ID: 1060878955

View in Genome Browser
Species Human (GRCh38)
Location 9:127104361-127104383
Sequence CACCTGGGTTCTGGGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878955_1060878963 15 Left 1060878955 9:127104361-127104383 CCAGGCCTCCCAGAACCCAGGTG 0: 1
1: 0
2: 4
3: 42
4: 391
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878955 Original CRISPR CACCTGGGTTCTGGGAGGCC TGG (reversed) Intronic
900193005 1:1359265-1359287 CACCTGGTTTCAGGGACACCAGG - Intronic
900238809 1:1605108-1605130 CTCCTGGGCGCTGGGAGGGCAGG - Intergenic
900293816 1:1938677-1938699 AACCTGGGTGCAGAGAGGCCTGG - Intronic
900398080 1:2461459-2461481 CCCCTGGGCACTGGGAGGCTAGG + Intronic
900416939 1:2539702-2539724 CATCTTGGTCTTGGGAGGCCTGG + Intergenic
900478375 1:2886811-2886833 GACTGGGGTGCTGGGAGGCCAGG - Intergenic
900800053 1:4731854-4731876 CAGGTGGGTCCTGGGAGGCTGGG + Intronic
900898228 1:5498606-5498628 CACCAGGATTCAGGGAGTCCTGG - Intergenic
901001702 1:6152039-6152061 GACCTGGGTGCTGGGCGGCCAGG + Intronic
901419808 1:9143303-9143325 CACCAGGGGTCTGGGAGGCAGGG - Intergenic
901637672 1:10677884-10677906 CACCTGCGGTGTGCGAGGCCTGG + Intronic
901942413 1:12673368-12673390 CCCATGGGATCTGGGAGGCAAGG + Intergenic
902293685 1:15451564-15451586 TGCCTGGGGGCTGGGAGGCCTGG + Intergenic
902372556 1:16015451-16015473 CACCTGGGGTCTGGGGTGCGTGG + Exonic
902633334 1:17718913-17718935 ACCCTGGGTTCTGGGAAGGCAGG + Intergenic
903262817 1:22140556-22140578 CTCCAGGCTTGTGGGAGGCCAGG + Intronic
903327261 1:22576603-22576625 CACCTATGTCCTGGAAGGCCAGG - Exonic
903335266 1:22620302-22620324 CACCTGGGTTCTGGGAAATGGGG + Intergenic
903952683 1:27005378-27005400 TACCTGGGTTTGGGGAGGGCTGG - Exonic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
904701964 1:32363004-32363026 CAGAGGGGTTCTGGGAGTCCAGG + Intronic
905318084 1:37096298-37096320 CACCTGGGTCCTTGGTGCCCTGG - Intergenic
905566456 1:38969096-38969118 CTCATGGGGTCTGGGTGGCCAGG + Intergenic
907253616 1:53161075-53161097 CACATGGGGTGTGGGAAGCCTGG + Intergenic
907456908 1:54581877-54581899 CACCTTGGGACTAGGAGGCCTGG + Intronic
907898920 1:58719718-58719740 CACCTAGCTTCAGGGAGGCTTGG + Intergenic
908334915 1:63112081-63112103 GACCTGGGCTCTGGTAGGTCTGG - Intergenic
911734882 1:101326068-101326090 CACCTGCGCACTGGGAGGACGGG - Intergenic
912230369 1:107785789-107785811 AACCTGGTGTCTGGGATGCCTGG - Intronic
913103059 1:115587338-115587360 CACCTGAGCACTGGGAGGACAGG + Intergenic
913960285 1:143333917-143333939 CGCCTGTGTGCTGGGAAGCCTGG + Intergenic
914054641 1:144159490-144159512 CGCCTGTGTGCTGGGAAGCCTGG + Intergenic
914124505 1:144806871-144806893 CGCCTGTGTGCTGGGAAGCCTGG - Intergenic
914474175 1:148009747-148009769 CACCTGGATCTTGGGAGGGCAGG - Intergenic
914756254 1:150563030-150563052 CACCTGCTTACAGGGAGGCCTGG - Intergenic
914831547 1:151174350-151174372 CACTTGGGTTCTACGAGGCATGG + Intronic
915625318 1:157110879-157110901 CACTTGGGCTGAGGGAGGCCAGG + Intergenic
917098295 1:171421857-171421879 CACCTGCGCACTGGGAGGACTGG - Intergenic
917122161 1:171654390-171654412 ATCCTGGGTTCTAGGAGGCAGGG - Intergenic
917132336 1:171755548-171755570 CACCATTGTTCTGAGAGGCCTGG + Intergenic
917535694 1:175872891-175872913 ACCCTGCCTTCTGGGAGGCCAGG - Intergenic
917625965 1:176846559-176846581 CACCTGGCTACTGGAAGGGCTGG + Intergenic
918453489 1:184683878-184683900 CACCTGGGCCCTGGGAGGCTGGG - Intergenic
918601276 1:186365437-186365459 CTCCTGGGTTCTGGGTGGCCAGG - Intronic
920401524 1:205679600-205679622 CACCTGAGACCTGGGAGGCGAGG + Intronic
920850605 1:209625745-209625767 CATCTAGGATCCGGGAGGCCAGG + Exonic
921193529 1:212730592-212730614 CCCCTGACTTCTGGGTGGCCTGG - Intronic
922322890 1:224503514-224503536 CACCTCGGCTCTGGGAGGCCCGG - Intronic
922707715 1:227798222-227798244 GACCTGGGTCCTGGGAGCTCTGG + Intergenic
922731429 1:227950441-227950463 CACCTGAGGTCTGGCAGGGCTGG + Intergenic
