ID: 1060876579

View in Genome Browser
Species Human (GRCh38)
Location 9:127088210-127088232
Sequence ATGGTGAAAAGTCCTGAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060876579 Original CRISPR ATGGTGAAAAGTCCTGAGAA TGG Exonic
901830923 1:11892035-11892057 CTGGTGAAAAGTGCAGAGAGTGG - Intergenic
902588801 1:17458826-17458848 ATGGTGAAAGGTCTTGTGGAGGG - Intergenic
902896665 1:19484759-19484781 GTGGCGAAAAGTCCAGGGAAGGG + Intronic
903544641 1:24116331-24116353 ATGGTCATAAGTCCAGGGAAGGG - Intergenic
905754454 1:40497159-40497181 ATGGTGTAAAGTCCAGAAAGTGG + Intergenic
908418130 1:63933142-63933164 ATGACCAAGAGTCCTGAGAAAGG + Intronic
908993784 1:70127509-70127531 AAGGAGAAAAGACCTGAGAGAGG + Intronic
910118303 1:83756931-83756953 ATGCTGAAAATTTCTGGGAAAGG + Intergenic
910140880 1:84026363-84026385 AAGGTGAGAAGTCCTAAGAATGG - Intergenic
911489917 1:98551702-98551724 ATGGTTACAAGAGCTGAGAACGG + Intergenic
911731159 1:101293695-101293717 ACAATGAAAAGTCCTGAGCATGG - Intergenic
911748554 1:101468551-101468573 ATGGTGATAAATACTTAGAATGG + Intergenic
911768713 1:101711711-101711733 ATGTGCAAAGGTCCTGAGAAAGG - Intergenic
912547399 1:110460852-110460874 ATGATGAAAAATCCTCAGAGAGG - Intergenic
916401757 1:164457128-164457150 ATGGTTACCAGACCTGAGAAGGG + Intergenic
916782295 1:168047953-168047975 ATGATGAAGAGCCCTTAGAAAGG - Intronic
917042999 1:170827146-170827168 AGGATGAAAAATCCTGAGAAAGG - Intergenic
917185520 1:172350242-172350264 ATGCCAAAAAGTCCTGAGGAAGG - Intronic
918130729 1:181626480-181626502 ATGGTGAAAGGCCCTGAGAGAGG - Intronic
920375975 1:205508212-205508234 AAGGTGAAAAGTCCAGGGAAGGG - Intronic
921397773 1:214687007-214687029 GTAGGGAAAAGTCCAGAGAAAGG + Intergenic
922449621 1:225726356-225726378 ATGGTTGAAAGTCTTGAGACTGG + Intergenic
922970474 1:229732247-229732269 ATAAAGACAAGTCCTGAGAATGG - Intergenic
924109680 1:240685767-240685789 AAGGTGAATAGACATGAGAAAGG + Intergenic
924810220 1:247394435-247394457 ATGGTGAAAAGACCCGATGAAGG + Intergenic
1063143625 10:3276666-3276688 ATGGTGAAGAATTTTGAGAAAGG - Intergenic
1064721554 10:18234765-18234787 ATGCTGAAAAGTCCTGGAGATGG + Intronic
1067191256 10:44070078-44070100 ATGATGAAAAGTTCTGGGGATGG + Intergenic
1068472262 10:57480181-57480203 TTGGTGAAGAGTCCTAAGACTGG + Intergenic
1071349108 10:84721468-84721490 TTGGTTTAAAGTCCTGAGGATGG + Intergenic
1071867295 10:89748616-89748638 AGGGTGACAAGGCCTAAGAAAGG - Intronic
1072547653 10:96452342-96452364 AAGGAAAAAAGTCCTGAGGAGGG + Intronic
1074671015 10:115791071-115791093 ATATTAAAAAGTCCTGAGACAGG - Intronic
1075855999 10:125630813-125630835 AAGGGGAGAAGTCCTGAGAGAGG + Intronic
1078911045 11:15732370-15732392 ATGGTGAAAAGACTTATGAAGGG - Intergenic
1081138744 11:39471512-39471534 ATGGTTAAAAGTACTGTAAAAGG - Intergenic
1081418366 11:42842355-42842377 GAGGTGAAAAGTCAAGAGAAGGG - Intergenic
1083342694 11:61968465-61968487 ATTTTGAAAAGTCCTCAGCATGG - Intergenic
