ID: 1060878457

View in Genome Browser
Species Human (GRCh38)
Location 9:127100581-127100603
Sequence CAGGAAGCCTTGGGTACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878457_1060878467 6 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878467 9:127100610-127100632 GGAGGTCTCTGATGTAGAGGTGG No data
1060878457_1060878469 19 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878469 9:127100623-127100645 GTAGAGGTGGGCAGTGCCCCAGG No data
1060878457_1060878471 29 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878471 9:127100633-127100655 GCAGTGCCCCAGGGTTCCACAGG No data
1060878457_1060878470 20 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878470 9:127100624-127100646 TAGAGGTGGGCAGTGCCCCAGGG No data
1060878457_1060878466 3 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878466 9:127100607-127100629 GAGGGAGGTCTCTGATGTAGAGG No data
1060878457_1060878468 7 Left 1060878457 9:127100581-127100603 CCAGTTGTACCCAAGGCTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1060878468 9:127100611-127100633 GAGGTCTCTGATGTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878457 Original CRISPR CAGGAAGCCTTGGGTACAAC TGG (reversed) Intronic
901775373 1:11557028-11557050 CAGGAAGCCTAGGTGACAAGTGG - Intergenic
901866404 1:12109724-12109746 CAGGACGCCCATGGTACAACTGG + Intronic
902656805 1:17874717-17874739 CAGGAAGCCTGGGGCACAGAAGG - Intergenic
905581508 1:39085972-39085994 GAGGAAGCTTTGGATACCACTGG - Intronic
907610674 1:55867055-55867077 CAGAAAGCTTTTGGTGCAACAGG - Intergenic
908276423 1:62477086-62477108 CCGGAAGCATTGGGTTCACCTGG - Intronic
909604672 1:77496450-77496472 CAGGAAGCCTAGGCTTCAGCAGG + Intronic
909726417 1:78841205-78841227 CAGAAAGCCTTTGGGACCACGGG - Intergenic
912448738 1:109757188-109757210 CAGGAAGCCTAGGCTCCCACAGG + Intronic
913520911 1:119645527-119645549 CAGCAAGCATGGGGTTCAACCGG + Intronic
917721511 1:177790838-177790860 CAGGAAGCCTTGAGGACCAGAGG + Intergenic
917725982 1:177827776-177827798 AACGCAGCCTTGGGTAAAACTGG - Intergenic
923306465 1:232693474-232693496 CAGGGAGCCTTGAGGAAAACAGG + Intergenic
1062870087 10:893715-893737 CAGGAAGCCATGAAGACAACTGG + Intronic
1063983492 10:11476181-11476203 CAGGCAGCCTAAGGGACAACTGG + Intronic
1065100048 10:22322431-22322453 CAGGAGACCTTGGAAACAACTGG - Intronic
1065759551 10:28969078-28969100 CAGAAAGGCTTGGGAACCACTGG + Intergenic
1067090088 10:43262051-43262073 CAGGCAGCCTTGAGTGCATCCGG - Intronic
1070805907 10:79270622-79270644 CAGGAAGCCACGGGGACACCAGG - Intronic
1072270437 10:93771173-93771195 CAGAAAGCCTTGGGTAAATTTGG + Intronic
1076232662 10:128834810-128834832 CCCGAAGCCTTGGGTCCATCAGG - Intergenic
1082022799 11:47549134-47549156 CTGGAACCCTTGTGTACTACTGG + Intronic
1083087051 11:60160039-60160061 GAGGAAGCCTTGATTACATCAGG + Intergenic
1083198054 11:61102679-61102701 GAGTCAGCCTTGGGTAAAACTGG - Intronic
1083640497 11:64142739-64142761 CAGGATGCCTGGGGTCCAAGAGG - Intronic
1086968881 11:93058843-93058865 CAGGAATCCTTGGGTTCCAGAGG - Intergenic
1088737044 11:112736510-112736532 GAGGAAGGCTTGGGTAAATCGGG + Intergenic
1090912884 11:131136666-131136688 CAGGAAGCCCTGGGAACTAGTGG - Intergenic
1092773291 12:11917995-11918017 CAGAAAGTCTTGGGTCTAACAGG - Intergenic
1094147914 12:27249728-27249750 CAGGAAGCCTTCTGTATAAATGG - Intronic
1098445357 12:70560867-70560889 CAGACAGCCTTTGGTTCAACTGG - Exonic
1098729430 12:74014562-74014584 CAGGAAGCTTTGGTGACAAGAGG + Intergenic
1101107376 12:101453999-101454021 CAGGAAGACTTGGTCACCACAGG - Intergenic
1105448255 13:20475688-20475710 CAGGAGGCCTTGGGAACAGAGGG + Intronic