924470208 1:244336666-244336688 CACCTCAGCCCTGGGAGGCCTGG + Intergenic
1063003506 10:1946476-1946498 CACCTGGGCCCTGGCAGGCCAGG - Intergenic
1063145301 10:3290468-3290490 GACCTGAGTCCTGGGAGGCCAGG + Intergenic
1064248852 10:13691465-13691487 CACCTGGGTTCTATGAGCCTGGG + Intronic
1066491749 10:35901045-35901067 GAGCTGGGTACTGGCAGGCCAGG - Intergenic
1066503193 10:36014756-36014778 CACCTGGGTTCTGGGAGCTGAGG + Intergenic
1066686181 10:37983697-37983719 CACCTGTGTTGTGGGAAGTCAGG - Intergenic
1067562339 10:47312661-47312683 CAGCAGGGCTCTGGGATGCCAGG - Exonic
1068022697 10:51604795-51604817 CACTTGGGCTTTGGGAGTCCTGG - Intronic
1070325059 10:75383435-75383457 CTCCAGGGTCCTGGGAGACCAGG + Intergenic
1072491254 10:95907872-95907894 CCTCTGGGTCCTGGCAGGCCAGG + Intronic
1072708252 10:97697813-97697835 CACCTGGGAGCCTGGAGGCCTGG + Intergenic
1072738646 10:97896480-97896502 GAGCTGGGTTCTGGGACCCCTGG + Intronic
1073127800 10:101162792-101162814 AACCTGGGTTCAGGCAGGGCTGG + Intergenic
1073833626 10:107415515-107415537 CACCTGTGTACTGGGAGGACAGG - Intergenic
1075343993 10:121668909-121668931 CAGCTGGGTGCTGGAAAGCCGGG + Intergenic
1075496287 10:122922319-122922341 AACCTGGGTTCTGGCAAGCCTGG + Intergenic
1075685885 10:124364841-124364863 CAGCTGGCACCTGGGAGGCCTGG - Intergenic
1075972123 10:126663816-126663838 CCCCTGGGTTCTGGGAGGGGTGG - Intronic
1076355619 10:129850791-129850813 CTCCTGGGTTCTGCAAAGCCTGG + Intronic
1076513019 10:131025615-131025637 CATCTGGGCTCTGGGATACCTGG - Intergenic
1076528189 10:131126002-131126024 CAGCTGGGGTCTGGGCTGCCTGG + Intronic
1076834661 10:133014970-133014992 TCCCTGGCTTCTGGGAGGCCCGG + Intergenic
1077215378 11:1393314-1393336 CTCCTGAAATCTGGGAGGCCTGG + Intronic
1077291459 11:1796910-1796932 CACCAGGTTTCAGGGAGGCAGGG + Intergenic
1077341700 11:2029127-2029149 AACCTGGGGTCTTGCAGGCCAGG - Intergenic
1077490925 11:2860664-2860686 CACAAGGGTTCTGGGAGGTGTGG - Intergenic
1077556896 11:3230293-3230315 CTCCTGTGTCCTGGGAGGGCTGG + Intronic
1078760292 11:14246026-14246048 CACATAGGTTCTGGGAGCCAAGG - Intronic
1081949735 11:47033915-47033937 CTCATGGGTTCTGGGTGGCCAGG + Intronic
1083331838 11:61902378-61902400 CACCTGGGTGCTGGGACACTGGG - Intronic
1083857494 11:65400371-65400393 CATCTGTGTCCTGGGAGGCAGGG + Intronic
1083938703 11:65883605-65883627 CAGGTGGGTTCAGGGAGGGCAGG - Exonic
1084113760 11:67030038-67030060 CACGTGGGTGCCAGGAGGCCAGG + Intronic
1084724546 11:70932662-70932684 CACATGGGGTCTCTGAGGCCTGG - Intronic
1088814896 11:113414176-113414198 CACCTCGGTTCTGCAAGGCATGG - Intronic
1089555909 11:119315952-119315974 TGCCTGGGCTCTGGGATGCCTGG + Intronic
1089561329 11:119344769-119344791 CACCAGGAGTCAGGGAGGCCCGG + Intronic
1089561599 11:119345963-119345985 GAGCTGGGTCCTGGGAGGCTGGG + Intronic
1090038386 11:123268587-123268609 CATCTGGTTTCTGGGAGAGCAGG + Intergenic
1090270122 11:125380142-125380164 CGCCTGGGTGCCGGGAGGGCGGG - Intronic
1090357640 11:126150577-126150599 CACCTGGGTGCTGGGGGACGTGG - Intergenic
1091066079 11:132514520-132514542 CTGCTGGGTTCTGGAGGGCCTGG + Intronic
1091239249 11:134041636-134041658 CACCTGGGTCGTGTGAGGCAGGG - Intergenic
1202824686 11_KI270721v1_random:84316-84338 AACCTGGGGTCTTGCAGGCCAGG - Intergenic
1092372702 12:7930365-7930387 CACTTGGATTCTGAGAGGCAGGG + Intronic
1093561254 12:20543483-20543505 CCCCTTGGTTATGAGAGGCCTGG - Intronic
1093967518 12:25342781-25342803 TACCTGGGTTCTCGGAGGTGAGG + Intergenic
1094232310 12:28120536-28120558 CACCTGGCTTCTTGAAGACCAGG + Intergenic
1096683529 12:53272807-53272829 CACCTGGGTTTGGTGAAGCCAGG + Exonic
1097707170 12:62880434-62880456 CTGCTGGGTTCTGGCAGGCAGGG - Intronic
1098578949 12:72076074-72076096 TAGCTGGTATCTGGGAGGCCTGG + Intronic
1098643857 12:72873138-72873160 CACCTGCGCACTGGGAGGACAGG + Intergenic
1098746098 12:74238921-74238943 CTTCTGGGGTCTGGGTGGCCAGG - Intergenic
1099445234 12:82744020-82744042 TCCCTGTGCTCTGGGAGGCCAGG + Intronic
