ID: 1060878956

View in Genome Browser
Species Human (GRCh38)
Location 9:127104366-127104388
Sequence GCAGGCACCTGGGTTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878956_1060878963 10 Left 1060878956 9:127104366-127104388 CCTCCCAGAACCCAGGTGCCTGC 0: 1
1: 1
2: 1
3: 47
4: 325
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878956 Original CRISPR GCAGGCACCTGGGTTCTGGG AGG (reversed) Intronic
900003453 1:28999-29021 GCAGGGACCCGGGCTCTGCGGGG - Intergenic
900023173 1:199515-199537 GCAGGGACCCGGGCTCTGCGGGG - Intergenic
900516090 1:3082835-3082857 GCCGGCGCCTGGGTGCTGCGTGG + Intronic
900674354 1:3875326-3875348 CCAGGCACCTGGGTTATGTCTGG - Intronic
900769279 1:4528067-4528089 GAAGGCACCTGGGACCTGGCTGG - Intergenic
900803454 1:4751978-4752000 CCAGGCACCTGGCATCTGGCTGG + Intronic
901419810 1:9143308-9143330 GCGGTCACCAGGGGTCTGGGAGG - Intergenic
902623363 1:17663062-17663084 GCAGCCACCGGGGTTCTGTGTGG + Intronic
903327262 1:22576608-22576630 GCAGGCACCTATGTCCTGGAAGG - Exonic
903328604 1:22585644-22585666 GCAGGCAGCTGGGTGGGGGGAGG + Intronic
903466928 1:23558401-23558423 GCCAGCACCTGCGTTCTGGGCGG + Exonic
903567245 1:24277388-24277410 CCAGGCCCCTGGTTTTTGGGGGG - Intergenic
903682491 1:25106630-25106652 GTGGGAACCTGGGTTCTGTGAGG - Intergenic
903952685 1:27005383-27005405 GCAGATACCTGGGTTTGGGGAGG - Exonic
905445366 1:38025236-38025258 ACAGGGAGCGGGGTTCTGGGGGG + Intergenic
905471601 1:38196324-38196346 ACAGGCACCTGGGGTCTGTGAGG + Intergenic
905643685 1:39609814-39609836 GCAGGGACCCGGGTGATGGGAGG + Intergenic
906155181 1:43609789-43609811 GCAGAGACGTGGGCTCTGGGAGG - Intronic
909613580 1:77580459-77580481 GAAGGAACCTGGGTTTTGAGAGG - Intronic
910387929 1:86704968-86704990 GCAGGTACCCTGGTGCTGGGGGG + Exonic
911467701 1:98275740-98275762 TTAGGCACCTTGGTTCTGGAAGG - Intergenic
913962814 1:143353105-143353127 GCAGGCACCGGGGCTTTGGAAGG + Intergenic
914057169 1:144178690-144178712 GCAGGCACCGGGGCTTTGGAAGG + Intergenic
914121977 1:144787676-144787698 GCAGGCACCGGGGCTTTGGAAGG - Intergenic
915146858 1:153800599-153800621 GCAGGCCCCTGGGGACGGGGTGG - Intergenic
915273825 1:154774557-154774579 GCAGGCACCTCACTTCTGGGAGG + Intronic
915439833 1:155938930-155938952 GCGGGCACCTGTGATGTGGGAGG - Intergenic
915627256 1:157122544-157122566 TCTGGCACTTGGGTTCTAGGGGG + Exonic
915704910 1:157834576-157834598 GCCGGCAGCTGGGATGTGGGAGG - Exonic
916064073 1:161121961-161121983 CCAGGCACATGGGTGCAGGGAGG + Exonic
917455707 1:175183823-175183845 GCAGGCTCCTGGGTGGTAGGTGG + Intronic
918302441 1:183216460-183216482 GCAGGCACCTAGGCTGAGGGTGG - Intronic
918659792 1:187074165-187074187 GCGGGCACCTGGGCTGTGCGCGG - Intergenic
919784600 1:201251267-201251289 GCAGGCCCCTGGGTTTTGTAGGG + Intergenic
919976335 1:202615423-202615445 GCAGACACCTGGGATGTGGGGGG - Intronic
920249629 1:204614971-204614993 ACAGGCACATGGCATCTGGGAGG + Intergenic
