ID: 1060874274

View in Genome Browser
Species Human (GRCh38)
Location 9:127069055-127069077
Sequence GTGCATATGAAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060874274_1060874278 12 Left 1060874274 9:127069055-127069077 CCTGCCTCCTTCTTCATATGCAC 0: 1
1: 1
2: 3
3: 30
4: 323
Right 1060874278 9:127069090-127069112 TAAAATCCTTAGTTCTGTCCAGG 0: 1
1: 0
2: 0
3: 27
4: 231
1060874274_1060874280 18 Left 1060874274 9:127069055-127069077 CCTGCCTCCTTCTTCATATGCAC 0: 1
1: 1
2: 3
3: 30
4: 323
Right 1060874280 9:127069096-127069118 CCTTAGTTCTGTCCAGGATTCGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060874274 Original CRISPR GTGCATATGAAGAAGGAGGC AGG (reversed) Intronic
901337855 1:8466706-8466728 GTACATATGAATAAAGATGCAGG + Intronic
904832110 1:33311978-33312000 GTGCATGTGATGAAGGAGGCGGG - Intronic
904944015 1:34185851-34185873 GTGCATCTAGAGATGGAGGCAGG - Intronic
907975139 1:59424250-59424272 ATACATGTGAAGAATGAGGCCGG + Intronic
908107535 1:60860798-60860820 GTGCATATAAGGAAGGCAGCAGG + Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909055874 1:70820520-70820542 GGGCATATGGAGAAAGAGGAAGG + Intergenic
910259431 1:85281452-85281474 GGTCATGTGAAGATGGAGGCTGG - Intergenic
911197068 1:95005337-95005359 GTGAACATGAAAAGGGAGGCAGG + Intronic
912281903 1:108324472-108324494 GTGCTTTTGGAGACGGAGGCAGG + Intergenic
912502189 1:110129981-110130003 GAGCATATGGGGAAGGTGGCGGG + Intergenic
912764020 1:112392704-112392726 GGCCATGTGAAGACGGAGGCAGG + Intergenic
912905143 1:113697597-113697619 GTGCATGTGAACAAGCAGGTGGG + Exonic
913400402 1:118425527-118425549 GAGCATAGGATAAAGGAGGCAGG + Intergenic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
915104541 1:153525411-153525433 GTCCATATGAATAAGCAGTCTGG - Intergenic
916388016 1:164298908-164298930 GTACCTTTGAAGAAGGAGGCAGG + Intergenic
917616732 1:176753469-176753491 GAGCAGAGGAAGAAGAAGGCTGG - Intronic
918301201 1:183205537-183205559 GGTCATATGAAGAAGGATACTGG + Intronic
919853812 1:201692191-201692213 GTGGATATAGAGAAGCAGGCAGG + Intronic
920086164 1:203418857-203418879 GTGAATATTAAAAAAGAGGCAGG + Intergenic
922030366 1:221791623-221791645 GTGCAGAGGAAACAGGAGGCAGG - Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922741122 1:228014755-228014777 ATGCAGGGGAAGAAGGAGGCTGG - Intronic
922988278 1:229883729-229883751 GTGCTTATGAAAAAGAAAGCAGG - Intergenic
923774802 1:236968679-236968701 GTGAATATGAAGAAAGAGACCGG - Intergenic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067352579 10:45489980-45490002 GGGCATGAGAGGAAGGAGGCTGG - Intronic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1069837829 10:71320107-71320129 GAGCTTCTGAAGAAGGAGCCAGG - Intronic
1070774095 10:79099817-79099839 GTGCATTTGAAAAAGCAGGTAGG + Intronic
1071614874 10:87066246-87066268 GGGGATATGAAGAGGGAAGCAGG - Intronic
1071988944 10:91080976-91080998 TTTCATATGAACCAGGAGGCAGG - Intergenic
1074034477 10:109724559-109724581 GTACAGGTGAGGAAGGAGGCTGG - Intergenic
1074150224 10:110752784-110752806 GTGTAAGTGAGGAAGGAGGCTGG - Intronic
1074847162 10:117408504-117408526 GGTCATGTGAAGATGGAGGCAGG + Intergenic
1074998989 10:118781588-118781610 GTCCATCTGAAGATGGATGCAGG + Intergenic
1076310416 10:129502272-129502294 GTGTAGATGAAGAAGCAGACAGG - Intronic
1076474526 10:130743099-130743121 GGGCAGGTGAGGAAGGAGGCGGG - Intergenic
1076474532 10:130743119-130743141 GGGCAGGTGAGGAAGGAGGCGGG - Intergenic