1100270454 12:93019718-93019740 CTCCTGGGCTGTGGGAAGCCTGG - Intergenic
1100892016 12:99136195-99136217 TACCTGGGTCCTGAGAGGCAGGG - Intronic
1101177402 12:102168636-102168658 GACCTGGTTTCTGGGAGCCAGGG + Intronic
1102393337 12:112567372-112567394 TCCCAGGGTTCTGGGAGGCCAGG + Intergenic
1102626463 12:114239332-114239354 CATCTGTGTCCTGGGAGGCTGGG + Intergenic
1103240484 12:119409194-119409216 AACCTGGGTGCTGGGTGCCCCGG + Intronic
1103967029 12:124646476-124646498 CACCCCGATTCTGGGAGGCGGGG - Intergenic
1104161650 12:126186859-126186881 CACCTGGGTTCTGTAAGGTCTGG - Intergenic
1105518525 13:21111646-21111668 AACCTGGGACCTGGGAGGCCAGG + Intergenic
1106027481 13:25968695-25968717 CACCTGTGTTCTGTGCGGACTGG - Intronic
1106081755 13:26506296-26506318 CATCAGGGCTCTGGGAAGCCAGG - Intergenic
1106102662 13:26708097-26708119 CACCTGGGGACTGGGCAGCCAGG - Intergenic
1112294647 13:98176435-98176457 CGACTGGGTTTTGGAAGGCCTGG + Exonic
1112400375 13:99072389-99072411 CTCATGTGTTCTGGGTGGCCAGG + Intronic
1112496859 13:99911964-99911986 CAGCTGCGTTCTTGGAGACCAGG + Intergenic
1112542201 13:100325869-100325891 CACATGTGTTCTGGGTGGCTGGG - Intronic
1113811274 13:113144044-113144066 CACCAGGATCGTGGGAGGCCAGG + Exonic
1114648028 14:24266515-24266537 CACCTGGGGGCAGGGAGGGCAGG + Exonic
1116904375 14:50390916-50390938 CACCTGAGTTCTGGGAGTCAAGG - Intronic
1117702716 14:58430544-58430566 CTACTGTGTTCTGGGAGGGCAGG - Intronic
1118310202 14:64686247-64686269 CACCTGAGGCCTGGGAGGCCTGG - Intergenic
1119229073 14:72966134-72966156 CACCTCGGTTCTGGCTGCCCTGG - Intergenic
1119806251 14:77484404-77484426 CTCCTGGGTCCTGGGAGGCGTGG + Exonic
1121774533 14:96582098-96582120 CACCAGGGCTCTGAGAAGCCAGG - Intergenic
1121873386 14:97429762-97429784 CACCTGGTTTCTAAGAGTCCAGG - Intergenic
1122124324 14:99570942-99570964 CTCGTGGGATCTGGGAGGCAGGG - Intronic
1122154354 14:99741584-99741606 TGTCTGGGTTCTGGGATGCCAGG - Intronic
1122164003 14:99807570-99807592 GACCTGGGTTCAGAGAGGGCTGG + Intronic
1122266914 14:100550911-100550933 CACCTGTGTCCTGTGAGGCAGGG - Intronic
1122623685 14:103073698-103073720 GACCTGACTGCTGGGAGGCCGGG + Intergenic
1122984530 14:105206127-105206149 CACCTGCGCTCAGGAAGGCCTGG + Intergenic
1123777663 15:23596856-23596878 CACCTGAGCACTGGGAGGGCGGG - Intronic
1124337348 15:28867336-28867358 CACCTGGTTGCTGTCAGGCCTGG + Intergenic
1124394546 15:29290065-29290087 TACCTGTGCCCTGGGAGGCCAGG - Intronic
1125495603 15:40190358-40190380 CACTTTGGCTCTGGGAGGCTGGG + Intronic
1126087505 15:45023464-45023486 CAGCTGGGATCTGGGCAGCCAGG - Intronic
1126560311 15:50035966-50035988 GATCTGGGCTCTGGGAGTCCAGG - Intronic
1127875362 15:63107051-63107073 CCACTGTGTGCTGGGAGGCCGGG + Intergenic
1127974219 15:63985322-63985344 CACTCTGGCTCTGGGAGGCCTGG - Intronic
1128345434 15:66849969-66849991 AACCTGGGTGCTGGGAGATCTGG + Intergenic
1129801861 15:78421030-78421052 AACCTGGGTGCTGAGAGGGCAGG - Intergenic
1130516390 15:84629125-84629147 TGCCTGAGTTCAGGGAGGCCAGG + Intergenic
1131273194 15:90959349-90959371 CTCCAGTGTTGTGGGAGGCCAGG + Intronic
1131278519 15:91002377-91002399 CACTTTGGGTTTGGGAGGCCAGG + Intronic
1132105008 15:99057092-99057114 GACCTGGGCTCTGGGATGTCAGG + Intergenic
1132545318 16:530385-530407 TACCTGGGTTCTGGCAGCCCAGG + Intronic
1132593888 16:739486-739508 CACCTGCCATCTGGGAGGCTGGG - Intronic
1132669013 16:1095144-1095166 CACCTGGAGTCGGGGAGTCCTGG + Intronic
1132673545 16:1112384-1112406 CAGCTCGGGTCAGGGAGGCCGGG + Intergenic
1132728145 16:1347657-1347679 CAGCTGGGCTCTGGGAGCCTCGG - Intronic
1132858063 16:2056280-2056302 ACCCTGGTTTCTGGGAGGCTGGG + Intronic
1133130198 16:3671971-3671993 GACCTGGGCTGTGGGTGGCCGGG + Intronic
1133412527 16:5580259-5580281 CTTCTGGGTTCTGGGAGCGCCGG + Intergenic
1134096612 16:11422978-11423000 CCCCTGGGAACTGGGAGTCCAGG + Intronic
1134242149 16:12513972-12513994 GGCCTGGGTGCTGGGAGCCCAGG + Intronic
