ID: 1060878953

View in Genome Browser
Species Human (GRCh38)
Location 9:127104347-127104369
Sequence GAGGCCTGGTACTGTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878953_1060878963 29 Left 1060878953 9:127104347-127104369 CCTGAGAAACAGTACCAGGCCTC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878953 Original CRISPR GAGGCCTGGTACTGTTTCTC AGG (reversed) Intronic
900519237 1:3097732-3097754 GAGGCCTGGGAAGGTTCCTCAGG + Intronic
901113516 1:6818970-6818992 GAGGCCTTGTTCTGTTGCCCAGG + Intronic
902878785 1:19357144-19357166 GAGGCCAGGTACGGTGGCTCGGG - Intronic
903742306 1:25565322-25565344 GAGGGATGGGACTGTTGCTCTGG - Intronic
904945882 1:34198359-34198381 GAGGCCTGGTCCTCCCTCTCTGG + Intronic
906207503 1:43995057-43995079 GAGCCCTGGTCCTGTGTCTCGGG + Intronic
906479096 1:46188760-46188782 GAGGCCTGGTCCAGTGTCTAAGG + Exonic
907638132 1:56157179-56157201 GAGGCCTGGTGCAGCTTCACAGG + Intergenic
910147246 1:84096203-84096225 AAGGCCTGGTGGTGTTTATCAGG + Intronic
913495613 1:119425663-119425685 CAGGCCTGGTCCTGTATCTTGGG + Intergenic
915396947 1:155592038-155592060 GAGGCATGGTGCTTTCTCTCCGG + Intergenic
915412483 1:155712879-155712901 GAGGCATGGTGCTTTCTCTCCGG + Intronic
917084289 1:171290799-171290821 CAGGCCTGGTTCTGTGTCTTGGG + Intergenic
919133458 1:193479605-193479627 GAGACCTGGTTCTCTTTTTCAGG - Intergenic
1065417858 10:25508569-25508591 GAGGCCTGTAGCTGTTTATCAGG + Intronic
1070901697 10:80035634-80035656 GAAAACTGGTTCTGTTTCTCTGG + Intergenic
1071180932 10:82982571-82982593 GAGGCTTGCCACTGTGTCTCTGG + Intronic
1071244001 10:83742540-83742562 GATGTGTGGTACTATTTCTCAGG + Intergenic
1071341582 10:84653717-84653739 AAGGTCTGGTTCTGTTTCCCAGG + Intergenic
1073476719 10:103758505-103758527 TAGGCCTGGTTGTGGTTCTCAGG - Intronic
1075670762 10:124262734-124262756 GTGGACCGGTACGGTTTCTCAGG + Intergenic
1076567528 10:131409141-131409163 GATGCCAGGTACTGCTCCTCAGG - Intergenic
1077047154 11:551701-551723 GAGGCCCGGGACTGCGTCTCAGG - Exonic
1077274498 11:1697519-1697541 AAGCCCTGCTACTGTTCCTCAGG + Exonic
1079284522 11:19117072-19117094 GAGGGCTGGGATTGGTTCTCCGG + Intergenic
1079741599 11:24069257-24069279 AATGCCTGATACTTTTTCTCTGG + Intergenic
1079782274 11:24622490-24622512 GAGGCCTGGTGCGGTGTCTCAGG - Intronic
1081295451 11:41381344-41381366 TAGGCCTGGTGCTGTGGCTCAGG + Intronic
1081705018 11:45177651-45177673 GAGGCTTGATCCTGGTTCTCCGG + Intronic
1082217018 11:49583666-49583688 GAGGCCTTATTGTGTTTCTCAGG + Intergenic
1084383144 11:68826162-68826184 GAGGCCGGGCACTGTGGCTCAGG + Intronic
1085213850 11:74809781-74809803 GAGGCCTCGTCCAGCTTCTCTGG + Intronic
1086632534 11:89040501-89040523 GAGGCCTTATTGTGTTTCTCAGG - Intronic
1087385925 11:97468339-97468361 GAGGCCTGGGACTGAGGCTCTGG - Intergenic
1087494771 11:98877142-98877164 GAGGCCAGGAGCTGTTTCTCAGG + Intergenic
1090821958 11:130350511-130350533 GAGGCCAGGCACTGTGGCTCAGG - Intergenic
1093262092 12:16950831-16950853 GAGGCCTATCACTGTTTCCCTGG + Intergenic
