCCCAAGGCCAAAGTGCGG - Intergenic
946171107 2:217896125-217896147 ACAGAAGCTAGGGCTTAGTGAGG + Intronic
946475757 2:220005099-220005121 AGAAAACAAAGGCCAGAGTGGGG + Intergenic
947717523 2:232349351-232349373 ACACAGCCCAGGCCACAGTGTGG - Intergenic
1170604270 20:17863965-17863987 CCGGAACCAAGGCCATAGCCTGG + Intergenic
1171322633 20:24259830-24259852 ACAGAACTCAGGTCCTAGTGTGG - Intergenic
1173733959 20:45346760-45346782 AAGGAAACAAGGCCAGAGTGAGG - Intronic
1175025066 20:55893446-55893468 AGTGAACCAAGCCCAGAGTGGGG - Intergenic
1179643858 21:42763552-42763574 CCAGAACCAAGATCAAAGTGTGG - Intronic
1180247334 21:46557029-46557051 GCAAAACCAAGGCCACAGTAGGG - Exonic
1184120220 22:42445062-42445084 GCAGAACCAAGGACCCAGTGAGG + Intergenic
1184318925 22:43723922-43723944 ACAGACCCAAAGCCATAGGAAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
1185148793 22:49152837-49152859 ACAGAAGCAAAGCCATAGTGAGG - Intergenic
949952270 3:9238981-9239003 GCAGCACCAAGGCCCTTGTGAGG - Intronic
949964429 3:9343361-9343383 TAAGAACCAAGGTCATGGTGTGG - Intronic
951673806 3:25214718-25214740 AAAGAACCTAGCCCAAAGTGAGG - Intronic
953101248 3:39830514-39830536 AGAAAACCAAAGCCATTGTGAGG + Intronic
953393783 3:42550142-42550164 ACTGTATCAAGGCCAGAGTGTGG - Intronic
954137913 3:48590612-48590634 TCAGAACCAGGACCAGAGTGAGG + Intronic
954155732 3:48684107-48684129 ACAGAGCCAAAGCCAGAGTGTGG + Intronic
956225174 3:66949575-66949597 ACAACCTCAAGGCCATAGTGAGG - Intergenic
956700813 3:71956960-71956982 ACAGTAGCAATGCCACAGTGAGG + Intergenic
957066351 3:75525566-75525588 CCAGAATCAAAGCCAAAGTGTGG + Intergenic
957930311 3:86869727-86869749 ACAGCACTAAGGCCAGAGTTAGG - Intergenic
960336543 3:116424633-116424655 ACAGAAGAGAGGACATAGTGTGG + Intronic
962740158 3:138357442-138357464 AGAGAAGAAAGGCCAGAGTGTGG - Intronic
962896414 3:139718828-139718850 AGAGAACCACAGCCTTAGTGAGG + Intergenic
963149107 3:142025421-142025443 ACAGCAACAAGGACATAGTTTGG - Intronic
964401061 3:156299100-156299122 AGAGGGCCAAGGCCAAAGTGAGG + Intronic
965602506 3:170469071-170469093 CCAGTGCCTAGGCCATAGTGTGG - Intronic
968132273 3:196198618-196198640 ACAGAGCCAAGGACGTAGGGAGG + Intronic
969358204 4:6643848-6643870 ACAGAAAAAGGGCCTTAGTGGGG - Intergenic
969477469 4:7429702-7429724 CCTGAACCAAGGCCACAGAGTGG + Intronic
969891620 4:10265114-10265136 ACAGTCCCAATGCCATAATGCGG + Intergenic
975996573 4:80322130-80322152 ACAGAACCGAGGGCTTACTGGGG - Intronic
981007857 4:139894038-139894060 ACAGAACCAATGCAAGAGAGGGG + Intronic
982916686 4:161219414-161219436 ACAGAACCAAGGTGATACAGTGG + Intergenic
983854771 4:172630334-172630356 TCAAAACCAAGGTCATGGTGTGG + Intronic
986928983 5:12795024-12795046 ACACATCCAAGGACATGGTGAGG - Intergenic
988919858 5:35930601-35930623 GCAGAACCAAGACTAGAGTGGGG - Intronic
990641124 5:57784682-57784704 ACAGCACAAAGGCCAGAGAGAGG + Intergenic
992323367 5:75636374-75636396 AAAGAACCAAGGCAAGAGTATGG + Intronic
993805110 5:92397520-92397542 ACAGAGTCAAGGACATAGTGGGG + Intergenic
994605899 5:101966229-101966251 ACAGAACAGAGTCCATAGTATGG - Intergenic
994722791 5:103400262-103400284 ACAGAAGAAAGGCCAGAGTTTGG - Intergenic
997037105 5:130205930-130205952 CCAGAAGCAAGGCCATACTGTGG - Intergenic
1000011609 5:157238700-157238722 TCAGACCCACGGCCATAGGGAGG - Intronic