1135114661 16:19714511-19714533 ACCCTTGGTTCTGTGAGGCCAGG - Exonic
1136003940 16:27315529-27315551 TCCCTGGGTGCTGGGAAGCCTGG - Intronic
1136547827 16:30965488-30965510 CACCTGGGCTCTGGGAGTCAGGG + Intronic
1138482647 16:57314033-57314055 CACCAGGGTTCTTGGTGTCCTGG - Intergenic
1139273473 16:65705070-65705092 CACCAGGGCTCAGGGAGGCAGGG + Intergenic
1140942715 16:79736892-79736914 CATCTGGCTGCTGGGAGGCCTGG - Intergenic
1143276286 17:5713504-5713526 CAACTGGTTTGTGGTAGGCCTGG - Intergenic
1143542462 17:7577767-7577789 CACCTGGGTTCCAGGAACCCTGG - Intronic
1143856635 17:9856030-9856052 CACCTGGGCTCTGCTAGCCCTGG + Intronic
1144132424 17:12259779-12259801 CTCCTGGGCTCTGGGAAGGCAGG + Intergenic
1144656985 17:17042996-17043018 CACCTCCGTTCTGGGAGCCGCGG + Intronic
1144731458 17:17528677-17528699 CTCATAGGTTCTGGGGGGCCAGG - Intronic
1144766161 17:17733890-17733912 CTCCTGGGGGCTGGGAGACCCGG + Intronic
1145111752 17:20169752-20169774 CACCAGCATTTTGGGAGGCCAGG - Intronic
1147265933 17:39234689-39234711 CACCTGCACTTTGGGAGGCCAGG + Intergenic
1147565954 17:41536575-41536597 CTCCTGGGTGCTGGGAATCCGGG - Intergenic
1147600317 17:41741117-41741139 CACATTGGATCTGGGAGGCAGGG - Intergenic
1148345099 17:46897924-46897946 CACCTGGGTCCTGGGTGTGCAGG - Intergenic
1148887010 17:50781234-50781256 CTCCTGGCTTCTGGGTGTCCAGG + Intergenic
1149995962 17:61405991-61406013 CACCTGGGTTCTGAGAGACGAGG + Intronic
1150212204 17:63447302-63447324 CACCGAGGTTCTGGGAGGCCGGG + Intergenic
1151495050 17:74453987-74454009 CACCTGGGTTGGGGGAGGTGGGG + Intergenic
1151673450 17:75585856-75585878 CCCCTGGGCACTGGGAGCCCAGG + Intergenic
1151928032 17:77213096-77213118 CTCCCGGGTGCTGGGAAGCCCGG - Intronic
1152135141 17:78499330-78499352 ATCCTGGGGTCTGGGAGGCAAGG - Intronic
1152810353 17:82378844-82378866 CACCTGGGTTTGGAGAGGGCGGG + Intergenic
1152810569 17:82379971-82379993 CATGTGTGTTCTGGGAGGCAGGG - Intergenic
1154411206 18:14143184-14143206 CACCTGGGATCTGGGTACCCTGG - Intergenic
1155920156 18:31595648-31595670 CATCTGGCTTCTCGGAGGTCTGG + Intronic
1157200962 18:45659182-45659204 CACCTGGCTGCTTGGAGGTCAGG - Intronic
1157272048 18:46283609-46283631 CAGCTGGGTTCTGGTAGACAGGG - Intergenic
1157297518 18:46456910-46456932 CACCTGGGTTCTCCGCAGCCTGG - Exonic
1157433178 18:47646962-47646984 AACCTGGGGTCAAGGAGGCCAGG - Intergenic
1157592430 18:48843610-48843632 CCCAGGGGATCTGGGAGGCCTGG + Intronic
1159749783 18:72285959-72285981 CACCTGGATTCTGTAAGGGCTGG - Intergenic
1160014571 18:75130681-75130703 CACCTGGGTTCCCCGAGTCCCGG - Intergenic
1160348812 18:78156396-78156418 CACCTGGTTTCTGGAAAGCTTGG + Intergenic
1161062043 19:2220044-2220066 CAGCTGGGTTCTGGGTCTCCTGG + Intronic
1161065255 19:2234350-2234372 CTCATGGGTTCTGGGGGGTCAGG - Intronic
1161217764 19:3103000-3103022 CACCAGGCTGCGGGGAGGCCAGG - Intronic
1161385430 19:3989512-3989534 CAAATGGGTTCAGGGAGGCCTGG + Intergenic
1161521012 19:4723555-4723577 CTCCGGGGTGCGGGGAGGCCAGG + Intronic
1161775853 19:6261697-6261719 CATCTGGGTGGTGGGAGTCCAGG - Intronic
1161810307 19:6467642-6467664 CAGCAGGGCTTTGGGAGGCCGGG + Exonic
1162515179 19:11143106-11143128 GACAAGGGTTCTGGGAGCCCAGG - Intronic
1162828613 19:13270031-13270053 AGCCTGGGTTCTTTGAGGCCTGG - Intronic
1165445914 19:35856713-35856735 CACCTGGGTTCGAGGAGGGAGGG - Intronic
1165732835 19:38157528-38157550 AACCTGGGTGCTCTGAGGCCTGG - Intronic
1166233242 19:41438160-41438182 GACCTGGGCTCTGGTGGGCCAGG + Intronic
1166741644 19:45118185-45118207 CGGCTGGGTGCCGGGAGGCCTGG - Intronic
1166987076 19:46667243-46667265 GACTTGGGTTCAGGGAGGCATGG + Intergenic
1167112687 19:47471539-47471561 CGCCTGGGTACTGGGGGGCGAGG - Intronic
1167236594 19:48319395-48319417 CACTTGGGGTCTGGGATCCCAGG - Intronic
1167249862 19:48394020-48394042 CATCTGGGTTTGGGGGGGCCGGG - Intergenic
1167498715 19:49833862-49833884 CAGCTGGGTTCTGAGAGGGCAGG + Intronic