1084549843 11:69834694-69834716 AGGGAGAAAACTCCTGAGAAGGG - Intergenic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086964377 11:93012444-93012466 GAGGTGAAAAGTGCTAAGAACGG + Intergenic
1087727542 11:101739481-101739503 ATGTTGAAAAGTCATCTGAATGG - Intronic
1090900772 11:131028915-131028937 AGGATGCAGAGTCCTGAGAAAGG + Intergenic
1091181352 11:133607272-133607294 ATGGGGAAAAGTGCTTAGATGGG - Intergenic
1091896396 12:4108549-4108571 ATGGTGAGAAGACCTGAAACTGG + Intergenic
1092068590 12:5613960-5613982 AAGGGGAGAGGTCCTGAGAAGGG + Intronic
1093286200 12:17267380-17267402 ATGGGGATATGTTCTGAGAAAGG - Intergenic
1095534922 12:43233795-43233817 ATTTTGAAAAGACATGAGAAGGG + Intergenic
1096380481 12:51153503-51153525 ATGATGAAAAGTTCTGAAAATGG - Intronic
1096810962 12:54169605-54169627 ATGTTGAGAAGTCATAAGAAAGG + Intronic
1099150172 12:79101507-79101529 AAGGTGAAAAGTTCTGAAGATGG + Intronic
1099617353 12:84953747-84953769 ATTGTGACAAGTCCTAAGAGTGG - Intergenic
1099654176 12:85468463-85468485 ATGGTGATGACTCCTGTGAAGGG - Intergenic
1100268935 12:93005077-93005099 ATGCTGAAAATACCTCAGAAAGG - Intergenic
1101049552 12:100847069-100847091 ATGGGGTAAAGTGCTGTGAATGG - Intronic
1101235761 12:102787704-102787726 ACGGTGCAAATTCCTGAGATGGG - Intergenic
1101544975 12:105704003-105704025 ATTTTGAAAGGTCCTGAGATTGG - Intergenic
1102560192 12:113756433-113756455 AGGGTCAGAAGTCCTGAGACTGG - Intergenic
1104228047 12:126856241-126856263 ATTCTGAAAAGTCCTAAAAAGGG + Intergenic
1106120137 13:26853085-26853107 ATTGTGAAATATCCAGAGAATGG - Intergenic
1106772424 13:32974731-32974753 ATGATGAAAAGTTCTGGAAATGG - Intergenic
1107357399 13:39582624-39582646 ATGCTGAAAATTCAGGAGAAAGG + Intronic
1111149902 13:84237490-84237512 GTGGTAAAAAGTGATGAGAAAGG + Intergenic
1111683014 13:91467238-91467260 TTGGAAAAAAGTCCTGAAAACGG + Intronic
1111766304 13:92534342-92534364 AAGGTGAAAGGCCTTGAGAAAGG - Intronic
1112306557 13:98279954-98279976 AGGCTGAAAACACCTGAGAAAGG - Intronic
1112585438 13:100715207-100715229 ATAGGTAAAAGTCCTCAGAAAGG - Intergenic
1112894482 13:104282162-104282184 AGGCTGAGAAGTCCTGAGATAGG - Intergenic
1113080807 13:106517817-106517839 ATGGTGAAAAGATCTGATATTGG + Intronic
1115365326 14:32551076-32551098 ATGGGGAAAAGTCATTGGAAAGG - Intronic
1115579983 14:34748015-34748037 ATGATGAACAGTCCTGGAAATGG - Intergenic
1115811418 14:37112691-37112713 ATGGTGGATAGTCATAAGAACGG - Intronic
1116067454 14:40002156-40002178 ATGGTGAAAATTCATAAAAATGG + Intergenic
1116219977 14:42071594-42071616 ATGGTGATAAGTACTGTGAAAGG + Intergenic
1116333329 14:43623354-43623376 ATAATGATAAATCCTGAGAAAGG + Intergenic
1116864712 14:50022304-50022326 ATGGTGAAAGAACATGAGAAGGG - Intergenic
1118057684 14:62098778-62098800 CTGGTGATAAGTGCTGAGACAGG + Intronic
1119688881 14:76654949-76654971 ATGGGCGAAAGTCCTGAGAGTGG - Intergenic
1119716523 14:76863495-76863517 ATTGTGTAGAGACCTGAGAACGG - Intronic
