ID: 1060870535

View in Genome Browser
Species Human (GRCh38)
Location 9:127036278-127036300
Sequence CTCCAATGGCTGACCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060870535_1060870541 4 Left 1060870535 9:127036278-127036300 CCAGGCCTGGTCAGCCATTGGAG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1060870541 9:127036305-127036327 CTTCTTTGGGATGAACTCGTTGG No data
1060870535_1060870537 -10 Left 1060870535 9:127036278-127036300 CCAGGCCTGGTCAGCCATTGGAG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1060870537 9:127036291-127036313 GCCATTGGAGCTGCCTTCTTTGG No data
1060870535_1060870539 -9 Left 1060870535 9:127036278-127036300 CCAGGCCTGGTCAGCCATTGGAG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1060870539 9:127036292-127036314 CCATTGGAGCTGCCTTCTTTGGG No data
1060870535_1060870542 17 Left 1060870535 9:127036278-127036300 CCAGGCCTGGTCAGCCATTGGAG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1060870542 9:127036318-127036340 AACTCGTTGGCGTCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060870535 Original CRISPR CTCCAATGGCTGACCAGGCC TGG (reversed) Intronic
901400476 1:9012088-9012110 CCCTAATGGCTGACCAGAGCCGG + Intronic
904977406 1:34467665-34467687 CTAAAATGCCTGATCAGGCCAGG + Intergenic
908784515 1:67721877-67721899 CTCCCCTGGCTGAGCAGGGCTGG + Intronic
915121160 1:153630190-153630212 CTGCAGTGGCTGCCCAGGCAGGG - Intronic
916549930 1:165840212-165840234 TTTTAAAGGCTGACCAGGCCGGG - Intronic
916851991 1:168713169-168713191 CTACAGTGGGTGAACAGGCCTGG - Intronic
917482505 1:175424316-175424338 CACCACTGCCTGGCCAGGCCAGG - Intronic
918406465 1:184215850-184215872 CTCCTATGCCCGTCCAGGCCAGG - Intergenic
919838272 1:201591495-201591517 CTGCAGGGGCTGAGCAGGCCTGG + Intergenic
1065153374 10:22845234-22845256 CTCCAATTGCAGACAAGTCCTGG + Intergenic
1065221305 10:23498909-23498931 CTTCAAAGGCTGCCCAGGCTGGG - Intergenic
1067476877 10:46573196-46573218 CTCCTACGGCTGGCCAGGGCTGG - Intergenic
1067617860 10:47768584-47768606 CTCCTACGGCTGGCCAGGGCTGG + Intergenic
1068927344 10:62554061-62554083 CCCCAACCTCTGACCAGGCCAGG - Intronic
1071430483 10:85602786-85602808 CCCAACAGGCTGACCAGGCCTGG - Intronic
1071976493 10:90961185-90961207 CTCCAAGCGTTGACCAGGCTAGG + Intergenic
1073307440 10:102514519-102514541 CTCCTGTGGCTGCCCAGACCTGG - Intronic
1074116409 10:110460306-110460328 CTCCCACGGCTGACCCAGCCAGG + Intergenic
1074307949 10:112296470-112296492 TTCCACTGGCTGACCATGCCTGG + Intronic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1077465925 11:2733636-2733658 CCCCCAGGGCTGCCCAGGCCTGG - Intronic
1079659386 11:23020236-23020258 CTCCAAGGGCTTATCAGGCCTGG - Intergenic
1085775674 11:79364320-79364342 CTGCCATGGATGACAAGGCCTGG + Intronic
1088626973 11:111736499-111736521 CTCCAAGGGCTGGCCACCCCTGG + Intronic
1092164354 12:6333833-6333855 GTACAATGACTGTCCAGGCCCGG - Exonic
1094463228 12:30721208-30721230 CTACACTGCCTGTCCAGGCCTGG + Intronic