1167577309 19:50323959-50323981 CCCCGGGGATCGGGGAGGCCTGG + Exonic
1167742812 19:51334416-51334438 TTCCTGGGTTCTGGGAGGGGAGG - Intronic
1168046979 19:53801148-53801170 CACCTGGGACCACGGAGGCCAGG - Intronic
1168057393 19:53870768-53870790 CACCTGGTTTCTAAGAGGACGGG + Intronic
1202694122 1_KI270712v1_random:112168-112190 CGCCTGTGTGCTGGGAAGCCTGG + Intergenic
925139483 2:1540081-1540103 CCCCTGGTCTCTGGGAGGCGTGG - Intronic
926198332 2:10776751-10776773 CCCCGGGGGTCTGGCAGGCCTGG - Intronic
927862477 2:26568767-26568789 CACCTGCACTTTGGGAGGCCGGG + Intronic
928114446 2:28537119-28537141 AGGCTGGCTTCTGGGAGGCCGGG - Intronic
928134502 2:28678114-28678136 CAACTGGGTTCTGGGGGGAGAGG + Intergenic
928388442 2:30889415-30889437 CACCTGGGTTGTTGGTGGGCTGG - Intergenic
928883413 2:36122545-36122567 CTCCTGGCTCCAGGGAGGCCAGG - Intergenic
929133785 2:38603192-38603214 CGCCGCGGTCCTGGGAGGCCCGG + Intronic
929215573 2:39408271-39408293 CTCCTGGGATCTGGGTGGCCAGG - Intronic
929773429 2:44912496-44912518 TACCTGGGCTCAGAGAGGCCAGG - Intergenic
929788067 2:45006160-45006182 CAAATGGGTTCTAGGAGCCCAGG + Exonic
931708362 2:64966689-64966711 CCCCAGGACTCTGGGAGGCCAGG + Intergenic
933589410 2:84215309-84215331 CACCTTGGTTCTGGGATTACAGG - Intergenic
933695408 2:85213767-85213789 CTCCTGGGTGCTGGGAGGAGGGG - Intronic
933727898 2:85436825-85436847 CACCTGCATTCCTGGAGGCCAGG - Exonic
934236678 2:90238744-90238766 CGCCTGTGTGCTGGGAAGCCTGG - Intergenic
934921335 2:98347251-98347273 CACCCGGGATCTCGGACGCCCGG + Intronic
935594515 2:104868536-104868558 GACCTGGGCTCTGGGAGGCTTGG - Intergenic
936097522 2:109542645-109542667 CACCCAGGTTCTGGTAGGCAGGG - Intergenic
937910648 2:127073977-127073999 CACCTGGGTCCTTGGAGAGCAGG + Intronic
937957355 2:127428796-127428818 CACCTGGTTCCTGGTGGGCCTGG + Exonic
937986490 2:127640430-127640452 CAGCTGGGCCCTGGGAGGCAGGG - Intronic
938378531 2:130823926-130823948 CACCTGGGATCTGGGACCACAGG - Intergenic
938402430 2:131004693-131004715 GACCTGAGTTCTGTGAGGCCGGG - Intronic
940047509 2:149424973-149424995 CACCTTGGATCAGGGAGTCCAGG + Intronic
941905113 2:170712577-170712599 CAGCTGGGGCCTGGGAGGACCGG + Exonic
944024122 2:195143267-195143289 AACCTGGGTGCTGAGAGGCAGGG - Intergenic
945468634 2:210201086-210201108 CACCTGTGCACTGGGAGGACGGG + Intronic
946327559 2:218992636-218992658 AAGCTGGGCTCTGGGAGACCAGG + Intronic
947541763 2:230984808-230984830 CAGCTGGGATCTGGGATGACCGG - Intergenic
947623095 2:231603509-231603531 CACCTAGGTTCTGGGACCCGGGG + Intergenic
947890053 2:233609552-233609574 CTCGTGGGTTCTGGGCGGCTAGG + Intergenic
947895785 2:233670769-233670791 CTCATGGGTTCTGGGTGGCTAGG + Intronic
948147222 2:235716757-235716779 CACTTGGAGGCTGGGAGGCCAGG + Intronic
948730123 2:239957767-239957789 CACCTGAATTCCAGGAGGCCGGG - Exonic
948954012 2:241272933-241272955 CTCCCGGGTGCTGGGCGGCCCGG - Intronic
1169215926 20:3794846-3794868 CACCTTGGGTCTGGGTGGCTGGG + Intronic
1169673837 20:8132622-8132644 CATCTGGGCTCCGGGCGGCCCGG - Exonic
1170605114 20:17869923-17869945 TACCTGGTTTCTGGAAGGCAGGG - Intergenic
1170826484 20:19800556-19800578 CACCATGTTTCTGGGAAGCCAGG + Intergenic
1170948070 20:20909859-20909881 CACCTGCGTACTGGGAGGAGGGG - Intergenic
1172437838 20:34942495-34942517 CAGCTGGGGTCCGGGAGGCCAGG + Exonic
1172899606 20:38324865-38324887 CCCGGGGGTTCTGGGAGGACAGG + Intronic
1175502507 20:59460469-59460491 CATCAGGGTTCAGGCAGGCCGGG + Intergenic
1175576201 20:60062636-60062658 CAGCTGGTTCCTGAGAGGCCAGG - Intronic
1176080544 20:63270632-63270654 CACCCGGACTCTGGGAGGTCTGG - Intronic
1176114156 20:63423863-63423885 CCCCAGGGTTCTCGGAGGCAGGG - Intronic
1176184106 20:63768783-63768805 CACCAGGGCTCTGTGAGGCTCGG + Intronic
1176194034 20:63828851-63828873 CTCCAGGGCTCTGAGAGGCCGGG + Intronic
1176195061 20:63832902-63832924 CAACTGGGCTCTGGGTGGGCAGG - Intergenic
1176237878 20:64062755-64062777 AAACTGGGCTCTGGGAGGCTGGG + Intronic