1120549390 14:85850532-85850554 AATGTGAAAAGTCTTGAGACTGG - Intergenic
1124042153 15:26115641-26115663 ATGGAGAAAAGTGCTGGGAAAGG - Intergenic
1125691886 15:41602355-41602377 CTAGTGAAAAGGCCAGAGAAGGG - Intergenic
1126844527 15:52746430-52746452 ATGTTTAAAAGCCCTGTGAATGG - Intergenic
1127106254 15:55619834-55619856 ATGGTGAGAATACCTGAGCATGG + Exonic
1127223704 15:56908577-56908599 CTGGTGAAAAGTCCAGAAAAAGG - Intronic
1128769467 15:70271059-70271081 ATGGTGAAATGGCCTGTGAAAGG + Intergenic
1128863748 15:71096463-71096485 ATGGAGAAAAGTCCCCAGAGAGG - Intergenic
1129793900 15:78361540-78361562 ATGGTGATCAGTTCTGAGACAGG + Intergenic
1130329990 15:82914607-82914629 ATGATGAAAAGTTCTGGAAATGG + Intronic
1133545758 16:6804961-6804983 ATTGTGAAAAGCACTGTGAAAGG + Intronic
1133888920 16:9859967-9859989 GTGGTGAACAGTCCTCAGAGAGG + Intronic
1135120709 16:19764060-19764082 ATGGAGAAAAATTCTGTGAATGG - Exonic
1136084913 16:27877879-27877901 ATGGTGAAGTGTTCTGAGCAGGG - Intronic
1137261810 16:46836749-46836771 ATGGGGAAATGTTCTGAGAAAGG - Intergenic
1137658889 16:50186145-50186167 ATGATGAAAAGTTCTGGCAATGG - Intronic
1138334960 16:56245850-56245872 ATTGTGAAAAGTGTTGGGAAAGG + Intronic
1138670025 16:58606446-58606468 ATTAGGAAAAGTACTGAGAATGG - Intronic
1140029533 16:71324227-71324249 AAGGTGGAAAGCCCTGAGATGGG - Intergenic
1140087807 16:71812032-71812054 AAGTTAAAAAGTACTGAGAAAGG - Intergenic
1141291162 16:82719206-82719228 CTCGTGGAAACTCCTGAGAATGG - Intronic
1141464418 16:84196685-84196707 CTGGTGAAAGGCCCGGAGAAAGG - Exonic
1142897282 17:2989631-2989653 ATGGTCAAAAGACATGAAAACGG - Intronic
1143611361 17:8019729-8019751 ATGGTGGAAACTGCAGAGAAAGG - Intronic
1149308323 17:55370760-55370782 ATGGTGAATGCACCTGAGAAGGG + Intergenic
1150249311 17:63697507-63697529 ATTGTGAAGAGGCCTGAGAGCGG - Exonic
1150849686 17:68692833-68692855 AAGTTGGAAAGTCCTGGGAAAGG + Intergenic
1151032158 17:70754108-70754130 AAGGAGAAAAGTCCTGTGATAGG - Intergenic
1151893882 17:76967256-76967278 AAGGTGACAGGTCCTGAAAAGGG + Intergenic
1152010949 17:77716008-77716030 ATGGTGTAAAGACCTTAAAACGG + Intergenic
1153521190 18:5955492-5955514 ATGGTGGAGGGTCCTCAGAAGGG + Exonic
1153726240 18:7958440-7958462 ATGGTGGAAAGAACTGAGAAGGG + Intronic
1155491738 18:26406881-26406903 ATAGTGGAGAGTCCTGAGGAAGG + Intergenic
1157175589 18:45449191-45449213 ATGGTGAACTGTCCAGACAAAGG - Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159147583 18:64474078-64474100 ATGGTGCTATGTCCTGAGGAGGG + Intergenic
1159653915 18:71009221-71009243 ATGGTAAAAACTTCTGAGAGTGG - Intergenic
1160232686 18:77060116-77060138 ATGGTGTGAAGTCCCCAGAATGG + Intronic
1161759449 19:6160560-6160582 AAGGTGCAAAGTCCTGGAAAAGG + Intronic
1163516089 19:17764761-17764783 GAGGTGAAAAGTGCTGGGAAGGG + Intronic
1165220246 19:34310475-34310497 ATGGTGAAATGTCCAGAGCCAGG + Intronic
1165290860 19:34884200-34884222 AAGCTGAGAAGTCCTGAGACAGG - Intergenic