1094482571 12:30896407-30896429 CTTCTATGGCTCACCAGGCAGGG - Intergenic
1096500132 12:52059769-52059791 CTGCAGTGGCTGACTAGCCCAGG + Intergenic
1097607207 12:61769607-61769629 CTCCAATGGGTGGCTAGACCAGG + Intronic
1097685747 12:62689370-62689392 CTTCAATGGCAGCCCAGGCATGG - Intronic
1097733587 12:63155987-63156009 CTCCATTTGGTGACAAGGCCTGG + Intergenic
1098049141 12:66434884-66434906 CTTCAATGGCTGTCAAGGCCAGG - Intronic
1102234084 12:111283353-111283375 TTCCAATGGCTGAGCACGGCGGG - Intronic
1104084116 12:125458682-125458704 CTCCATTGGCTTCCCAGCCCTGG - Intronic
1104283946 12:127405833-127405855 CTCCGATGGCTGAAGAGGCAGGG - Intergenic
1104286654 12:127430562-127430584 CTCCATTGGCTTCCCAGTCCGGG + Intergenic
1104450457 12:128864542-128864564 CTCCCATGGCTGCCCACTCCTGG - Intronic
1104682626 12:130761973-130761995 CTCCAATGCCTGCACAGGGCGGG - Intergenic
1111743870 13:92240792-92240814 CTCCAAAGGATGGCCAGGCATGG - Intronic
1112731253 13:102365290-102365312 CTCTACTGGCTGTCCAGGCATGG - Intronic
1117400120 14:55351466-55351488 CTCCTAAGGAGGACCAGGCCTGG + Exonic
1119756403 14:77123070-77123092 TGCAAATGGCTGACCAGGCACGG - Intronic
1120882975 14:89428903-89428925 CTCCGGAGGCTGCCCAGGCCAGG + Intronic
1121585184 14:95058489-95058511 CTGCACTGGCAGACGAGGCCAGG - Intergenic
1123111084 14:105867113-105867135 CTACAATGGGTGGCCAGGGCAGG + Intergenic
1128879470 15:71230168-71230190 GTCCAGTGCCTGACCAGGGCAGG - Intronic
1129247643 15:74289416-74289438 CTCAAATGTCTCACCAGGCTGGG + Intronic
1130513351 15:84607015-84607037 CGCCACTGACTAACCAGGCCTGG - Intronic
1131979422 15:97980625-97980647 CTCCACAGGCTGACGATGCCTGG - Intergenic
1138281262 16:55773634-55773656 CACCAATGGCTGAGCAGGAAGGG + Intergenic
1138287277 16:55820227-55820249 CACCAATGGCTGAGCAGGAAGGG - Intronic
1142029664 16:87832238-87832260 CTCCCCTAGCTCACCAGGCCTGG - Exonic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1143352264 17:6297598-6297620 ATCCAATGGCTGATCAACCCAGG + Intergenic
1148356997 17:46982137-46982159 CTCCAAGGGGTGATCAGGGCAGG - Intronic
1151678625 17:75612811-75612833 CGCCAGTGGCTGCCCTGGCCTGG - Intergenic
1152008728 17:77697762-77697784 CCCCGATGGCTGACCACCCCAGG - Intergenic
1152119409 17:78408977-78408999 TTTCAACGGCTGACAAGGCCGGG - Intronic
1155768168 18:29663537-29663559 CACCAATGGATGGACAGGCCAGG - Intergenic
1160163427 18:76491843-76491865 CTCCCAGGGCTGCCCAGTCCCGG + Intronic
1160234196 18:77072908-77072930 TGACAATGGCTGAACAGGCCAGG - Intronic
1161125955 19:2557532-2557554 CTCCATTCGCTGACCCGGCCAGG - Intronic
1162498112 19:11034747-11034769 TTTCAGTGGCTGACCTGGCCTGG - Intronic
1163775462 19:19214849-19214871 CTCTAATACCTGGCCAGGCCTGG + Intronic
1164693617 19:30227839-30227861 CTACACCGGCCGACCAGGCCCGG - Intergenic
1165811491 19:38614459-38614481 ATCCAATGCCTGGCCTGGCCGGG - Intronic
1167402757 19:49283846-49283868 CCCCAATTCCTGACCAGGCCTGG + Intergenic
925310213 2:2876482-2876504 CTCCATGGGCTGACCCGCCCGGG + Intergenic
925919367 2:8628468-8628490 CTCCCAGGGCTGACTGGGCCAGG + Intergenic