1176270161 20:64232144-64232166 CACCTGGGTACAGAGAGGCCGGG - Exonic
1176296619 21:5076584-5076606 CACCTGGGGTCTGGCAGGGAGGG + Intergenic
1178892028 21:36528302-36528324 CACCGCAGTTCTGAGAGGCCAGG + Intronic
1179138193 21:38699095-38699117 GCCCTGGATTTTGGGAGGCCTGG + Intergenic
1179789871 21:43750047-43750069 CGCCTGGACTCTTGGAGGCCTGG + Intronic
1179860430 21:44185537-44185559 CACCTGGGGTCTGGCAGGGAGGG - Intergenic
1180032906 21:45224472-45224494 CAACTGGGTTCTGGGAGCCCTGG + Exonic
1180032922 21:45224514-45224536 GAACTGGGTTCGGGGAGCCCTGG + Exonic
1180032976 21:45224653-45224675 GAACTGGGTTCCGGGAGCCCTGG + Exonic
1180917447 22:19499041-19499063 CACCTGGGCTCAATGAGGCCTGG - Intronic
1181040219 22:20188513-20188535 CACCTGCTCTCTGTGAGGCCTGG - Intergenic
1181747090 22:24962998-24963020 CAGCAGGCTTCTGGGAGCCCAGG + Intronic
1181942303 22:26487793-26487815 CTCTTGGGTTTTGGGAGTCCAGG + Intronic
1182092727 22:27606961-27606983 GAGCTGGCTTCTGGGAGGACAGG + Intergenic
1182120996 22:27786662-27786684 CTCCAAGGTTCTGGGAGGCTGGG + Intronic
1183191505 22:36324538-36324560 CACCTTGCTGCGGGGAGGCCAGG - Intronic
1184461676 22:44641281-44641303 GAGCTGGGTTCCTGGAGGCCAGG - Intergenic
1184860242 22:47169395-47169417 GACCTGGGATCTGGGAGGTGGGG - Intronic
1185275190 22:49947696-49947718 CAGCTGGGCTCTGGGTGGGCGGG - Intergenic
949843975 3:8351959-8351981 CACCTGAATTCTGAGATGCCTGG - Intergenic
949941611 3:9159134-9159156 CACCTTGGTTCTAGGTGGGCAGG - Intronic
950424027 3:12915003-12915025 CACTTGGGCTCTGGGAGCCTGGG + Intronic
950542360 3:13620129-13620151 CACCTGAGTCCCTGGAGGCCTGG + Intronic
950572710 3:13811868-13811890 GACCAGGGCTCAGGGAGGCCCGG - Intergenic
952385973 3:32841911-32841933 CACATGCATTTTGGGAGGCCGGG - Intronic
952399556 3:32950900-32950922 CAACTGGGATCTGAGAGGCCAGG - Intergenic
953928644 3:46995196-46995218 CACCTGTGTGCAGGCAGGCCTGG + Exonic
954810199 3:53242752-53242774 CCCCTGGGTGCTGAGAGGGCAGG - Intronic
956454753 3:69409586-69409608 CACCTGGGTTGTGTGAGGGAGGG - Intronic
958047938 3:88307826-88307848 CACCTGCGCACTGGGAGGACGGG + Intergenic
959660608 3:108863951-108863973 CACCTGCGCACTGGGAGGACAGG - Intergenic
963226016 3:142862250-142862272 CACCTGGTTTCTTGGAAGGCAGG - Intronic
963702861 3:148647945-148647967 AACCTGGGACCTGGGAGGCGGGG - Intergenic
964549749 3:157873394-157873416 TGCCTGGGCTCTAGGAGGCCTGG - Intergenic
964810059 3:160653992-160654014 CATCTAAGTTCTGGGAGGCATGG + Intergenic
965684144 3:171283697-171283719 CACTAGGGTTCTGGAAGCCCTGG + Intronic
968188343 3:196649278-196649300 CACCTGGGATCTGGGAGAATGGG - Intronic
968227001 3:196979095-196979117 TGCCCGGGATCTGGGAGGCCAGG + Intergenic
968521104 4:1035203-1035225 GACCTGGGGTCAGGGAGGCCTGG + Intergenic
968600191 4:1505086-1505108 CACGTGGGTACTGGGAGTACTGG + Intergenic
968673426 4:1864330-1864352 CACCTGGGGCCTGGGAGGCGGGG + Intergenic
969429966 4:7148351-7148373 CTCCTGGGTACTGGCACGCCAGG - Intergenic
969571021 4:8008446-8008468 CACTGAGGCTCTGGGAGGCCAGG + Intronic
969636183 4:8370570-8370592 GACCTGGGACCGGGGAGGCCGGG + Intronic
969868545 4:10091052-10091074 CACCTGGGTGCTGCAAGGCTTGG + Intronic
969938277 4:10704962-10704984 CATCTGAGTGCTGAGAGGCCAGG + Intergenic
970301047 4:14681527-14681549 CACCTGTGTTCTGTGCGTCCTGG - Intergenic
974397338 4:61354701-61354723 CCTCTGGGTTCAGAGAGGCCAGG + Intronic
975060057 4:69986002-69986024 CACCTGGGCTTTGGGAGTCATGG - Intergenic
975117570 4:70696340-70696362 CTCCTGGCTTCAGGGAGTCCAGG - Intergenic
975213836 4:71731250-71731272 AACCTGGGTGCTGAGAGGGCAGG + Intergenic
982350431 4:154409222-154409244 CACTTGGGCCCTGGGAGGCAGGG - Intronic
982593563 4:157348488-157348510 TACCTGCATTCTGGGAGGCCGGG - Intronic
984245337 4:177268604-177268626 AACCTGGGTGCTGAGAGGGCAGG + Intergenic
984833866 4:184000741-184000763 CACCTGGGTGCTGAGAGTCGAGG - Intronic
985521909 5:377730-377752 CTCCTGGGGCCTGGGAAGCCTGG + Intronic