1077217180 11:1399795-1399817 GTGCCAAGGAAGAAGGAGGCTGG - Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1079127611 11:17730210-17730232 GTGCATATATGTAAGGAGGCTGG - Intergenic
1079241625 11:18726159-18726181 GGGCAAAGGAAGAAGGAGACGGG - Exonic
1079997744 11:27313500-27313522 GTGCATAGGCAGAAGGAAGGAGG + Intergenic
1081173818 11:39901488-39901510 GGGCATATGAAAAAAGAGGAAGG - Intergenic
1087058679 11:93957707-93957729 GTGGATAAGAAGCAGGAGACAGG + Intergenic
1088338645 11:108737902-108737924 GTGCATATGAAAATGCACGCAGG - Intronic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1093627857 12:21371324-21371346 GTGAATATGAGGTAGGAGGCAGG - Intronic
1095526261 12:43129481-43129503 GTGAAAATGAAGAGGGAAGCAGG + Intergenic
1095853319 12:46832994-46833016 GTACATATGAAGAAGGAATTAGG + Intergenic
1096240991 12:49960314-49960336 GGGCATGTGGAGAACGAGGCTGG - Intergenic
1096633407 12:52944020-52944042 GTGCAAAAGAACAAGGGGGCTGG + Intronic
1096765800 12:53888245-53888267 AGGCATATGAAGAATGAAGCTGG - Intergenic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1097727654 12:63093292-63093314 GTGGATATGAAAAAGGAAGCAGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097963884 12:65558609-65558631 GTGCAGATGAAGATGATGGCAGG + Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100066364 12:90650527-90650549 CTGGATATGAAGGAGGAGTCTGG - Intergenic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102628653 12:114257212-114257234 GTGCCTCTGAAGTGGGAGGCGGG - Intergenic
1103118135 12:118355505-118355527 GGGGATAGGAAGAAGGAGACAGG - Intronic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1103989276 12:124787333-124787355 GGGCATTTGAGGCAGGAGGCGGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104622892 12:130331624-130331646 GTGCGTATGCATGAGGAGGCGGG + Intergenic
1105483164 13:20798272-20798294 GAGCATGTGAAGATGAAGGCAGG + Intronic
1106560944 13:30845746-30845768 GGGCAGAGGAAGAGGGAGGCAGG + Intergenic
1107424317 13:40277467-40277489 GTGCATATGGAGAATAATGCAGG - Intergenic
1108050706 13:46435214-46435236 GTGGATATGAAGAATCAGGTAGG - Intronic
1108128100 13:47266932-47266954 GTGCATATTAAGTAAGTGGCTGG + Intergenic
1109543282 13:63808838-63808860 GTGGATATGAAGAATCAGGTAGG - Intergenic
1112487244 13:99831070-99831092 GGGCACATGAAGGAAGAGGCAGG + Intronic
1112793219 13:103027381-103027403 GTGCATTTGAAGAAAGAGAGAGG + Intergenic
1113362591 13:109645106-109645128 GTGCATGTGAAGATGGGGGTGGG - Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114715652 14:24821148-24821170 GTGAATATATGGAAGGAGGCAGG - Intronic
1115917250 14:38329708-38329730 GTGCTTATGAGGATGGAGGCTGG + Intergenic
1116283728 14:42945505-42945527 ATGCTTAAGAAGAAGGATGCTGG + Intergenic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1119813076 14:77540375-77540397 GTGCATATGCAGGAAGAGGAAGG + Intronic
1122420348 14:101572516-101572538 GTGCATATGGAGCAGGAGCCTGG - Intergenic
1122420371 14:101572672-101572694 GTGCATATGGAGCAGGAGCCGGG - Intergenic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122873612 14:104652552-104652574 CTCCATATGGAGAAGGATGCGGG - Intergenic
1123126733 14:105952338-105952360 GGGCATATGCAGAGAGAGGCTGG - Intergenic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1125436893 15:39655715-39655737 GGGCATCTGAATAAGGAGGATGG - Intronic
1126648214 15:50896155-50896177 GGGGATATGAAGATGAAGGCAGG - Intergenic
1128519174 15:68364428-68364450 GTGCATATCCCGAAGGAGGGAGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129660755 15:77551536-77551558 GTGCATATGAGGATGAAGCCAGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129695540 15:77738892-77738914 TCCCATATGAAGAAGCAGGCAGG + Intronic