1168184206 19:54687470-54687492 TTAGTGCAAAGTCCTCAGAATGG + Intronic
927455625 2:23246854-23246876 ATGGTGAAAAGTCATAAGACAGG - Intergenic
927614347 2:24576033-24576055 ATCATGTAAAGTCCTCAGAAGGG - Intronic
928472007 2:31584087-31584109 AGGGTGTAGAGTCCTGATAAAGG + Intergenic
929753038 2:44737524-44737546 ATTGTGTAGAGTCCTCAGAAGGG - Intronic
936236044 2:110743660-110743682 ATGGTGCAAAGTGCTCTGAATGG - Intronic
936494021 2:113002168-113002190 AGGGTGAATGCTCCTGAGAAAGG - Intergenic
937018544 2:118629611-118629633 GTGGTGGAAAGTCCTTAAAAGGG - Intergenic
939627917 2:144501215-144501237 ATGGAGAAAGTTCCTGAGATTGG - Intronic
940206159 2:151203914-151203936 ATGGTGAGAAATCCTAACAAGGG + Intergenic
941003988 2:160228489-160228511 AATATGAAAAGACCTGAGAAAGG + Intronic
941241710 2:163046629-163046651 ATGTTGAAAAGAAGTGAGAAAGG - Intergenic
941422274 2:165297403-165297425 ATGGTCAAAATTAATGAGAAAGG - Intronic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
945535285 2:211009781-211009803 TTTGTGAAAATTCCTTAGAAAGG + Intergenic
946284834 2:218695116-218695138 AGGAAGAAAAGTCCTGGGAAAGG - Intronic
946859191 2:223984122-223984144 ATGTTGAAAAGTTCATAGAAAGG + Intronic
948108036 2:235430711-235430733 CCGGGGAAAAGTCCTGAGGAAGG - Intergenic
1168779121 20:473667-473689 ATGGTGAAAAACGCTGAAAAGGG + Intronic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1169293182 20:4370303-4370325 ATGGTGGAAAGAGCTAAGAATGG - Intergenic
1173153063 20:40584309-40584331 ATGGTGCCAAGTCCTCAGGATGG - Intergenic
1174180924 20:48673867-48673889 ATTGTGTAAAGTGCTTAGAATGG - Intronic
1175664866 20:60849933-60849955 ATGGTGCAAAGACCTCAGTAAGG - Intergenic
1175996904 20:62816131-62816153 ATCTTGAAAATTCCCGAGAAAGG - Intergenic
1176786392 21:13261264-13261286 TTAATGAAAAGTCCTGATAAAGG - Intergenic
1177732204 21:25042082-25042104 TTTGTAAAAAGTCCTGAGGAGGG - Intergenic
1178094860 21:29203755-29203777 ATACAGAAAAGCCCTGAGAACGG + Intronic
1178411908 21:32370958-32370980 TTGGTGAGAAGTGGTGAGAACGG - Intronic
1178684537 21:34700875-34700897 CTTGTGAAAGGTCCAGAGAAGGG - Intronic
1178760359 21:35396270-35396292 AGGGAGGAAAGTCCTGGGAATGG + Intronic
1178796029 21:35745207-35745229 AGGGAGAAGAGTCCTCAGAAAGG - Intronic
1179352331 21:40624014-40624036 ATGGCGATAAGTCTTGAGGATGG + Intronic
1182594016 22:31404019-31404041 ATACTCAAAAGTCCTGAGAGAGG - Intronic
1184126296 22:42489661-42489683 AAGGTGAAAGCTACTGAGAATGG + Intergenic
1184575362 22:45360114-45360136 ATTGTTAACACTCCTGAGAAAGG + Intronic
950246090 3:11419983-11420005 ATTATGCATAGTCCTGAGAAGGG - Intronic
951692615 3:25412488-25412510 CTGGTCAACAGTCTTGAGAATGG - Intronic
953086671 3:39675290-39675312 ATGATGCAAAGGCCTAAGAATGG - Intergenic
955919423 3:63939897-63939919 ATAAAGACAAGTCCTGAGAATGG - Intronic
959130486 3:102349953-102349975 TTTGTCAAAAGTCCTGAAAATGG + Intronic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