920301044 1:204989228-204989250 GAAGGCACATGGGTTCAAGGAGG + Intronic
920371394 1:205481469-205481491 GCAGCCACCTGGGCTGTGGCAGG + Intergenic
920946520 1:210534171-210534193 GCAGGCACCTATGGTCTGTGAGG + Intronic
922322891 1:224503519-224503541 GCTGTCACCTCGGCTCTGGGAGG - Intronic
922712119 1:227842099-227842121 GGAGGCATTTGGGTCCTGGGGGG - Intronic
922764857 1:228151407-228151429 GCAGGCACTTGGGGTCTTGGTGG + Intronic
922796765 1:228343338-228343360 GCAGGCACCTCGATTCTGCAGGG - Intronic
924396181 1:243623655-243623677 CCAGGAACCTGGGTTTTGGTGGG - Intronic
1063137071 10:3227024-3227046 GGAGGCATCTGGGCTCTGGAAGG + Intergenic
1065422083 10:25556270-25556292 GCATCCACCTGTGTGCTGGGTGG - Intronic
1067059784 10:43072351-43072373 GCACGCACCTGTGTGCTGTGTGG - Intergenic
1067470993 10:46537633-46537655 CCAGGCTCTTGGGTTCTGAGAGG + Intergenic
1067471257 10:46540357-46540379 GGAGGTAACTGGCTTCTGGGTGG - Intergenic
1069625970 10:69867856-69867878 GCTGGTAACGGGGTTCTGGGTGG + Intronic
1069776475 10:70930147-70930169 GCAGGCAGATGGGGCCTGGGTGG + Intergenic
1070467819 10:76742229-76742251 GCAGGCAGCTGTGTGGTGGGGGG + Intergenic
1070702691 10:78615036-78615058 GCAGGCACTTGGGACCTGGGAGG + Intergenic
1073669683 10:105573896-105573918 TCATGCAACTGGGTTCTGGCTGG - Intergenic
1075337245 10:121617355-121617377 GCTGTCACCTCGGTGCTGGGAGG - Intergenic
1075385775 10:122054299-122054321 ACAGGCCCCTGGGTTCTTGAGGG + Intronic
1075454515 10:122576534-122576556 GTAGGCAGCTGGGTTGTGGCTGG + Exonic
1075455068 10:122579713-122579735 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075456132 10:122586195-122586217 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075456623 10:122589079-122589101 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075457183 10:122592407-122592429 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075458257 10:122598909-122598931 GCAGGCAACTGGGCTGTGGCTGG + Exonic
1075458764 10:122601932-122601954 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075459395 10:122605991-122606013 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075460027 10:122610050-122610072 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075460659 10:122614109-122614131 GCAGGCAGCTGGGCTGTGGCTGG + Intronic
1075461303 10:122618152-122618174 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075461768 10:122621192-122621214 GCAGGCAGCTGGGCTGTGGCTGG + Exonic
1075653633 10:124146936-124146958 GGAGGTGCCTGGGTTCTGAGTGG - Intergenic
1075707438 10:124510067-124510089 TCTGGATCCTGGGTTCTGGGGGG + Intronic
1075818275 10:125283354-125283376 GCAGGCTCCAGGGCTCTGAGCGG - Intergenic
1075972127 10:126663821-126663843 TCAGACCCCTGGGTTCTGGGAGG - Intronic
1076050334 10:127328510-127328532 GCAGGGACCTCTGTCCTGGGTGG + Intronic
1076605724 10:131688936-131688958 GCAGGCATGTGGGGTGTGGGTGG - Intergenic
