ID: 1060876694

View in Genome Browser
Species Human (GRCh38)
Location 9:127089070-127089092
Sequence TGCCCACTCCAACCTCAACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060876694_1060876700 13 Left 1060876694 9:127089070-127089092 CCCCGTTGAGGTTGGAGTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1060876700 9:127089106-127089128 ACCAGCCTCCCTTCTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 169
1060876694_1060876702 14 Left 1060876694 9:127089070-127089092 CCCCGTTGAGGTTGGAGTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1060876702 9:127089107-127089129 CCAGCCTCCCTTCTGGTAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 189
1060876694_1060876698 7 Left 1060876694 9:127089070-127089092 CCCCGTTGAGGTTGGAGTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1060876698 9:127089100-127089122 TATACCACCAGCCTCCCTTCTGG 0: 1
1: 1
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060876694 Original CRISPR TGCCCACTCCAACCTCAACG GGG (reversed) Exonic
901513685 1:9731193-9731215 CGCCCACTCCTACCTCCATGGGG + Exonic
901780356 1:11590206-11590228 TGGCCACTCCAGCCTCACCCCGG + Intergenic
909355997 1:74711031-74711053 TGCCCACAGCATCCTCCACGTGG - Intronic
915423101 1:155800775-155800797 TGCTCACTGCAACCTCCACCCGG - Intronic
918631364 1:186722890-186722912 TGAGCACTCCAACCTCTAGGGGG + Intergenic
921186875 1:212678037-212678059 TGCCCCTTCCAGCCTCCACGTGG - Intergenic
1065234588 10:23636212-23636234 TCCCCCCTCCAACCTCAGTGGGG + Intergenic
1065551158 10:26869613-26869635 TTCCCACGCCAACCTCAGGGTGG - Intergenic
1066066662 10:31765917-31765939 TGCCCACCCCCACCTCAGAGTGG + Intergenic
1070234667 10:74611097-74611119 GGCTCACTGCAACCTCAACCGGG + Intronic
1071491369 10:86138818-86138840 AGCCCACTCCTTCATCAACGAGG - Exonic
1071794634 10:88991203-88991225 ACCCCACGCCCACCTCAACGTGG - Exonic
1071903685 10:90148620-90148642 TAAGCACTCCAACCTCAACTTGG - Intergenic
1076272216 10:129163523-129163545 TGGCCCCTCCAACATCAACAGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080410884 11:32023768-32023790 TGCCCACGCCAGCCTCAGTGTGG - Intronic
1080822653 11:35821960-35821982 TGCACTCTCCAACCTCTAGGGGG - Intergenic
1083482654 11:62959668-62959690 TGCCAACGCCAACCTCAGCAAGG - Intronic
1088295775 11:108292242-108292264 TGCCCACCCCTACCCCAGCGTGG - Intronic
1088559147 11:111095564-111095586 TTCCCACTCCCACCACAACCTGG + Intergenic
1091310802 11:134573994-134574016 TGCCCACACCAGCCCCAACATGG + Intergenic
1095397063 12:41773216-41773238 TCCCACCTCCAACCTCAATGTGG - Intergenic
1097194648 12:57236757-57236779 TGCCCACCCCAACCCCACCCCGG + Intronic
1097270635 12:57771990-57772012 TGCTCACTCCAACCCCATGGCGG - Exonic
1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1102506529 12:113387822-113387844 CGCCCGCTCCGACCTCAACCCGG + Exonic
1102890211 12:116552836-116552858 TCCCCACTCCTTCCTCAGCGGGG - Intergenic
1103450286 12:121024097-121024119 GGCCGACCCCACCCTCAACGTGG - Exonic
1106692606 13:32134335-32134357 TTCCCTCTCCCACCTCAACAAGG - Intronic
1113275926 13:108730108-108730130 TCCCCACTCCAATCTCATCTTGG + Intronic
1113823317 13:113231218-113231240 TGCCCACACACACCTCAACCAGG - Intronic
1117464254 14:55976289-55976311 TGCCCCATCCAAACTCAAGGAGG - Intergenic
1119887139 14:78152583-78152605 TGCCCACACCAACACCAAAGTGG - Intergenic