1094089383 12:26630925-26630947 GAGGCCTGCCAATATTTCTCAGG + Intronic
1095631259 12:44379796-44379818 GAGCCCTGGTACTTTTTTTATGG + Intronic
1095704547 12:45222601-45222623 GAGGCCTGCTTCTGCTTCTGAGG - Intronic
1097714981 12:62956263-62956285 GAGGTCTGGTTCTGTTGCCCAGG + Intergenic
1099449600 12:82792750-82792772 GAGGCCAGGTGCAGTGTCTCAGG - Intronic
1099994128 12:89758771-89758793 GAAGCCTCGTACTGTTACCCGGG + Intergenic
1100398254 12:94203748-94203770 TAGGCCAGGCACTGTTTCTGGGG - Intronic
1102380954 12:112466489-112466511 GAGGTCTGGTTCTGTTGCCCAGG - Intronic
1102558334 12:113743774-113743796 GAGACGAGGTACTGTTTCCCAGG - Intergenic
1103739959 12:123084382-123084404 GGGTCCTGGTCCTGTTTCCCTGG + Intronic
1104021634 12:124995937-124995959 GAGGTCTGGCTCTGTTGCTCAGG + Intronic
1105447779 13:20472689-20472711 GAGGCCTGGGACTGGCTCACTGG + Intronic
1105819254 13:24064969-24064991 GTGGCCTGTGACAGTTTCTCAGG - Intronic
1105993045 13:25641930-25641952 GAGGTGTGGTATTATTTCTCAGG - Intronic
1107129522 13:36880034-36880056 GGGGCCTGGTTCTGTTGCTCAGG - Intronic
1109278569 13:60329800-60329822 CAGGCCTGTTCCTGTTTATCAGG + Intergenic
1110977679 13:81861392-81861414 GATGCGTGGTATTATTTCTCAGG - Intergenic
1111431949 13:88157014-88157036 GAGCCATGCTACTGATTCTCTGG - Intergenic
1114779706 14:25524439-25524461 GTGGTCTGATAATGTTTCTCAGG + Intergenic
1117094659 14:52284783-52284805 CAGGCCTGGTCCTGTGTCTTAGG - Intergenic
1117094665 14:52284829-52284851 CAGGCCTGGTCCTGTGTCTTGGG - Intergenic
1119665404 14:76481789-76481811 CAGGCCTGGTCCTGTCTCTCTGG - Intronic
1121558813 14:94859145-94859167 GATGCCAGGTTCTGTTTCTCTGG + Intergenic
1122032065 14:98919526-98919548 CTGGCCTGGTCCTGTTGCTCAGG - Intergenic
1122312941 14:100808684-100808706 GGGGTCTTGTACTGTTGCTCAGG + Intergenic
1128911399 15:71518846-71518868 GTGGCCAGGCACTGTTGCTCAGG + Intronic
1132350676 15:101138076-101138098 GTGGCCTGCTCCTGTCTCTCAGG + Intergenic
1133217567 16:4302546-4302568 GAGGCCGGGTACAGTGGCTCAGG - Intergenic
1134389545 16:13806850-13806872 TAGGTCTGGGACTGTTTCTGGGG + Intergenic
1138717844 16:59044688-59044710 GAGGCCTGGTGCATTTTCTTGGG - Intergenic
1140241131 16:73201931-73201953 ACGGCGTGGTAGTGTTTCTCAGG + Intergenic
1142833222 17:2564881-2564903 AAAGCCTGGTTCTGTTTCTCTGG - Intergenic
1142901988 17:3018018-3018040 GAGCCCGGGTGCTGATTCTCAGG + Intronic
1143271193 17:5676067-5676089 GAGGGCTGGTAGTGTTTCTTGGG + Intergenic
1144942513 17:18951579-18951601 GGGGCCTGGGACTGTTTCACGGG + Intronic
1145277269 17:21439508-21439530 GAGGCCAGGTGCAGGTTCTCTGG + Intergenic
1145315105 17:21725402-21725424 GAGGCCAGGTGCAGGTTCTCTGG + Intergenic
1145713539 17:26997339-26997361 GAGGCCAGGTGCAGGTTCTCTGG + Intergenic
1145763288 17:27440373-27440395 AAGGCCTGGCTCTGTTGCTCAGG + Intergenic
1146931399 17:36780664-36780686 AAGGCCTTGCTCTGTTTCTCAGG - Intergenic
1147752184 17:42743148-42743170 GAGGCCTGGCACAGTGGCTCAGG - Intronic