1110863689 13:80371515-80371537 CCGGCAGCCTTGTGTACAAGAGG + Intergenic
1113161848 13:107390789-107390811 CAGGAAGCTTTAGATACAATAGG + Intronic
1115960097 14:38826408-38826430 AAGGCAGCCTTGTGTACAAAGGG - Intergenic
1116435345 14:44889614-44889636 CAGGAAGCCTGAGGTAGAAAAGG - Intergenic
1116468971 14:45265693-45265715 CATGGGGCCTTGGGGACAACAGG + Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121073895 14:91050899-91050921 CATGAATCCTTTGGTAAAACAGG + Intronic
1122455214 14:101845005-101845027 TAGAAAGCCTTGGGGAGAACAGG - Intronic
1123500458 15:20877333-20877355 CAAGAAGCCTCGGTGACAACGGG - Intergenic
1123557703 15:21451026-21451048 CAAGAAGCCTCGGTGACAACGGG - Intergenic
1123593930 15:21888307-21888329 CAAGAAGCCTCGGTGACAACGGG - Intergenic
1128698603 15:69787867-69787889 GAGTAAGCCTTGGTTACAAGAGG - Intergenic
1129670634 15:77605965-77605987 CAGCCAGAGTTGGGTACAACGGG - Intergenic
1131752865 15:95528166-95528188 GAGGAAGCCTTTGGTACATGTGG - Intergenic
1202966055 15_KI270727v1_random:178198-178220 CAAGAAGCCTCGGTGACAACGGG - Intergenic
1132679510 16:1133988-1134010 CAGGAAGCGCTGGGTCCACCTGG + Intergenic
1140907302 16:79419781-79419803 CAGGAAGCTTTAGGGACACCAGG + Intergenic
1141910737 16:87056878-87056900 GAGGAAGCCCTGGGTACCCCAGG + Intergenic
1143114190 17:4572239-4572261 TAGGAAGCCTTGGATGCCACAGG + Intergenic
1143565329 17:7717316-7717338 CAGGCAGCCGTGGGTGCAGCTGG - Intergenic
1146397536 17:32480702-32480724 CAGGAAGCCATGAGGACACCAGG - Intronic
1146567528 17:33925825-33925847 CACGCAGCCTTGGGTAGAGCAGG - Intronic
1148519735 17:48261389-48261411 CAGGAATCCTTGGGAGCTACAGG + Intronic
1150417693 17:65000833-65000855 CAGGAAACCTTGGCTTCAAGAGG - Intergenic
1151555022 17:74842483-74842505 CGGGAAGCCTTGCGTCCCACGGG + Exonic
1152655637 17:81518050-81518072 CAGGTAGCCTTGGGAGCAGCGGG - Intronic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1155177496 18:23313662-23313684 CAGGAAGCCCCTGGTACAAATGG - Intronic
1155978734 18:32159254-32159276 CATGGACCCTTGGGTACAGCAGG - Intronic
1156614819 18:38771043-38771065 CAGGAAGTGTTGGGTATAAATGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157712752 18:49861173-49861195 CAGCAAGCCTGGTGTACAATAGG - Intronic
1158518696 18:58152242-58152264 CAGCAAGGCTTGGGAACAAGAGG + Intronic
1162053377 19:8048981-8049003 GAGGCAGCTGTGGGTACAACAGG + Intronic
1165226445 19:34358484-34358506 CAAGCAGCCTTGGGAGCAACAGG - Intergenic
1167394188 19:49216948-49216970 CATGAAGCCATGGGTATAAATGG - Intergenic
925357204 2:3250211-3250233 CAGGCAGCCATGGGGACAGCTGG + Intronic
926621352 2:15049454-15049476 CAGGAGGCCTGGGGTCCCACAGG - Intergenic
929897941 2:45977891-45977913 CATGAACCCTTGGATCCAACTGG + Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
935013201 2:99155020-99155042 CACGAGGCCGTGGGTACGACCGG + Exonic
937244773 2:120485528-120485550 CAAGAAGCCTTGGGGACAGTGGG - Intergenic
937863523 2:126731524-126731546 CAGGGATCCTTGGGTACAGGGGG + Intergenic
938590798 2:132734478-132734500 CAGGCAGCCTGGGGTACATAGGG - Intronic
943028650 2:182659663-182659685 CAGGTAGAATTGGGTAGAACTGG - Intergenic
946453265 2:219799418-219799440 CAAGAAGCTTTGGGGCCAACAGG + Intergenic
948363402 2:237438308-237438330 CAGGAAGGCTTGGGAACTGCAGG + Intergenic
948789794 2:240371341-240371363 AAGGAAGCCTTGTGTACCAGGGG + Intergenic
1172703507 20:36866221-36866243 AGGGAAGCCTTGAGAACAACAGG + Intergenic
1174087244 20:48018164-48018186 CAGGAGGCCATGGGTACAGAGGG - Intergenic
1174428296 20:50448897-50448919 GAGGAAGCCTTGGGAATATCTGG - Intergenic
1175290325 20:57870988-57871010 CACAAAGCCTTGGGTACCACTGG + Intergenic
1175310538 20:58008671-58008693 CCTGAAGCCTGGGGTACAGCTGG + Intergenic