1130701002 15:86181517-86181539 GTACATATGGAGTAGGAGGGAGG + Intronic
1131668206 15:94592438-94592460 GTGCATGTGCACCAGGAGGCAGG - Intergenic
1131837824 15:96408600-96408622 GTGGGTAGGAATAAGGAGGCAGG - Intergenic
1132226699 15:100148059-100148081 GTCCTTACTAAGAAGGAGGCAGG - Intronic
1133030126 16:3006736-3006758 GGCCATGTGAAGACGGAGGCAGG - Intergenic
1133996348 16:10751475-10751497 GTGCTGAGGAAGTAGGAGGCTGG + Intronic
1134080745 16:11323375-11323397 GTGCAGATGGAGGTGGAGGCTGG + Intronic
1134539588 16:15054200-15054222 GTGTAAGTGAAGAAGGATGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135020856 16:18961854-18961876 GAGCATGAGAAGGAGGAGGCAGG - Intergenic
1135775755 16:25256745-25256767 GTGCATTTGGAGAAAGAGACTGG - Exonic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1137449198 16:48555083-48555105 GGGCATTTGAAGAAGGAGCAAGG - Intronic
1137766917 16:50984978-50985000 GAGCCAATGAAAAAGGAGGCTGG - Intergenic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1140494872 16:75376662-75376684 GTGGCTATGAAGTAGTAGGCAGG + Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142378416 16:89718508-89718530 GTGGATAAGAAGATGGAGACTGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1143013728 17:3880431-3880453 GGGCCTATGGAGAAGGATGCGGG + Exonic
1143484913 17:7248789-7248811 GTGCACATGGAGTAGGAGTCGGG + Intronic
1144257553 17:13484546-13484568 GTGCCTATGAAATAGGAAGCAGG + Intergenic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1148445975 17:47737428-47737450 GTGCATGTGAAGACAGAGGTTGG + Intronic
1148621784 17:49039964-49039986 GTGCATAGGAAGGAGAACGCAGG + Exonic
1149008868 17:51834390-51834412 GAGAATCTGAGGAAGGAGGCAGG - Intronic
1150706564 17:67492372-67492394 AAACATATGAAGCAGGAGGCAGG + Intronic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1152797556 17:82315620-82315642 GTGCCTCTGAAGAAGGAGAGTGG + Intronic
1153375148 18:4368581-4368603 GTTCATATGAATTTGGAGGCTGG - Intronic
1155038739 18:22047112-22047134 GTTCATATGAAGGAGGAAGGGGG + Intergenic
1156166755 18:34430296-34430318 ATGCAACTGAAGAAGGAAGCAGG + Intergenic
1156306585 18:35883561-35883583 GGCCATGGGAAGAAGGAGGCAGG - Intergenic
1157443200 18:47725724-47725746 GTCCATGTGTATAAGGAGGCTGG - Intergenic
1157552163 18:48589366-48589388 GTACATGTGAAGATGGAGGCAGG - Intronic
1157909196 18:51599192-51599214 CTTCATATGAATAAGGGGGCTGG + Intergenic
1157924577 18:51749322-51749344 GGGGATATGGAGAAGGAAGCAGG + Intergenic
1158233071 18:55280269-55280291 GTGCATAGGAAGCGGGAGGAGGG + Intronic
1160024693 18:75208391-75208413 GTGCTTCGGAGGAAGGAGGCTGG - Intronic
1160219269 18:76960741-76960763 GTGCACATGAAGAAGCACACGGG + Exonic
1160458315 18:79018674-79018696 GGCCATGTGAAGATGGAGGCGGG - Intergenic
1161269574 19:3382413-3382435 GAGCATCTGAGGGAGGAGGCTGG + Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161860017 19:6791005-6791027 ATGCATGTGAAATAGGAGGCAGG - Intronic
1161864912 19:6826694-6826716 GTGCAGATGAAGCTGGAGGTGGG + Exonic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166605098 19:44134972-44134994 CTGCATTTGAAAAAGGAGGGAGG + Intergenic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1166997179 19:46725189-46725211 GTGTATATCATGAAGGGGGCGGG + Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167217689 19:48175652-48175674 AGGGATATGAAGGAGGAGGCTGG + Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927080946 2:19630126-19630148 GTGCTTATGAAGTTGGGGGCTGG + Intergenic