1147816588 17:43214932-43214954 GAGGCCTCGCTCTGTTGCTCAGG - Intronic
1151818086 17:76481403-76481425 GGGGCCTGGGTCTCTTTCTCGGG + Exonic
1152587202 17:81194400-81194422 GAGGCCTGGTCCTCTCGCTCTGG - Intronic
1153414851 18:4835494-4835516 CAGTCTTGGTACTGTTTGTCAGG + Intergenic
1155667394 18:28327805-28327827 GAGGCCTGGCACTGTATATTGGG + Intergenic
1157139752 18:45094015-45094037 GAGGCCAGGTACGGTGGCTCAGG + Intergenic
1160603203 18:80030213-80030235 CAGGCCTGGTCCTGTGTCTTGGG - Intronic
1160909390 19:1467811-1467833 GAGGCCGTGTACTGCTTCTACGG + Exonic
1162083877 19:8236651-8236673 AGGGCCTGGTTCTGTTGCTCAGG - Intronic
1162158076 19:8693481-8693503 GAGGTCTGGTTGTGTTTCCCAGG + Intergenic
1162306537 19:9877876-9877898 GAGGTCTGGTTCTGTTGCCCAGG + Intronic
1162500697 19:11051814-11051836 GAGGCCGGGTGCTGTGACTCAGG + Intronic
1162743005 19:12783779-12783801 GAGGGCTCCTCCTGTTTCTCAGG + Intronic
1162832787 19:13297480-13297502 GAGGCCTGGCTCTGTTGCCCAGG - Intronic
1163121954 19:15223608-15223630 GAGGCCTGGGACAGTTGCCCGGG - Intergenic
1163803951 19:19385235-19385257 GTGGCCTGGCAGTGTTTCTAAGG - Intergenic
1164606409 19:29601709-29601731 GAGGCCAGGTACGGTGGCTCAGG + Intergenic
1166072108 19:40393819-40393841 GAGGCCTGCTCCTGTCTCTCTGG - Exonic
1167132779 19:47598315-47598337 GAGGTCTTGTCCTGTTTCCCAGG - Intergenic
1168236748 19:55068552-55068574 GAGGCCGGGCACTGTGGCTCAGG + Intronic
926243930 2:11108142-11108164 GAGGCCAGGTATGGATTCTCAGG - Intergenic
927826583 2:26313655-26313677 GAAGCCTGGTCCTGTTGCCCAGG + Intronic
932777185 2:74535432-74535454 GAGACCTGGTACTGGGACTCTGG - Exonic
939333731 2:140798512-140798534 GAGGCCTGAAACTGTGACTCTGG - Intronic
942687971 2:178554017-178554039 GAGTCCTGTTACTTTTTGTCTGG + Exonic
943301378 2:186206894-186206916 GAGGCCTGGAACTGATTCTTTGG - Intergenic
943810786 2:192186666-192186688 GAGGCCTGGTATTCTTGCCCCGG + Intronic
944521260 2:200570088-200570110 GTGGCCTAATACTGTTACTCTGG + Intronic
949011286 2:241680340-241680362 GAGCCCTGGTCCTGTTTCATAGG + Intronic
1169522442 20:6387978-6388000 GACACCTGGTTCTGTTTCTGTGG - Intergenic
1169715872 20:8617098-8617120 GAGGCCTTTTCCTGTTTCCCAGG + Intronic
1171375811 20:24693609-24693631 CAGGCCTGGTTCTGACTCTCTGG - Intergenic
1172839364 20:37892901-37892923 GAGGCCTGGTCCCTGTTCTCTGG + Intergenic
1175414335 20:58791944-58791966 GAGGCCTGGGACGGCCTCTCTGG - Intergenic
1175871522 20:62211595-62211617 GCTGCCTGGCACTGTCTCTCTGG - Intergenic
1175905842 20:62378936-62378958 GGGGCCTGGGACTGGCTCTCGGG - Intergenic
1177382181 21:20359079-20359101 GAGGCCTAGTACTGATTATCTGG + Intergenic
1179595482 21:42440213-42440235 AAGGCCACGTCCTGTTTCTCAGG - Intronic
1179798822 21:43800992-43801014 GAGGCCTGGTGGTGTTTCTGAGG + Intronic
1181037055 22:20174767-20174789 GGGCCCTGGTCCTGTTTCCCAGG + Intergenic
1181498387 22:23301408-23301430 GAGCACTGGGACTGTGTCTCAGG + Intronic
1181562360 22:23713209-23713231 GAGGCCTTGCACTGTTGCCCAGG - Intergenic