1176206911 20:63894297-63894319 CGGGAAGCCTTGGATGCTACTGG + Intergenic
1178944129 21:36932074-36932096 CAGGAAGCTCAGGGTACTACTGG - Intronic
1179711687 21:43267262-43267284 CAGGAGGCCAGGGGTACAGCTGG - Intergenic
1179929197 21:44556026-44556048 AAGGAATCCTTGTGAACAACAGG + Intronic
1181276977 22:21693590-21693612 CAGGAAGACCTGGGGACAGCTGG + Intronic
1182527286 22:30928291-30928313 CAGGCATCCTTGGGTAAAGCGGG - Intronic
1183905105 22:41034605-41034627 CAGGAAGCCTTGGGGTACACAGG + Intergenic
953775777 3:45816033-45816055 GAGGGAGCCTTGGGGCCAACAGG + Intergenic
954386839 3:50248572-50248594 CAGGAAGCAGGGGGAACAACGGG - Intronic
954451126 3:50572263-50572285 GAGGAAGCCTGGGGTAAGACTGG - Intronic
962902153 3:139770847-139770869 CAGGAACTCTTGGGCACTACAGG - Intergenic
962916123 3:139905565-139905587 CAGGCTGCCCTGGGTACAAGTGG - Intergenic
963213044 3:142715519-142715541 CACGAAGTTTTGGGTACATCAGG + Intergenic
965805076 3:172533806-172533828 AAGGCAGCCTTGGGTACCCCAGG - Intergenic
966311082 3:178594640-178594662 CAGGATGCCTTGTAGACAACTGG + Intronic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
970209678 4:13696454-13696476 CAGGAAGCCTTGCGTATATGAGG + Intergenic
970493962 4:16607020-16607042 AAGGCAGACTTGGGTAAAACTGG + Intronic
972544522 4:40067645-40067667 CTGGAACCCTTGTGTACTACTGG - Intronic
974463800 4:62226402-62226424 GAGGCTGCCTTGGGTGCAACTGG + Intergenic
975690633 4:76959114-76959136 CAGGAAGCCTTGGACACCGCAGG - Intronic
975738562 4:77405817-77405839 CAGGAAGTCTTTTGTAAAACAGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
993004249 5:82413428-82413450 CAGGAGGCCTTGGAAACACCTGG - Intergenic
995245039 5:109925462-109925484 CAGGGACCCTTGTGTACATCAGG + Intergenic
998443371 5:142180117-142180139 CAGGAATCATTCTGTACAACAGG + Intergenic
1002176561 5:177404277-177404299 CATGAAGCCTAGGGGACACCGGG + Exonic
1004477346 6:15986172-15986194 CAGGCAGACTTGGGTTAAACTGG + Intergenic
1004829698 6:19463731-19463753 CAGGCGGCCTGGGGTACAATGGG - Intergenic
1006193364 6:32222788-32222810 CAGGAAGCCAGGGGCACACCTGG + Exonic
1008657167 6:53627749-53627771 CAGGAGGCGTTGGTTTCAACAGG - Intergenic
1014353627 6:120375949-120375971 AAGCAAGCCTTGGGTAAAACAGG + Intergenic
1018968987 6:168512237-168512259 CAGGAAGTCGTGGGCAGAACAGG + Intronic
1021400263 7:20201874-20201896 CAGGAAGACATGGTTCCAACTGG - Intronic
1021952477 7:25788813-25788835 CAGGAAGCCTATGGTCTAACAGG + Intergenic
1024560448 7:50640408-50640430 GAGGAAGCCTGTGGTACATCTGG + Intronic
1030729516 7:112969431-112969453 CAGGGAGCCTGGGGTACAAGTGG + Intergenic
1032953818 7:136947807-136947829 GAGAAAATCTTGGGTACAACTGG + Intronic
1034315370 7:150126167-150126189 CAGTGAGCCTTGGAGACAACAGG + Intergenic
1034791523 7:153974627-153974649 CAGTGAGCCTTGGAGACAACAGG - Intronic
1035719988 8:1784702-1784724 CTGGCAGCCCTGGGTACTACTGG - Exonic
1036669830 8:10775908-10775930 CAGGAAGCTTTGGCTGCAGCGGG + Intronic
1044319829 8:90790105-90790127 CAGGCAGCGTTGAGAACAACTGG + Intronic
1046619769 8:116516500-116516522 AAGGAAGTCTTGGGAGCAACAGG + Intergenic
1047712884 8:127569505-127569527 CAGGAGGCCTTGGGTAATTCTGG + Intergenic
1054739661 9:68792112-68792134 AGGGAAGCCCTGGGAACAACAGG - Intronic
1056919570 9:90774333-90774355 CAGGATGCCTTGGGGACAGTGGG - Intergenic
1059704238 9:116805548-116805570 GAGGAAGCCATGGGCACAATGGG - Intronic
1060878457 9:127100581-127100603 CAGGAAGCCTTGGGTACAACTGG - Intronic
1061447384 9:130648025-130648047 CACAATGCCTTGGGTACAGCTGG - Intergenic
1062475082 9:136722714-136722736 CTGGCAGCCTTGGGTGCACCTGG - Intronic
1199977017 X:152900151-152900173 CAGGAGGCCTTGGGGACACTGGG - Intergenic