985673157 5:1216740-1216762 CACCTGGGGCCAGGGAGGCTGGG - Intronic
986125360 5:4878982-4879004 TGACTGGGTCCTGGGAGGCCTGG - Intergenic
992667042 5:79020517-79020539 CACCTGGGGTGTGGAAGGCTTGG + Intronic
996749580 5:126875237-126875259 CACCTGGGCCCCAGGAGGCCAGG - Intronic
997208747 5:132065606-132065628 CACCTGGGATGTGGGAAGGCAGG - Intergenic
997262400 5:132475108-132475130 CACCAGGGCTCTGGGAGCCCAGG + Intronic
997337376 5:133117758-133117780 CACCCGGGTCCTGGGAGGAGAGG - Intergenic
998064779 5:139149065-139149087 CACCTGGCTTCTCCGAAGCCAGG - Intronic
998149522 5:139748877-139748899 CACCTGATTTCTAGGAGCCCTGG + Intergenic
998381846 5:141731256-141731278 CCCCTGGGCTGTGGGAGGCATGG + Intergenic
998411730 5:141916322-141916344 CTCTTGGGTTCTAGGAGGGCAGG - Intergenic
998641173 5:144013034-144013056 CACCTGTGTCCTGGGAGAACAGG - Intergenic
1000320453 5:160130402-160130424 CACCTGGGCCCTGGGAGGCAGGG - Intergenic
1001382295 5:171312480-171312502 CACCTGGGGGGTGGGAGGCAGGG + Intergenic
1002388879 5:178893651-178893673 CTCATGGGTTCTGGGTGACCAGG + Intergenic
1002466199 5:179410111-179410133 TCCCTGGGTTCTGGCTGGCCAGG + Intergenic
1002576319 5:180176201-180176223 CACCTGCTCTCTGGGAGGCATGG - Intronic
1002613599 5:180436863-180436885 ACCCTGGGCTCTGGAAGGCCAGG - Intergenic
1002714230 5:181216494-181216516 CACTGGGACTCTGGGAGGCCAGG - Intergenic
1002929326 6:1622580-1622602 CACATGGTTGCTGGGAGGCCGGG - Intergenic
1005427092 6:25714108-25714130 CACCAGGGGGCTGGCAGGCCTGG + Intergenic
1005856132 6:29864304-29864326 CTCCCGGGTACTTGGAGGCCAGG + Intergenic
1006342059 6:33452491-33452513 CATCTGGGTTCTGGGTGGGGAGG - Exonic
1006642464 6:35496413-35496435 GGCCTGGGCGCTGGGAGGCCGGG + Intronic
1006836893 6:37004455-37004477 GTCCTGGGATCAGGGAGGCCTGG + Intergenic
1007061260 6:38942750-38942772 CACCTGAGGTGTGGGAAGCCTGG + Intronic
1007164742 6:39821372-39821394 GAGCTGGGTGCTGGGAGCCCAGG - Intronic
1007730270 6:43941275-43941297 CTCCTGGGATCTGGATGGCCTGG + Intergenic
1010317327 6:74466517-74466539 CACCTGTGTGCTGGCAGGGCAGG + Intergenic
1010745118 6:79551963-79551985 CACCTGTATTCTTGGATGCCTGG + Intergenic
1010811150 6:80300133-80300155 CACCTGGGCTCTGGAAGTCAAGG - Intronic
1011351388 6:86427555-86427577 CACCTGAGTTCAGGGAGTCGAGG - Intergenic
1013598960 6:111686222-111686244 CACCTCGTTTCTGGGAGGGACGG - Intronic
1014061442 6:117076691-117076713 CTCATGGGTTCTGAGTGGCCAGG - Intergenic
1015477700 6:133671844-133671866 CACATGGGTTCTGGCAAACCTGG + Intergenic
1018095575 6:160384653-160384675 CCCCAGGGGTCTGGGAGGCTGGG + Intronic
1018375009 6:163202098-163202120 CAGCAGGGTTCTGGGAAGCAGGG + Intronic
1018433927 6:163744471-163744493 CACGTGGGTTTTGGGAGGTCCGG + Intergenic
1018500560 6:164406247-164406269 CACATGAGTACTGGGAGGACAGG + Intergenic
1018652306 6:166002592-166002614 GTCCTGGGTCCTGGGAGCCCGGG - Intergenic
1018662501 6:166101362-166101384 GACCTGAGATTTGGGAGGCCAGG - Intergenic
1018943012 6:168322196-168322218 CACCTGTAATTTGGGAGGCCAGG - Intergenic
1019025474 6:168958939-168958961 CACTGGGGCTCTGGGAGCCCTGG + Intergenic
1019289197 7:242069-242091 CCCCTGCGCTCTGGCAGGCCTGG + Intronic
1019457479 7:1138072-1138094 CACGTGGGTGCGCGGAGGCCCGG - Exonic
1019492633 7:1322394-1322416 CAGCTGGATTCTGGGGGGACTGG - Intergenic
1019624886 7:2011080-2011102 CACCTGGGCTCTGTGGGGTCAGG + Intronic
1019774386 7:2903863-2903885 CGAGTGGGGTCTGGGAGGCCGGG - Intergenic
1020080670 7:5284130-5284152 AATCTTGGTTCTGGGAGGCCGGG + Intronic
1022183985 7:27949167-27949189 CATCTGGATTTTGGGAGGCCAGG + Intronic
1024231478 7:47367112-47367134 GAGCTGTGTTCTGGGAGCCCTGG - Intronic
1024440418 7:49409789-49409811 CACCAGGGTTCAGGGATTCCAGG + Intergenic
1025198256 7:56948044-56948066 AATCTCAGTTCTGGGAGGCCGGG - Intergenic
1025673693 7:63628889-63628911 AATCTCAGTTCTGGGAGGCCGGG + Intergenic
1026538252 7:71258192-71258214 CCCCTTGGCCCTGGGAGGCCTGG - Intronic
1026941531 7:74290193-74290215 AACCTGGGGTCTGGGAGAACAGG + Intronic