1181955121 22:26582779-26582801 GAGTCCTGGTGCTGAATCTCAGG + Intronic
1182164650 22:28161337-28161359 GAGGCCTTGTTATGTTCCTCAGG - Intronic
1182430889 22:30298325-30298347 GTGGCCTGGTATTGGTGCTCTGG + Intronic
1184869133 22:47222496-47222518 ATGGCCTGGAACTGTTTATCTGG + Intergenic
1203288926 22_KI270735v1_random:15718-15740 AAGGCCAGGTACTGTGTCTCAGG - Intergenic
949133867 3:538212-538234 GTGGTCTGTGACTGTTTCTCAGG - Intergenic
949305617 3:2637221-2637243 GAGGCCAGGTACGGTGGCTCAGG - Intronic
956764797 3:72475459-72475481 GAGGCCTTTTACTGTTTTTTCGG + Intergenic
957305113 3:78447549-78447571 ATGCCCTGTTACTGTTTCTCAGG - Intergenic
960917814 3:122714867-122714889 GAAGCCTGGTAATATTCCTCTGG - Intronic
961246283 3:125456619-125456641 AAGGTCTGGTTCTGTTTCCCAGG - Intronic
961372646 3:126440854-126440876 CAGGCCTGGTCCTGTTTCCTTGG + Intronic
962072483 3:132046095-132046117 TAGGCAGAGTACTGTTTCTCTGG - Intronic
967429206 3:189361919-189361941 GAGGCTTGGGACTGTGTGTCAGG + Intergenic
976972218 4:91118309-91118331 GAGGTCTCGTTCTGTTGCTCAGG + Intronic
980024681 4:127751252-127751274 GATGCCTGGTATTATTTCTGAGG - Intronic
983587481 4:169371234-169371256 CCGGCCTGGTTCTGTTTCTTTGG + Intergenic
983625087 4:169794345-169794367 GAGGCCTGTTACTGCTTAACAGG - Intergenic
983633841 4:169877957-169877979 GAGGCCTGTTACTGCTTAACAGG + Intergenic
983843794 4:172490745-172490767 CAGGCCTGGTACAGATTCTTGGG - Intronic
985486220 5:152490-152512 TAGGCCAGGTACTGTGGCTCAGG - Intronic
986799151 5:11241734-11241756 CAGGCCTGCTGCTATTTCTCTGG - Intronic
986884437 5:12216291-12216313 CTGGCCTGGTTCTGTTTGTCTGG - Intergenic
988060522 5:26161788-26161810 TATGCCTGGTACTTTTTCTAGGG + Intergenic
988085344 5:26468641-26468663 TACGGCTGGTTCTGTTTCTCTGG + Intergenic
990099571 5:52164852-52164874 GAAATCTGGTTCTGTTTCTCTGG + Intergenic
990735288 5:58853834-58853856 GAGCTCTGTGACTGTTTCTCTGG - Exonic
1001945562 5:175774838-175774860 GTGGCCTGGGCCTTTTTCTCTGG - Intergenic
1002397522 5:178969701-178969723 GAGGCCAGGAGCTGCTTCTCAGG - Intergenic
1003437536 6:6105866-6105888 GAGGACTGGGACTGTTGCTCTGG + Intergenic
1003899394 6:10640069-10640091 GAGGCCAGGCACGGTGTCTCAGG + Intergenic
1004237654 6:13888679-13888701 GAGGCCAGGTGCGGTTGCTCAGG - Intergenic
1005999883 6:30956406-30956428 GAGGCCAGTTAATGTGTCTCCGG - Intergenic
1006693667 6:35912323-35912345 GGGGTCTGGTACTGTTGCCCAGG - Intronic
1006777387 6:36606177-36606199 GAGACGTGGTTATGTTTCTCAGG + Intergenic
1007448850 6:41927768-41927790 GGGGCCTGGAACTGTTTCCCTGG - Intronic
1007964032 6:45987043-45987065 GAGACCTGATACTCTTTCACTGG + Intronic
1011346995 6:86381183-86381205 GAGTCTTAGCACTGTTTCTCTGG + Intergenic
1013609685 6:111782796-111782818 GAGGCCAGGTACAGTTGCTCTGG + Intronic
1013816728 6:114108269-114108291 GAGGAGTGGGACTTTTTCTCGGG - Intronic
1014138232 6:117911635-117911657 GAGGTCTCGTTCTGTTTCCCAGG + Intronic
1017610082 6:156176199-156176221 GAGGCCGGCTGCTCTTTCTCAGG + Intergenic