926295971 2:11568820-11568842 CTGAAATGGGTGACAAGGCCTGG + Intronic
926598917 2:14820860-14820882 CTCGCGTGGCTGACCTGGCCTGG - Intergenic
928377762 2:30789937-30789959 CTACATGGGCTGCCCAGGCCTGG + Intronic
928379973 2:30809346-30809368 CTGCTATGGCTGTCCAAGCCTGG + Intronic
931209618 2:60180043-60180065 ATCCAATTGCTGCCCAGGCTGGG + Intergenic
931537941 2:63299383-63299405 GTCCAATTCCTAACCAGGCCTGG - Intronic
932344929 2:70989123-70989145 CTCCAAAGGGGGCCCAGGCCTGG + Intronic
935208969 2:100922287-100922309 CTCCAAAGCCTGGCCAGGCATGG + Intronic
935802620 2:106714132-106714154 CTCCAATGGCAGAACCAGCCTGG + Intergenic
936020694 2:108992836-108992858 CTCCCAGGACTGACCTGGCCTGG + Intergenic
936687489 2:114845139-114845161 CTCAAGTTGCTGAGCAGGCCTGG + Intronic
941137680 2:161737962-161737984 CTCAAATGTCTGACTAGGTCAGG - Intronic
947106030 2:226668629-226668651 TTCCAATGGCCTACGAGGCCCGG - Intergenic
947332367 2:229043792-229043814 CTTCCATGGCTGGCCAGGCATGG - Intronic
948193663 2:236079075-236079097 CTCCGATGCCACACCAGGCCTGG + Intronic
948462964 2:238139083-238139105 CCCCAGTGCCTGCCCAGGCCCGG - Intronic
948468988 2:238165474-238165496 CTCCACTGGAAGACCTGGCCAGG + Intronic
948562605 2:238864545-238864567 CTCCCCAGGCTGACCTGGCCTGG - Intronic
1169970159 20:11261483-11261505 CTGCCAGGACTGACCAGGCCAGG - Intergenic
1170871987 20:20214413-20214435 CTCCTCAGTCTGACCAGGCCAGG + Intronic
1175172141 20:57088271-57088293 CTCAGATGGATGACCAGGGCAGG + Intergenic
1175826443 20:61938886-61938908 CTCCCATGGCTGCCCAGGGAGGG + Exonic
1175913865 20:62416684-62416706 CTACATGGGCTGAACAGGCCTGG + Intronic
1179287957 21:39994483-39994505 TTCCCAGGGCTGACCAGGCAAGG - Intergenic
1180968012 22:19800608-19800630 CTCCTAAGGCTTAGCAGGCCTGG - Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1183107618 22:35626191-35626213 CTCCCAAGGCTGTCCATGCCTGG - Intronic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
953226256 3:41024382-41024404 CTCCAATGACTGACAAGGAGTGG - Intergenic
954104855 3:48404430-48404452 CTTCCAGGGCTGCCCAGGCCAGG + Exonic
954994114 3:54866129-54866151 CTCCAAGGCTTGCCCAGGCCTGG + Intronic
956929185 3:74023322-74023344 CTCCAATTTCTGACCATGGCTGG + Intergenic
962753673 3:138452335-138452357 CCCCACTAGCTCACCAGGCCAGG + Intronic
965842454 3:172922631-172922653 CTACCATGCCTGGCCAGGCCTGG - Intronic
966184552 3:177216183-177216205 CTCCAATGCCTTGCCAGGCAGGG + Intergenic
966594810 3:181716123-181716145 TTACAATGGCTGGCCAGGCTAGG - Intergenic
968489928 4:884488-884510 CTCCACGCGCTGCCCAGGCCTGG + Intronic
968532902 4:1104615-1104637 CCAGAATGGCAGACCAGGCCAGG - Intronic
968555545 4:1244810-1244832 CCCCTCTGGCTGTCCAGGCCTGG + Intronic
975320090 4:73000308-73000330 CTTCAGTTGCAGACCAGGCCTGG - Intergenic
976303427 4:83536383-83536405 CTCCGCTGGCTGCCCAGGTCTGG - Intronic
979635581 4:122951804-122951826 GCCCAATGACTGACCAGGCCTGG - Intronic
982743740 4:159084825-159084847 CCCTCATGGCTGACCAGGCCTGG + Intergenic
