ID: 1060870421

View in Genome Browser
Species Human (GRCh38)
Location 9:127035364-127035386
Sequence TTGGATCAACTGAGGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060870413_1060870421 19 Left 1060870413 9:127035322-127035344 CCTGTGCTCCAGGTATGAAGATC 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG No data
1060870411_1060870421 29 Left 1060870411 9:127035312-127035334 CCAACAAGAACCTGTGCTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG No data
1060870415_1060870421 11 Left 1060870415 9:127035330-127035352 CCAGGTATGAAGATCTGGAATGA 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060870421 Original CRISPR TTGGATCAACTGAGGGAGGT AGG Intronic
No off target data available for this crispr