1076995230 11:294488-294510 GCAGGCACCTGGGCTGTTGGGGG - Intronic
1077144851 11:1040273-1040295 GCATGCACCTGGGCACTGGCTGG - Intergenic
1077197407 11:1288321-1288343 GCAGGCCCCTGTGTCCTCGGAGG - Intronic
1077431613 11:2518469-2518491 GCAGGCACAGGAGTTCTGTGTGG + Intronic
1077870747 11:6259774-6259796 GCAGGCGCCTGGGCTGGGGGCGG + Exonic
1078129510 11:8601770-8601792 ACAGGCACCTGGTATCTGAGGGG - Intergenic
1081616839 11:44596272-44596294 GCAAGCACTTGGTGTCTGGGCGG + Intronic
1082028022 11:47586850-47586872 GCAGGTACCAGGCTTCAGGGTGG + Exonic
1084735572 11:71103211-71103233 GCAGGCACCGCTGTCCTGGGAGG - Intronic
1084943418 11:72626304-72626326 GCAGGGACCTGGGACCAGGGAGG - Intronic
1085297987 11:75441638-75441660 GCAGGCACCTGAGCTCCTGGCGG + Exonic
1085303669 11:75473220-75473242 GCAGGCAACTGGGGTTAGGGAGG + Intronic
1088440780 11:109867695-109867717 GCAGGCATCTGGTGTCTTGGTGG - Intergenic
1088595838 11:111439555-111439577 GGAGGGAGCTGGGTTCTGGGAGG - Intronic
1089366872 11:117926011-117926033 GCAGGTACCAGGGTCCTTGGAGG + Intronic
1089646723 11:119885268-119885290 GCAGGCAGCTGGGCTCTTGCAGG + Intergenic
1089691294 11:120188401-120188423 GCAGTGGCCTGGGCTCTGGGGGG - Intergenic
1091043086 11:132300738-132300760 GCAGGCAGATGGGTGCTGAGAGG - Intronic
1091376872 12:31053-31075 GCAGGGACCCGGGCTCTGCGGGG - Intergenic
1092062123 12:5559898-5559920 GCAGGAATCTGTGTTCTGTGGGG + Intronic
1094853051 12:34390874-34390896 GGAGGCACTTGCGCTCTGGGGGG - Intergenic
1094854249 12:34395872-34395894 AGAGGCACCTGTGTTCTGGAAGG + Intergenic
1094855556 12:34401283-34401305 CCAGGCACCTGTGTTGTGGAAGG + Intergenic
1094872154 12:34604552-34604574 GAAGGCACCTGTGTTGTGGAGGG + Intergenic
1094872698 12:34606988-34607010 GCAGGCACGTGTGTTGTGGAAGG + Intergenic
1098190745 12:67945773-67945795 GTAGGCACCTGGGCTCAGTGAGG - Intergenic
1101731209 12:107428064-107428086 GCAAGGATCTGGGTTTTGGGAGG - Intronic
1101970519 12:109309380-109309402 GCACGCCCCGGGGTTCTGGGGGG + Intergenic
1102014104 12:109636582-109636604 GAAGGCACCAGGGTGCTGGTTGG + Intergenic
1102584003 12:113910535-113910557 TGAGCCACCTGGGTTCTGGCAGG - Intronic
1103046043 12:117735347-117735369 GCAGGCGCCAGGCTTCTGGGAGG - Intronic
1103136046 12:118508831-118508853 GCAAGAACCTGGGTTCTGGCTGG + Intergenic
1103333865 12:120174400-120174422 GCAAGCAGCAGGGTCCTGGGAGG + Intronic
1103419820 12:120771395-120771417 GGAGCCAGTTGGGTTCTGGGAGG - Intronic
1103433132 12:120904465-120904487 GTCGGCTCCTGGGTTCTAGGCGG + Intergenic
1103480610 12:121247831-121247853 GCGGGCCCCTGGGCTCTGGGAGG - Intronic
1103572825 12:121856523-121856545 GGTGGGATCTGGGTTCTGGGAGG - Intronic
1104009143 12:124916822-124916844 TCAGACACCTGCGTTTTGGGAGG - Intronic
1104678279 12:130730361-130730383 CCAGGCACGTGGGTTCTAAGCGG - Intergenic
1104789458 12:131472761-131472783 GCAGCCACCTGTGGTCTGGAGGG - Intergenic
1105071581 12:133236826-133236848 GCACGCACCTGTGGTCTGGGAGG - Intergenic