929905535 2:46042828-46042850 GTGCCTGTGAACAAGGATGCTGG - Intronic
930643167 2:53875343-53875365 GTGCTTATGAGGAAGGTGGATGG - Intronic
931179695 2:59886917-59886939 GGGGATATGAAGTAGGCGGCTGG - Intergenic
932426124 2:71636533-71636555 GTTCATATGAGGAAGGATGTGGG + Intronic
933584030 2:84160686-84160708 GTGTATCTAAAGAAAGAGGCAGG + Intergenic
934729065 2:96645052-96645074 TGGCATATGAAGGAAGAGGCTGG - Intergenic
934768412 2:96893482-96893504 GTGAAAATGAACAGGGAGGCTGG + Intronic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
935810221 2:106790343-106790365 ATGCTTATCAAGAAGGATGCAGG - Intergenic
935882581 2:107580431-107580453 GAGCATAGGAAGAAAGGGGCAGG + Intergenic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936630746 2:114200224-114200246 GTGGAATTGAAGTAGGAGGCAGG - Intergenic
939348441 2:140999878-140999900 GTGCATCTGGAGAAGGTGACAGG + Intronic
940989074 2:160079727-160079749 GTGAATATGAAGACAGAGGTTGG + Intergenic
942425744 2:175858703-175858725 GAGCAGATGAAGACGGAAGCGGG - Intergenic
943128416 2:183826151-183826173 GTTCATCTGAGGTAGGAGGCAGG + Intergenic
943298617 2:186169403-186169425 GAGCATTTGAAGAATGAGGCGGG + Intergenic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946176925 2:217927937-217927959 GCCCATATGAAGAAATAGGCAGG + Intronic
948127135 2:235572494-235572516 GTGCAAAGGACGCAGGAGGCAGG - Intronic
948197512 2:236106633-236106655 ATGCATTTGGAGAAGGTGGCTGG + Intronic
948588266 2:239034821-239034843 GTGCAGAGGAGGCAGGAGGCTGG - Intergenic
1169189570 20:3649564-3649586 GTGCACATGAAAAATCAGGCAGG + Exonic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172570170 20:35964084-35964106 GTGGTTATGAGGAAGGAGGCTGG - Intronic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174272114 20:49377188-49377210 GTGCAGATGAAGGAGGAGTGGGG + Intronic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1175588621 20:60168781-60168803 GGGCAGAGGAAGAAGGAAGCTGG + Intergenic
1176910753 21:14561833-14561855 GGCCATGTGAAGATGGAGGCAGG + Intronic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181101886 22:20546240-20546262 GTTCATAAGAAGGAGGGGGCAGG - Intronic
1184318516 22:43719390-43719412 GGGCACATGAAGAAAGATGCTGG - Intronic
1185188413 22:49417384-49417406 GTGCATCAGAAGCTGGAGGCAGG - Intronic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
949614303 3:5737053-5737075 GAGCAAATGGAGAAGGATGCAGG + Intergenic
950464088 3:13143057-13143079 GTCCAGATGAAGAAAGAGACGGG - Intergenic
951050349 3:18086604-18086626 GTGCATAAGAGGTGGGAGGCAGG - Intronic
952317097 3:32240423-32240445 GTGCAAATGAAGGAGTTGGCAGG + Intronic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
952799547 3:37275738-37275760 GTGCAGAAGAAGAACGCGGCTGG + Intronic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
954482991 3:50818934-50818956 GTGCATATTAAGAAGAATCCTGG - Intronic
954639415 3:52089158-52089180 CTGCATGTCACGAAGGAGGCAGG + Intronic
955680006 3:61490280-61490302 GTCCTTATTAAGAAAGAGGCAGG + Intergenic
958609145 3:96401759-96401781 GTCCTTATAAAGAAGGAAGCAGG - Intergenic
959572473 3:107899725-107899747 GTGAAATTAAAGAAGGAGGCAGG - Intergenic
959803837 3:110527615-110527637 GTGGTAAGGAAGAAGGAGGCTGG - Intergenic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961060232 3:123822489-123822511 CTGCAGATGAAGAAGGATGGAGG - Intronic
961473563 3:127133620-127133642 CTGGCTTTGAAGAAGGAGGCAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964029700 3:152123006-152123028 TTACGTATGAAGAAGGAAGCAGG - Intergenic