1028164854 7:87526626-87526648 CTCATGGGTTCTGGGTGGCCAGG + Intronic
1029334104 7:99885857-99885879 CACCTGGGGGTTGGGAGGGCAGG + Intronic
1029435741 7:100563086-100563108 GACCTGGGTGCTAGGTGGCCTGG - Intronic
1029482634 7:100822532-100822554 CACCCTGGTCCTGGAAGGCCAGG + Exonic
1029832699 7:103278242-103278264 CACCTGGGAGCTGGGAGACACGG + Intergenic
1031405704 7:121384082-121384104 CAGCAGGGTTCTGGGGGGCGGGG + Intronic
1031701227 7:124929571-124929593 CACCTGAGCTCTGTGAGGGCGGG + Intronic
1032855193 7:135828201-135828223 CACCAGGGTTCTGGGAGCCAGGG + Intergenic
1033044330 7:137947616-137947638 AACCTGTGATCTGGGAGCCCAGG - Intronic
1033423071 7:141219683-141219705 CACCAGAGCTCTGGGAGGACAGG - Intronic
1034432154 7:151046431-151046453 CAGCTGGCTTCTGAGGGGCCTGG + Intronic
1034534732 7:151719723-151719745 CACATAGGCTCTGGGAAGCCAGG - Intronic
1035319178 7:158017457-158017479 CACCTGTGTGCAGGGAGTCCAGG + Intronic
1036295107 8:7528885-7528907 CAGCAGGGCTCTGGGAGGGCGGG - Intergenic
1036327456 8:7792106-7792128 CAGCAGGGCTCTGGGAGGGCGGG + Intergenic
1037440710 8:18913509-18913531 GGCCTGGCTCCTGGGAGGCCTGG - Intronic
1038540353 8:28385878-28385900 GTCCGGGGGTCTGGGAGGCCGGG - Intronic
1040296448 8:46151504-46151526 CACCTGGGTTCTGGGAAGAAAGG + Intergenic
1041250477 8:55929652-55929674 CAACTGGTAGCTGGGAGGCCTGG + Intronic
1045498636 8:102728721-102728743 CACATGGGGTCTGGGAGTCTGGG + Intergenic
1047507032 8:125488155-125488177 CCCCTGGGGCCTGGGGGGCCTGG - Intergenic
1048468497 8:134686805-134686827 CACTTAGGAGCTGGGAGGCCTGG - Intronic
1048850789 8:138643382-138643404 CAGCTAGGGTCTGGGAGACCTGG + Intronic
1049251022 8:141588996-141589018 CACCAGGGTCCTGGGCAGCCGGG + Intergenic
1049383538 8:142329630-142329652 CACCTGGGCTCTGGGGTGCTCGG - Intronic
1049929134 9:439415-439437 CAGCTGGAGTATGGGAGGCCAGG - Intronic
1051370034 9:16351157-16351179 CACCTGGGTTCCAGGAGGAGCGG + Intergenic
1052795333 9:32918778-32918800 CACCTGTGCACTGGGAGGACGGG + Intergenic
1053383539 9:37668479-37668501 TAGCTGTGTGCTGGGAGGCCCGG + Exonic
1056395331 9:86176402-86176424 CACATAGCTTCTGGGAGGGCTGG + Intergenic
1057130163 9:92649250-92649272 AACCTGGGATCTGGGAGCCATGG + Intronic
1057244819 9:93446030-93446052 CACCTGGGACCTGGGAGGAATGG + Intergenic
1057313309 9:93954725-93954747 GGCCTGGTTTCTGTGAGGCCTGG + Intronic
1057342387 9:94214378-94214400 CACCTGCGAACTGGGAGGACTGG + Intergenic
1057409700 9:94807144-94807166 CACATGAGTTCTTGGGGGCCAGG + Intronic
1060553850 9:124498519-124498541 ATCCAGGGTTCTGGAAGGCCGGG + Intronic
1060727909 9:126017926-126017948 CACCTGGTTTCAGGGAGGGAAGG - Intergenic
1060878955 9:127104361-127104383 CACCTGGGTTCTGGGAGGCCTGG - Intronic
1060935186 9:127510383-127510405 CACCTGGGCTCTGGGATGGCTGG - Intronic
1061560331 9:131398167-131398189 CACCTGGGAGCTGGCAGACCTGG + Intronic
1061999765 9:134210026-134210048 CTCCAGGGCTCAGGGAGGCCAGG - Intergenic
1062116774 9:134813858-134813880 CCCCTGGGTCCTGGGTGCCCAGG + Intronic
1062236162 9:135508748-135508770 CACCTTGGATCTGGGAGAGCTGG - Intergenic
1062567479 9:137169781-137169803 CACGTGCGTGCCGGGAGGCCTGG - Exonic
1062612057 9:137379858-137379880 CAGCTGGGGTCTGGAGGGCCAGG - Intronic
1186416061 X:9383990-9384012 GATCTGGATTCTGGGTGGCCAGG - Intergenic
1186423239 X:9443449-9443471 CACCTGGGTTCCGTTAGGGCTGG - Intergenic
1186659027 X:11649260-11649282 CAGCTGGTGTCTGGGATGCCTGG - Intronic
1186760513 X:12717685-12717707 CAGCGGGGGTCTTGGAGGCCGGG - Exonic
1189771315 X:44430520-44430542 TAGCTGGCTTCTGGGAGGACAGG - Intergenic
1192206855 X:69101998-69102020 CACCTGGGTTCTAAAAGGTCTGG + Intergenic
1192435449 X:71140875-71140897 CATCTGGGACCTGGGAGCCCAGG + Intronic
1195911220 X:109890258-109890280 CACCTTGGTTCTCTGAGCCCCGG + Intergenic
1200162833 X:154018193-154018215 CACCTGAGGCCTGGCAGGCCCGG - Intronic
1200225117 X:154412863-154412885 CAGGTGGATCCTGGGAGGCCAGG + Intronic