1120031569 14:79647135-79647157 GGCCCACTTAAACCTCAACATGG + Intronic
1122153181 14:99735493-99735515 TGCCAACTCCGACCTCACTGTGG - Intergenic
1122624520 14:103077525-103077547 TGGCCCCTCCAACCTCCACCAGG + Intergenic
1123014156 14:105365606-105365628 TGCTCATACCAACCTCCACGGGG - Intronic
1123711309 15:22989780-22989802 TGCCCACTCCAGCTTGAACAAGG - Intronic
1123938439 15:25205220-25205242 TGCCCACACCAGGCTCAAGGAGG - Intergenic
1124483499 15:30097489-30097511 TGCCGGCTCCAACCTCAGCTAGG - Intergenic
1124489950 15:30149551-30149573 TGCCGGCTCCAACCTCAGCTAGG - Intergenic
1124520079 15:30399737-30399759 TGCCGGCTCCAACCTCAGCTAGG + Intergenic
1124538576 15:30566487-30566509 TGCCAGCTCCAACCTCAGCTAGG - Intergenic
1124760075 15:32441095-32441117 TGCCGGCTCCAACCTCAGCTAGG + Intergenic
1124975323 15:34524478-34524500 TGCCGGCTCCAACCTCAGCTAGG + Intergenic
1125538500 15:40456544-40456566 TGCCCACACCACCCTCAGCCTGG + Intronic
1126487468 15:49198244-49198266 TGCTCACTGCAACCTCCACCTGG + Intronic
1130282375 15:82530368-82530390 TGCCAGCTCCAACCTCCACTAGG - Intergenic
1130575638 15:85090768-85090790 GGCCCACTCCCACTTCAACAGGG - Intronic
1134459779 16:14421205-14421227 TGCTCACAGCAACCTCAGCGTGG + Intergenic
1136247619 16:28984771-28984793 TGCCCACCCCCACCTCAGCCAGG - Intergenic
1136420300 16:30128000-30128022 TGCCTACTACAACCTCATCAGGG - Intergenic
1136515868 16:30768126-30768148 TGCCCACTCCACCCCCAACCTGG + Exonic
1138792723 16:59926473-59926495 CCCACACTCCAACCTCAACTAGG + Intergenic
1142432902 16:90040164-90040186 TGCCCACTCCCACAGCACCGGGG - Intronic
1143107984 17:4538838-4538860 CCCCCACTCCAGCCTCAGCGGGG + Exonic
1143510489 17:7393047-7393069 TGCCCACTCCCACCTGATCCAGG + Intronic
1144820188 17:18067330-18067352 TGCCCACTCAAACCACTACTCGG - Exonic
1146371426 17:32267100-32267122 TGCCCACTCCTCCCTCAGGGTGG + Intronic
1146771103 17:35569299-35569321 TACCCACTTCAACCTAAACTTGG + Intergenic
1148061942 17:44842725-44842747 TTCCCATTCCAACCCCAACTAGG + Intergenic
1151215334 17:72573128-72573150 TGCCCCTTACAACCTCATCGAGG - Intergenic
1152663429 17:81553357-81553379 TCCCCACCCCAACCTCAAAGGGG - Intronic
1152699013 17:81810175-81810197 TGCCCACTGAAAACTCCACGGGG - Intronic
1155437498 18:25828159-25828181 TGCCCGCTCCAACCTCAGAGGGG + Intergenic
1156379709 18:36547019-36547041 AGCCAACTCCACCCTCAGCGGGG - Intronic
1158998179 18:62945214-62945236 TGCTCACTCCAACTGCATCGAGG + Exonic
1164761748 19:30733397-30733419 TGCCCCCTCCAGCCTGAAGGAGG + Intergenic
1165059018 19:33195776-33195798 CGCCCACCCCAACCTCAGTGCGG + Intronic
929061363 2:37927903-37927925 TGCCCACTCCCAGCTCATCCAGG - Intronic
932256252 2:70289737-70289759 GGCTCACTGCAGCCTCAACGTGG - Intronic
935297110 2:101659463-101659485 TTCCCACTCCAACCTCATGCTGG - Intergenic
937318084 2:120944665-120944687 TGCCCAATCCAACTTCACAGGGG + Intronic
938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG + Intergenic
942688133 2:178555980-178556002 TTCCCACTCCATCCCTAACGGGG + Intronic
946119332 2:217495765-217495787 TGCCCACTACATTCTCAATGTGG + Intronic
948794871 2:240397388-240397410 TGCCCACTCCATCCTACAGGTGG + Intergenic
948883213 2:240870736-240870758 TGCCCACTCCCACCTCCTCCCGG - Intronic
1168811012 20:704589-704611 TGCCCACTCCATCCTCACCTTGG + Intergenic
1172702642 20:36862732-36862754 TGCCTTCTCCGACCTCACCGAGG - Exonic