1000045942 5:157522052-157522074 ACAGAGACCAAGCCATAGTGTGG + Intronic
1002780433 6:361031-361053 AAACAAGCAAGGCCACAGTGAGG - Intergenic
1002876651 6:1216354-1216376 ACAGGGCCAGGGCCAGAGTGAGG - Intergenic
1003432536 6:6053125-6053147 AGAAAACCAAGGCCATAGGGGGG + Intergenic
1004054018 6:12116287-12116309 CGAGAACCAAGGCCCTAGAGTGG - Intronic
1005521665 6:26606650-26606672 AAAGATCCAAAACCATAGTGAGG + Intergenic
1006016146 6:31082639-31082661 ACAGAACAAAAGCTATAGTCCGG - Intergenic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1007165695 6:39827533-39827555 ACAGAGCCAAGGCGTGAGTGAGG - Intronic
1007504820 6:42327487-42327509 ACAGAGCCTAGTCCATAATGAGG + Intronic
1010788124 6:80029608-80029630 ACTGAAACGAGGCCACAGTGTGG + Intronic
1013537336 6:111075237-111075259 ACTGAAGCAAGGCCATGCTGAGG + Intergenic
1014648725 6:124008541-124008563 TCAGAACTAATGCCATTGTGAGG + Intronic
1015552850 6:134430312-134430334 ACAGGACCAGGGCCAGAATGTGG + Intergenic
1016295589 6:142570242-142570264 ACTGAAACAAGGCCAGACTGTGG - Intergenic
1017426730 6:154329933-154329955 ACAGCACGGAGGCCAGAGTGGGG - Intronic
1018321304 6:162612265-162612287 ATAGAACCAGGACCAAAGTGTGG + Intronic
1019852613 7:3574556-3574578 CCAGAGCCAAGGGCATAGTGGGG - Intronic
1020509142 7:9030679-9030701 TCAGAACCAAGGCAATATTCTGG + Intergenic
1021197807 7:17692027-17692049 GCAGAACCATGCCCATATTGTGG - Intergenic
1022522260 7:31016024-31016046 ACAGAACCAAAGCCAGCATGAGG - Intergenic
1023482062 7:40644924-40644946 ACAGAAACACAGCCACAGTGCGG - Intronic
1024556124 7:50604951-50604973 ACAGAGCCCAGGCCTGAGTGGGG - Intronic
1026129390 7:67607502-67607524 ACAGAAGTAAGGCCATGGAGGGG + Intergenic
1027691760 7:81355157-81355179 ATAGAACCAAGTAAATAGTGTGG - Intergenic
1028285651 7:88995104-88995126 ACAGAACCATGGCAATAGATAGG - Intronic
1032311163 7:130788618-130788640 TCAGAAACAAGGCAAGAGTGAGG - Intergenic
1035462291 7:159049502-159049524 CCAGAGCCAGGGCCATAGCGAGG + Intronic
1035618516 8:1020753-1020775 ACAGAACCCAGGGCACAGAGGGG + Intergenic
1036587593 8:10138797-10138819 GCAGAACTAAGGCCAAAGGGTGG + Intronic
1038299138 8:26325705-26325727 AAAGTACCAAGGCCAAAGAGGGG - Intronic
1040298786 8:46177209-46177231 GCAGAAACAAGGCCACAGCGTGG + Intergenic
1040299713 8:46181535-46181557 GCAAAAACAAGGCCACAGTGTGG - Intergenic
1040960654 8:53028741-53028763 ACAGAACAAAAGCCAAAGTAGGG + Intergenic
1043952777 8:86327579-86327601 ACATGCCCAAGGCCAGAGTGGGG + Intergenic
1045244377 8:100430090-100430112 ACAGAACCATCGCCATATAGAGG + Intergenic
1047811660 8:128417200-128417222 ACAGTTCGAAGGCCACAGTGTGG + Intergenic
1048333475 8:133486557-133486579 AGAGAAACAGGGCCACAGTGAGG + Intronic
1050611399 9:7357724-7357746 ACAGAGCCAGTGCCATGGTGTGG + Intergenic
1057570706 9:96202330-96202352 ACAGAAACTAGGCCATGGTCAGG - Intergenic
1060867719 9:127013253-127013275 ACAGAACCAAGGCCATAGTGGGG - Intronic
1194981934 X:100450055-100450077 ACAGAAGCCAGGCCACTGTGCGG - Intergenic
1198658589 X:138941876-138941898 TCAAAACCAAGGCCATAATCTGG + Intronic
1199591970 X:149475925-149475947 CCAGAACCAAGGTGCTAGTGAGG - Intergenic
1199757773 X:150881232-150881254 ATAGAGCCAAGGCCACAGAGTGG - Intronic
1199852012 X:151730706-151730728 AGTGAACCAAGACCATAGGGTGG - Intergenic