959814257 3:110657030-110657052 ATAGTGAAAATTACTGATAAAGG + Intergenic
960200554 3:114830354-114830376 ATAGTGAAAAGTCCTTGTAAAGG - Intronic
960921496 3:122751446-122751468 ATGGTAAAAAGTCTGGAAAAAGG + Intronic
960970538 3:123136368-123136390 GTGGTGACCAGCCCTGAGAAGGG - Intronic
963380138 3:144519145-144519167 ATGGTTAAAAATAATGAGAATGG + Intergenic
964204464 3:154157442-154157464 ATGGTGAAAATGCCTCAGCAGGG - Intronic
964487960 3:157205647-157205669 ATGGTGCATAGCCCTGGGAAGGG - Intergenic
965232498 3:166071693-166071715 ATGGGGAACACTCATGAGAAGGG + Intergenic
965369101 3:167838908-167838930 ATGGGGAAAAGTCCAGTAAAAGG - Intergenic
965662425 3:171055850-171055872 ATGGTGATAAGTACTGTGAAAGG + Intergenic
966247723 3:177826920-177826942 ATGGTGAAATCTCCTGTGAATGG + Intergenic
966625782 3:182014926-182014948 ATGATTCAAATTCCTGAGAATGG + Intergenic
967731114 3:192907854-192907876 ATTCTGAAAAGCCCTGAGTATGG + Intronic
971657966 4:29374159-29374181 ATGGTGAAAAGAGATCAGAAGGG + Intergenic
971670083 4:29545193-29545215 ATGGTGAGAAGGACAGAGAAAGG + Intergenic
972054244 4:34780173-34780195 ATTGTGAAAAGACATGAGATTGG - Intergenic
972567416 4:40282197-40282219 CTGGTGAGCACTCCTGAGAATGG + Intergenic
973283597 4:48389695-48389717 GTAATGAAAAGTCTTGAGAATGG + Intronic
973893965 4:55394471-55394493 TTGGGGAAAAGTTCTGAGAGTGG + Intergenic
974270326 4:59642542-59642564 ATGGTGAAACATTCTGAAAAAGG + Intergenic
974324583 4:60397278-60397300 AAGGTGAAATGTCCAGTGAAAGG - Intergenic
976262280 4:83156932-83156954 ATGGTTGTAAGTCATGAGAATGG + Intergenic
977245539 4:94626149-94626171 ATGGTGAAAACTCCTCAGATGGG - Intronic
978712853 4:111806618-111806640 GAGGTTAAAAGTCCTTAGAAGGG - Intergenic
978715906 4:111842057-111842079 ATGGTGACATCTCCTGTGAAAGG + Intergenic
981465856 4:145071034-145071056 ATGATGAAAAGTTCTGAAGATGG + Intronic
982637526 4:157915788-157915810 ATGATGAAAAGTCCAAGGAAGGG + Intergenic
982753892 4:159195675-159195697 ATGGTGACAAGGCATGAAAAGGG - Intronic
984379023 4:178966605-178966627 AAGGGGAAAAGTCTTGAGAGAGG + Intergenic
984749021 4:183253703-183253725 ATACTTAAAACTCCTGAGAAAGG - Intronic
985100068 4:186450096-186450118 GTGATGAAAAATACTGAGAAGGG - Intronic
985181851 4:187273167-187273189 ATGGTGAAAAGTCAGGAAGAAGG + Intergenic
985967522 5:3348953-3348975 ATTGTGAAACGTCCCGGGAAGGG - Intergenic
988890606 5:35612648-35612670 AGAGTGATAAGTCCTGGGAATGG + Intergenic
989780211 5:45255767-45255789 GTGAGGAAAACTCCTGAGAAAGG - Intergenic
990528572 5:56652209-56652231 ATGGTGAAGAGTGAAGAGAAAGG - Intergenic
991406380 5:66304641-66304663 ATGATGAGAAGTCCAGAGATGGG + Intergenic
992018265 5:72597239-72597261 ATGGTGAAATGAGATGAGAAAGG - Intergenic
992703995 5:79369474-79369496 ATGATGAAAAGTTCTGGAAAGGG + Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
993118880 5:83750788-83750810 ATAATGAAAAGCCCTGCGAATGG + Intergenic
993145558 5:84089295-84089317 TTGGAGAAAAATCCTGATAAGGG - Intronic