1173688702 20:44942394-44942416 TGCCCCCTCCCACCTCTAGGAGG + Exonic
1175309741 20:58003495-58003517 TGCCCCCTCCAGCCTCAGCCTGG - Intergenic
1175888673 20:62306466-62306488 TCCCCACTCCCACCTTCACGGGG + Intronic
1176201408 20:63862428-63862450 CGAGCACTTCAACCTCAACGTGG + Exonic
1179493473 21:41756521-41756543 TGCCCACTACCACGTCAAGGTGG - Exonic
1179991204 21:44949075-44949097 CGCCCACTCCAATCTCAAAGGGG - Intronic
1182797364 22:33000651-33000673 AACCCACCCCAACCCCAACGGGG - Intronic
1183316833 22:37141641-37141663 TGCCCACTCCAATCTCAGAGCGG + Intronic
1183491158 22:38116307-38116329 TGCCCACTCCAACCTCTGTTCGG + Intronic
1183696925 22:39428790-39428812 TGCGCACTCCATCCTCAGAGTGG - Intronic
1184196580 22:42933653-42933675 CACCCACTCAAACCCCAACGGGG + Intronic
951586014 3:24215441-24215463 TGCCAACTCCAACAGCAACCAGG + Intronic
956732630 3:72210835-72210857 TGCCCTCTCCTCCCTCAACTAGG - Intergenic
961790729 3:129374850-129374872 TCCCCACTCCAAACTGAACATGG - Intergenic
966517003 3:180829679-180829701 AGCCCACCCCAACCTCATCTTGG + Intronic
966811711 3:183852083-183852105 GGCTCACTACAACCTCAACCTGG - Intronic
967317341 3:188161721-188161743 TCCCCACTCCACCCTCCACTAGG + Intronic
977962768 4:103104348-103104370 TGGCCTCTCCAACCTCATTGGGG + Intergenic
982158329 4:152541972-152541994 AGCCCACTGCAGCCTCAACCTGG + Intergenic
983286403 4:165745067-165745089 TCCCCTTTCCACCCTCAACGTGG - Intergenic
984937184 4:184899584-184899606 TGCCCAGGCCAACACCAACGTGG + Intergenic
987422713 5:17739168-17739190 TTCCCACTCCAAACTCAAGATGG - Intergenic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
993333658 5:86630822-86630844 TTTCCACTGCAACCTCAACTGGG - Intergenic
997595812 5:135106819-135106841 TGTCCACTCCCACCTCCATGAGG - Intronic
999240973 5:150127172-150127194 TCACCACTCCAACCCCAACTGGG - Intronic
1000891445 5:166807255-166807277 TGACCACTCCAGCCTCATCATGG + Intergenic
1003070679 6:2943198-2943220 TGCCCATTTCGACCTTAACGAGG + Intergenic
1005545478 6:26864289-26864311 TGCCCACTCATAGCTCAATGTGG + Intergenic
1007398687 6:41591466-41591488 TGCCCACGCCCACCTCAGCAGGG + Intronic
1007856306 6:44861840-44861862 TTTCCACCCCAACCTCAACTGGG + Intronic
1009016180 6:57905053-57905075 TGCCCACTCATAGCTCAATGTGG + Intergenic
1010811378 6:80303488-80303510 TGCCCACACCAACCTAAACATGG + Intronic
1014358513 6:120444250-120444272 TTCCAACTGCAACCTCAGCGAGG - Intergenic
1022135063 7:27439410-27439432 CTCCCACTCCAACCTCCATGTGG + Intergenic
1035005695 7:155658474-155658496 GGCCCACTGCAACCTCCGCGGGG + Intronic
1060876694 9:127089070-127089092 TGCCCACTCCAACCTCAACGGGG - Exonic
1060880976 9:127117793-127117815 GTCCCACTCCAACCTCCATGAGG - Intronic
1186405979 X:9303403-9303425 TGTCCACTCCCACATCAACCAGG + Intergenic
1187200735 X:17131458-17131480 TGCCCACTTCATCCCTAACGTGG - Intronic
1187299976 X:18038819-18038841 GGCCAACTCCAACATCAACAGGG - Intergenic
1189307465 X:39997638-39997660 TCCCCACTCCAACCCCTCCGTGG + Intergenic
1191763929 X:64675588-64675610 TGCTCACTGCAACCTCAACCTGG - Intergenic
1197666021 X:129224272-129224294 TGCCAACTCCATCATCAATGGGG + Intergenic
1199239770 X:145532802-145532824 TTCTCTCTCCAACCTCAACCAGG - Intergenic
1200713775 Y:6514178-6514200 TCCCCACTCCCACTTCAATGTGG + Intergenic
1201020051 Y:9646981-9647003 TCCCCACTCCCACTTCAATGTGG - Intergenic