1018398917 6:163403128-163403150 GAGGCCTCGCTCTGTTGCTCAGG + Intergenic
1020150415 7:5677728-5677750 GAGTCCTGGGAGTGTTGCTCAGG + Intronic
1022204459 7:28150007-28150029 GAAGCCAGGTAATGTTTGTCAGG - Intronic
1023118696 7:36887545-36887567 GAGGCAAGGTATTGTTTCTGGGG - Exonic
1023377317 7:39570142-39570164 CAGTCCTGGTACTGTTGCTTGGG - Intronic
1024687443 7:51761910-51761932 GAGGCCTGATGCTGTTTATGAGG + Intergenic
1025562316 7:62382772-62382794 GAGGCCAGGCACAGTGTCTCAGG + Intergenic
1025825124 7:65004780-65004802 GGGGCCTAGTACAGTGTCTCTGG - Intronic
1030655362 7:112161715-112161737 GAGCTCTGGTACAGTCTCTCTGG + Intronic
1032431135 7:131862653-131862675 GAGGCCTGGGACTGCTTCAGAGG - Intergenic
1033461180 7:141548941-141548963 GAGGCCTGGAACAGTGCCTCGGG - Intergenic
1035893447 8:3371228-3371250 AAATCCTGGTTCTGTTTCTCTGG + Intronic
1036013149 8:4750880-4750902 AAGACCTAGTACTGCTTCTCTGG - Intronic
1037332873 8:17761996-17762018 GAGGCCTGGTGCAGTGGCTCAGG + Intronic
1038388700 8:27174396-27174418 GAGAGATGGTTCTGTTTCTCTGG + Intergenic
1040743832 8:50615859-50615881 GTGCCATGGTTCTGTTTCTCTGG - Intronic
1041915145 8:63131538-63131560 GAGGCCTGGCACAGTGGCTCAGG - Intergenic
1044702457 8:94976867-94976889 GAGGCCAGGTACAGTGGCTCAGG + Intronic
1047338154 8:123955574-123955596 GAGGCCGGGCAATGTTTCTAAGG - Intronic
1049559726 8:143303773-143303795 AGAGCCTGGTTCTGTTTCTCAGG + Intergenic
1057135142 9:92682225-92682247 TAGTACTGGTTCTGTTTCTCTGG + Intergenic
1057919159 9:99082455-99082477 GTTGGCTGGTACTGCTTCTCTGG + Intergenic
1058975340 9:110121058-110121080 CAGACCTGGTAATGCTTCTCTGG - Intronic
1059252431 9:112897719-112897741 GAGGTCTCGGTCTGTTTCTCAGG - Intergenic
1060045373 9:120336349-120336371 GAGACCTTGTACTGTGGCTCGGG - Intergenic
1060878953 9:127104347-127104369 GAGGCCTGGTACTGTTTCTCAGG - Intronic
1061932691 9:133841435-133841457 GAGTCCTGGCCCTGTTTCCCTGG + Intronic
1062339698 9:136088516-136088538 GTGGCCAGGGACTCTTTCTCGGG + Intronic
1185982566 X:4795916-4795938 GAGCGCTGGCCCTGTTTCTCTGG + Intergenic
1187726728 X:22211012-22211034 GGGGCCTGGAACAGTTGCTCTGG + Intronic
1187759259 X:22561894-22561916 GAGGTCTTGCTCTGTTTCTCTGG - Intergenic
1189418034 X:40831988-40832010 GAGGCCTGGGACTGGGTCCCAGG - Intergenic
1189445264 X:41075318-41075340 AAGGCCTGGTTCTGTCGCTCAGG + Intergenic
1189807978 X:44754217-44754239 AAGGCCAGGTACTGTGGCTCAGG + Intergenic
1192668461 X:73112904-73112926 GAAATCTGGTTCTGTTTCTCTGG + Intergenic
1193024019 X:76824532-76824554 GATGATTGGTTCTGTTTCTCTGG + Intergenic
1193640875 X:84008457-84008479 CAGGCCTGGTCCTGTGTCTTGGG - Intergenic
1195018002 X:100797505-100797527 CAGGCCTGGTTCTGTGTCTTGGG - Intergenic
1195510452 X:105710132-105710154 GAAGCCAGGTAATGTTTCTTGGG - Intronic
1201694953 Y:16814641-16814663 GAGCACTGGCCCTGTTTCTCTGG - Intergenic
1201748475 Y:17406062-17406084 GAAGCCTGGTTCTGTTGCCCAGG + Intergenic
1201929424 Y:19325727-19325749 GAGTTCTGTTGCTGTTTCTCAGG + Intergenic