993422994 5:87724896-87724918 ATGGCTGAAAGACCTGAGAAGGG + Intergenic
995406980 5:111809319-111809341 ATGGTCAAAACTGCAGAGAAGGG - Intronic
995553712 5:113305615-113305637 AAGGTGACAAGGCCTGGGAAAGG - Intronic
997228990 5:132229072-132229094 ATGGGGCAAACTCCTGAGAAGGG - Intronic
998635510 5:143950389-143950411 CTGGTGACAATTCCTGAGAGAGG - Intergenic
1000027679 5:157374290-157374312 GAGGTGAAATGTCCTGAGGAAGG - Intronic
1000882900 5:166717780-166717802 AATTTGAAATGTCCTGAGAAGGG - Intergenic
1001795283 5:174497125-174497147 ATGATGAAAAGTTCTGGAAATGG - Intergenic
1002387808 5:178881867-178881889 ATATTAAAAAGTCCAGAGAATGG - Intronic
1006774868 6:36584459-36584481 ATGGTAAAAAGTACATAGAAGGG + Intergenic
1007217399 6:40250941-40250963 CAGGTGAAAAGACCTCAGAAAGG - Intergenic
1007521818 6:42455879-42455901 ATGGGGATAAGTGCTGAGAATGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008491353 6:52090188-52090210 ATTGTGAAGAGTCTTTAGAAGGG + Intergenic
1009305598 6:62085802-62085824 ATGTTGAAAATTCATGAAAAAGG + Intronic
1013515808 6:110884806-110884828 ATGGTGAATATAACTGAGAAAGG + Intronic
1013741886 6:113297171-113297193 ATAGTGACAAGTGCTAAGAAGGG - Intergenic
1015675805 6:135747113-135747135 ATGGGGATATGTTCTGAGAAAGG + Intergenic
1015767822 6:136737703-136737725 ACTGTGCAAAGTACTGAGAAGGG + Intronic
1016003841 6:139069201-139069223 ATGGTAAAAAGTCCTGTTCACGG - Intergenic
1016719932 6:147284500-147284522 ATTGTGATAAGTGCTGATAAAGG + Intronic
1017379828 6:153815106-153815128 AGGCTGAAAAGTCCTGTGACAGG - Intergenic
1017998216 6:159553507-159553529 CTGGTGAAGAGTCTGGAGAAAGG - Intergenic
1018034370 6:159868741-159868763 ATGATGAAAAGTTCTGGAAATGG + Intergenic
1018169363 6:161132316-161132338 ATGGGGAAAAATCCAGAAAAGGG + Exonic
1018216420 6:161532467-161532489 ATGGAGTAAACTCCTGAGTAGGG - Intronic
1018677604 6:166236475-166236497 ATGGTGATAAGTGCTAAGAAAGG + Intergenic
1019950737 7:4370292-4370314 ATGGTTAAAATTCCTAAGATGGG - Intergenic
1020329671 7:7004814-7004836 GTAGTGAAAGGTCCTCAGAAGGG + Intergenic
1020658021 7:10950680-10950702 ATGGTGTATATGCCTGAGAAGGG + Intergenic
1021518758 7:21517247-21517269 ATGCTGAAATGTCTTGAAAATGG + Intergenic
1022725450 7:32977299-32977321 ATGGGGATATGTTCTGAGAAAGG + Intronic
1023502265 7:40863568-40863590 ATGGTGAGCAGTTATGAGAAGGG - Intergenic
1024594428 7:50920088-50920110 AGGGTGAAAAGACCTGAACATGG + Intergenic
1026032906 7:66810249-66810271 AGGTTGAAATGTCCTGAAAAAGG - Exonic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1029408737 7:100394694-100394716 ATGGTCAAAAGACTTGACAAGGG + Intronic
1029974360 7:104818653-104818675 ATGTTCAAAAGTACTGAGAGAGG + Intronic
1034984185 7:155497233-155497255 GTGGTGCAGAATCCTGAGAAGGG - Intronic
1035307824 7:157944658-157944680 AGAGGCAAAAGTCCTGAGAAGGG + Intronic
1035743945 8:1948064-1948086 AGGGTGAAAAGTCCCAAGGAAGG - Intronic