964166791 3:153716810-153716832 GTGTGTATGCACAAGGAGGCAGG - Intergenic
964511085 3:157452668-157452690 GTACATATGAGGAAACAGGCTGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
966062064 3:175769787-175769809 GTTCATATGAATGAGGAGGTTGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967860618 3:194148671-194148693 GTGCATGGGTAGAAGGAGGTGGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968347419 3:198021762-198021784 GTACAGATGAAGAAACAGGCAGG - Intronic
968413291 4:407242-407264 ATGCATATTAAGAATAAGGCGGG + Intergenic
968676604 4:1884686-1884708 TTGCAGATAAAGAACGAGGCTGG - Intronic
969516439 4:7650776-7650798 GTGCAGCTGATGGAGGAGGCAGG - Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970120124 4:12744245-12744267 GTGGATGTGAAGAAAGAGGTGGG + Intergenic
970777632 4:19695040-19695062 GTGCATGTGAAAGAGGAAGCAGG + Intergenic
971709657 4:30094284-30094306 GCCCAGATGAAGAAGGAAGCGGG + Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
977862714 4:101984791-101984813 CTGCATAAGAAAAAGGGGGCAGG + Intronic
979138701 4:117145615-117145637 CTGCCTATGAATAAGAAGGCAGG + Intergenic
982761796 4:159293548-159293570 TTCCTTATGAAGAAGTAGGCAGG - Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
984891418 4:184497478-184497500 GTCCATGTAAAGATGGAGGCAGG + Intergenic
985863684 5:2494992-2495014 GTGCTTATGAAGAAGGTTGAAGG + Intergenic
986517687 5:8581073-8581095 GTGAATGTTAAGAGGGAGGCAGG - Intergenic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
986934733 5:12868721-12868743 TTGCATATGTAGAGGAAGGCTGG - Intergenic
988011882 5:25499125-25499147 GTGTGTATGAAGAATGAGACTGG + Intergenic
988418689 5:30978644-30978666 ATCCATATGACGAAGGAGGATGG + Intergenic
989094444 5:37768683-37768705 GTGCAAATGCAGTAGTAGGCAGG + Intergenic
990206175 5:53431911-53431933 ATGCTTATGAATCAGGAGGCAGG + Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991201078 5:63993606-63993628 GTGCACATGTAACAGGAGGCAGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
991516170 5:67438006-67438028 GTACATCTGCAGAAGTAGGCTGG + Intergenic
992441780 5:76803414-76803436 GTGCACATGTAGCATGAGGCGGG + Intergenic
992568881 5:78031289-78031311 GTGGACATGAAGTTGGAGGCAGG + Intronic
993237100 5:85325705-85325727 GAGCATATGAAGTAGGATCCTGG - Intergenic
995366535 5:111367801-111367823 GTCCATAGGAAGAAGGAAGAAGG - Intronic
995413819 5:111887322-111887344 GCACATATGAAGACGGAGGTTGG + Intronic
995739706 5:115342854-115342876 GTGGATATGCAGAAGGAGTGGGG + Intergenic
997014500 5:129916787-129916809 GTGCATAAGAAGGAGGAGTCAGG + Intronic
997474510 5:134134839-134134861 GAGTAAATGAAGAAGGATGCTGG + Intronic
997679266 5:135737838-135737860 GTGCTGATGAAGTAGGAGGCTGG - Intergenic
999409965 5:151342205-151342227 GTGGAACTGAAGAAGGAGCCAGG - Intronic
999627902 5:153539579-153539601 GTACATATGTAGAATGAGGTTGG + Intronic
1000717851 5:164669064-164669086 GTGCATATGTAGTAGGTGGGTGG + Intergenic
1003432746 6:6055051-6055073 ATGCAAATGAGGGAGGAGGCAGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003825928 6:9951981-9952003 GTGAATATGAAGAAAGAGATGGG + Intronic
1004005253 6:11632169-11632191 GTGCTTATAAACATGGAGGCTGG + Intergenic
1007517812 6:42427495-42427517 GTGCTTTGGAAGATGGAGGCAGG - Intronic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008507928 6:52248738-52248760 GTATATTTGGAGAAGGAGGCTGG - Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012382118 6:98632492-98632514 GTGCATATGGAGAGGGAAGCTGG - Intergenic