987036676 5:14026041-14026063 CCCCCATAGTTGACCAGGCCAGG + Intergenic
988602030 5:32649112-32649134 CTCCAAAGCCTGACCTGGCTTGG + Intergenic
989777446 5:45226011-45226033 CTCCACTGGCCGCCCAGGCATGG + Intergenic
990617274 5:57520699-57520721 ATCCATTGGCTGAGGAGGCCAGG + Intergenic
997230443 5:132238634-132238656 CTCCACTGGCTGAGGAGGCAGGG + Intronic
1001225784 5:169943626-169943648 CTCTAATGCCTGATGAGGCCAGG - Intronic
1003529962 6:6928986-6929008 CTCCAATGCCTGCACGGGCCAGG + Intergenic
1005849238 6:29807013-29807035 TTGAAATGGCTGACCAGGCACGG - Intergenic
1006338023 6:33431210-33431232 CCAGAATGGCTGCCCAGGCCTGG - Intronic
1006388077 6:33743103-33743125 CTCCTCTGGCTGGCCAGGCTGGG - Intronic
1006898233 6:37484208-37484230 CTCCCCTGGGGGACCAGGCCTGG - Intronic
1007312161 6:40955153-40955175 CTCCCATGTGTGCCCAGGCCCGG - Intergenic
1007408504 6:41648461-41648483 CTCCCTTGGCTGAAGAGGCCGGG - Intronic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1014658157 6:124132824-124132846 CCCCACTGGGTGACTAGGCCTGG + Intronic
1017298220 6:152824927-152824949 CTCGAACTCCTGACCAGGCCTGG - Intergenic
1020882005 7:13774170-13774192 CTCAGATGTCTGACCAGACCAGG - Intergenic
1023110660 7:36807737-36807759 CTTCAATGGCTGACAAGGAAGGG + Intergenic
1024216603 7:47254220-47254242 CTCCAGTGGCGGGCCAGGACAGG - Intergenic
1026932564 7:74231968-74231990 CTCCAGTGGCTGGCCAGGCACGG - Exonic
1028778070 7:94703164-94703186 CTCCAACAGCTGGCCAGGCGCGG + Intergenic
1028839692 7:95415212-95415234 CTCCTATGTCTGCCCAAGCCAGG + Intronic
1033654511 7:143363349-143363371 CTCCAATCCCCAACCAGGCCTGG - Intergenic
1036775261 8:11607464-11607486 CACCAATGGCTGGCCAAGCTTGG + Intergenic
1048389830 8:133952199-133952221 CTGCAAAGGCTGAACTGGCCAGG + Intergenic
1048968651 8:139631516-139631538 CTCCAGTGCCTGACCAGGTGTGG - Intronic
1049509138 8:143018905-143018927 CTCCAGTGGCTGCGCAGCCCTGG - Exonic
1049598171 8:143494157-143494179 CCCCACAGGCTGACCACGCCTGG + Intronic
1051405688 9:16735694-16735716 CACCAAACCCTGACCAGGCCAGG + Intronic
1051480243 9:17551877-17551899 TTCCAATTGCTGGCCAGGCGTGG + Intergenic
1055124715 9:72705887-72705909 GTCCATTGGCTGGCTAGGCCTGG + Intronic
1056657607 9:88522158-88522180 CTCCAATGTATGACCTGGTCTGG - Intergenic
1056889507 9:90477829-90477851 CTCTAATGGCTGGACAGGGCTGG - Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1058508761 9:105693924-105693946 CTCGAATGGCAGACAAAGCCAGG - Intergenic
1060363516 9:122984546-122984568 CTCCAATGGACGACCAGCCAGGG + Exonic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1061743533 9:132723979-132724001 ATCCAGTGGCTGAGCAGGGCAGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1190064894 X:47233140-47233162 CGCCACTGGCTGTCCAGGCCTGG - Exonic
1190128718 X:47726935-47726957 CTCCAATGGCACAGAAGGCCTGG - Intergenic
1191117283 X:56865223-56865245 GTCCAATTCCTGACCAGGTCTGG + Intergenic
1192050599 X:67720721-67720743 CTCCATAGGATGAGCAGGCCTGG - Intronic
1197757484 X:130005918-130005940 CTGCAATCGCTGGCCAGGCATGG - Intronic