1036965544 8:13293455-13293477 ATTGTGAAAAGTCCTGGACATGG + Intronic
1037567860 8:20132649-20132671 ATTGTGGAAAGTTCTGAGGAGGG + Intergenic
1038270935 8:26075276-26075298 ATGATGAGAACTCATGAGAATGG + Intergenic
1039300351 8:36202423-36202445 TAGGTGTAAAGTGCTGAGAACGG - Intergenic
1042710394 8:71710760-71710782 ATGTAGAAGAATCCTGAGAATGG + Intergenic
1043132930 8:76484132-76484154 ATGGTAAAAGGTCCTCATAATGG - Intergenic
1044362295 8:91301256-91301278 ATGCTGAAAAGCATTGAGAAGGG - Intronic
1044496993 8:92898256-92898278 ATTGTGACAAGTCTTGAGGATGG + Intronic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1045485683 8:102629123-102629145 TTGCTGAGAAGTCCTTAGAAAGG + Intergenic
1046093250 8:109527972-109527994 ATGGGGTAAGGTACTGAGAATGG + Intronic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1048927550 8:139284293-139284315 ATGGTCAAACGTCCTGAAGAGGG - Intergenic
1050214504 9:3307344-3307366 CTGTTAAAAAGTCTTGAGAAAGG + Intronic
1051090388 9:13400312-13400334 AAGGTGAAAAGTCCTTGAAAAGG + Intergenic
1055675659 9:78657732-78657754 AAGAAGAAATGTCCTGAGAAGGG - Intergenic
1056493945 9:87137127-87137149 ATTGTGAAAAGTTCTGTCAATGG - Intergenic
1057612282 9:96555823-96555845 GTGGTGGGAAGTCCTGGGAATGG - Intronic
1058605325 9:106715443-106715465 AGGGAGAAAAATCTTGAGAAAGG + Intergenic
1058971551 9:110087867-110087889 GTGGTAATAAGTGCTGAGAAGGG + Intronic
1059200295 9:112408491-112408513 ATGGGGATATGTTCTGAGAAAGG + Intronic
1059740850 9:117148061-117148083 ATGGTGGACAGTCTTGAGCAAGG - Intronic
1059832954 9:118118895-118118917 ATTGTGATAATTCCTGAAAATGG - Intergenic
1060732068 9:126044995-126045017 AATGTGAAAAGTTCTGAGAAGGG - Intergenic
1060876579 9:127088210-127088232 ATGGTGAAAAGTCCTGAGAATGG + Exonic
1061357515 9:130117882-130117904 GTGGTGTAAACTCCTTAGAAAGG + Intronic
1187413489 X:19071584-19071606 GTGGTGAGAAGTCAGGAGAAGGG + Intronic
1187766312 X:22646525-22646547 ATGGAGAAAAGAACTCAGAAGGG - Intergenic
1188153563 X:26711880-26711902 AGAGTGAAAAGACCAGAGAATGG + Intergenic
1188340342 X:28992909-28992931 CTAGTGCAAAGCCCTGAGAATGG + Intronic
1189189075 X:39081352-39081374 ATGCTGAATAGTACTGAGAGTGG - Intergenic
1193934032 X:87593125-87593147 ATGTTGAAAAGTAAAGAGAAAGG - Intronic
1194011634 X:88569325-88569347 ATGGTGTATAGTGCTGAGAAGGG - Intergenic
1195126345 X:101813091-101813113 ATGGTGATACCTTCTGAGAAAGG + Intergenic
1198053558 X:132972206-132972228 ATGGTACAAAGCCCTGTGAAAGG - Intergenic
1198515500 X:137402668-137402690 ATGGGGACCAGTCCTGAGTATGG - Intergenic
1198934464 X:141891578-141891600 ATTGTGGAAAGTTCTGAGTAGGG - Intronic
1199549636 X:149044535-149044557 ATGGTGAACAGTTCTGAGAGAGG + Intergenic
1200231509 X:154446073-154446095 ATGGTGAAAAGACGTGAGCGTGG - Intronic
1201254681 Y:12095593-12095615 ATGATGACAAGTGCTGAGAAAGG - Intergenic
1201509420 Y:14741956-14741978 ATGGAGATAAGTGCTGAAAAAGG + Intronic
1201588883 Y:15591807-15591829 ATGGTGAAAAGTGATCTGAAGGG - Intergenic