1013409909 6:109874714-109874736 GGCCATGTGAAGATGGAGGCAGG + Intergenic
1015629227 6:135214623-135214645 GTGAATATGAAGTACGATGCAGG - Intronic
1017047922 6:150364652-150364674 ATCCACATCAAGAAGGAGGCAGG + Intergenic
1017974707 6:159346884-159346906 GTGCAGATTAGGAAGGTGGCAGG - Intergenic
1018996431 6:168713979-168714001 GGGCATGGGAAGCAGGAGGCTGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023630540 7:42159549-42159571 GTGCATTTTAAGAAGTAGTCTGG - Intronic
1026498251 7:70921745-70921767 GTGCATGGGAAGAAGCCGGCAGG + Intergenic
1026659117 7:72283616-72283638 GATCATATGAAGCAGGATGCAGG + Intronic
1027602847 7:80260508-80260530 GTGAATAGGAAGAAGGAGTGTGG + Intergenic
1029178875 7:98685090-98685112 GTGCTTAGGAAGAAGGCGGATGG + Intergenic
1029224099 7:99012428-99012450 GTGAATATAAGGAACGAGGCAGG - Exonic
1031112101 7:117623370-117623392 GTGCACAGGAAGCAGCAGGCTGG + Intronic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033658135 7:143386968-143386990 GTGCTTCTGAAGGAGGAGCCAGG + Intronic
1035304227 7:157920497-157920519 GTTCAAAAGAAGAAGCAGGCAGG - Intronic
1035931216 8:3782489-3782511 GTGCTTTTTAAAAAGGAGGCTGG + Intronic
1036158225 8:6362356-6362378 GGGCAGATGAAGAGGGAGGGTGG - Intergenic
1037287570 8:17317630-17317652 GTGCAGGGGAGGAAGGAGGCTGG + Intronic
1037464713 8:19148921-19148943 GACCCTATGAAGATGGAGGCAGG + Intergenic
1038256881 8:25958416-25958438 GTGCAGATGGAGAAAGGGGCAGG - Intronic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038773086 8:30502222-30502244 GCGGGTATGAAGAAGGGGGCAGG + Intronic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042711266 8:71719975-71719997 GTGGACATGAAGTCGGAGGCGGG + Intergenic
1046586772 8:116157354-116157376 GTGGCTATGAACAAAGAGGCAGG + Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1047407636 8:124598602-124598624 GTGCTTATGAAGATGGGGGTAGG - Intronic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048503972 8:135004189-135004211 CTGCATATGAGGCAAGAGGCTGG + Intergenic
1052139242 9:24958090-24958112 GTTCATTTGAAGAAGGAATCAGG - Intergenic
1052236456 9:26216978-26217000 GAGCATAGGAAGAAGCAGGAGGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1056618695 9:88191729-88191751 GTGCAGTTGAGGAAGGAGGCTGG - Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1058038425 9:100278345-100278367 CTGCATATGAAGAATGAGAGAGG - Intronic
1059012830 9:110481279-110481301 GTGCTTATGAAGATGGCGTCTGG - Exonic
1059061766 9:111040336-111040358 GTGTATAGGAAGAAAGAGACGGG - Intergenic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1059691324 9:116688003-116688025 GTGCATAAGAGGAAGGAGCAGGG + Intronic
1060108244 9:120888275-120888297 ATGAGTGTGAAGAAGGAGGCTGG - Intronic
1060240441 9:121898296-121898318 GTGCTTGGGAAAAAGGAGGCTGG + Intronic
1060453291 9:123764382-123764404 GTGCGTATGAGGCATGAGGCAGG + Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061911491 9:133727538-133727560 GTGAATCTGAGGAAGGAGCCAGG - Intronic
1062021079 9:134319698-134319720 CTGCAAATGAAACAGGAGGCTGG + Intronic
1062097897 9:134712219-134712241 GGGGATAAGAAGAAGGGGGCAGG - Intronic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1186095259 X:6094399-6094421 GTGCATATGAATAGAGAAGCTGG - Intronic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1192388480 X:70698846-70698868 TTGCATATCAAGATGGAGGTGGG + Intronic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1196198017 X:112855576-112855598 GTGCATATTCAGCAGGTGGCAGG + Intergenic