1108379708 13:49844224-49844246 GGAAGCACCAGGTTTCTGGGAGG + Intergenic
1108613306 13:52105693-52105715 GCAGCCACCTGGGGGTTGGGTGG + Intronic
1110043211 13:70792569-70792591 GAAGGCACCAGGCTCCTGGGTGG + Intergenic
1111846776 13:93519656-93519678 CCAGTCTGCTGGGTTCTGGGAGG + Intronic
1112324247 13:98432840-98432862 GCAGGTACCTGGGTGCTGGAGGG + Intronic
1114907747 14:27151703-27151725 GCAGAGACCTGGGTGCAGGGGGG - Intergenic
1114929469 14:27449589-27449611 TCAGGCAGCTGGATTCTGTGAGG + Intergenic
1119157537 14:72424781-72424803 CCAGGCATCTGAGTTCTGGGGGG + Intronic
1119320659 14:73728366-73728388 CCAGGCACATGGGTGGTGGGAGG - Intronic
1119476562 14:74933756-74933778 GGAGGGAGCTGGGTCCTGGGAGG + Intergenic
1121696816 14:95920285-95920307 GGAGGCCCCTGGGTGCTGGAAGG + Intergenic
1122549867 14:102544148-102544170 GCTGGCATCTGGGGGCTGGGTGG - Intergenic
1122905047 14:104797749-104797771 GGAGGCCCCTGAGCTCTGGGAGG - Intergenic
1123031861 14:105455772-105455794 GCAAGCATCTGTGCTCTGGGAGG + Intronic
1124383837 15:29190048-29190070 GCAGGGACATGGGTCCTGGAGGG + Intronic
1124491982 15:30163773-30163795 GCAGACACCTGGGATGTGGGGGG - Intergenic
1124751555 15:32374544-32374566 GCAGACACCTGGGATGTGGGGGG + Intergenic
1127470947 15:59289554-59289576 GCAGACACCTGTGTCTTGGGTGG - Intronic
1128645542 15:69376211-69376233 GCAGGCACCTGCTTACTTGGGGG + Intronic
1130707921 15:86250744-86250766 GCACTCACCTGAGGTCTGGGAGG - Intronic
1131152694 15:90056957-90056979 GAAGGCACCGGGATTCTGGATGG - Intronic
1132450048 15:101961941-101961963 GCAGGGACCCGGGCTCTGCGGGG + Intergenic
1132523954 16:405138-405160 GCAGGCACCTGGATCCTGTCGGG - Intronic
1132602858 16:781717-781739 GCAGGCATGGGGGTCCTGGGAGG - Intronic
1132858008 16:2056046-2056068 GCAGGCACCTGAGTGCTTGTTGG + Intronic
1132869609 16:2109971-2109993 GACGGCAGCTGGGTTCGGGGAGG + Exonic
1132895754 16:2228642-2228664 GCAGGCACCTGGCTGCGGTGTGG + Intronic
1134717806 16:16365628-16365650 GACGGCAGCTGGGTTCGGGGAGG - Intergenic
1134880584 16:17742323-17742345 GCAGGCAGCTGGGGTCTCAGTGG - Intergenic
1134956944 16:18386531-18386553 GACGGCAGCTGGGTTCGGGGAGG + Intergenic
1135521543 16:23182376-23182398 GCAGGCACCTGCCATCTGGACGG + Intergenic
1136047415 16:27625418-27625440 GCAGGAGCCTAGGTCCTGGGAGG - Intronic
1137629340 16:49931214-49931236 GCAGACACGTGAGGTCTGGGTGG + Intergenic
1138147320 16:54624417-54624439 GCAGGCACCAGGGTGCAGGGAGG + Intergenic
1139450252 16:67023752-67023774 GCAGTCCCCTGGATTCTAGGAGG - Intergenic
1141566129 16:84903248-84903270 GGGGGTACCTGGGTTCTTGGGGG - Intronic
1141647432 16:85375256-85375278 AAAGGCACCTGGGGCCTGGGAGG - Intergenic
1142365321 16:89646982-89647004 GCAGGCACCTGGCTCCTTGTGGG - Intronic
1142644440 17:1302848-1302870 GCAGGCCCATGGGCTGTGGGAGG + Intergenic
1142719089 17:1764344-1764366 GCAGGCTCCTGGCAGCTGGGTGG + Intronic
1143473460 17:7190484-7190506 CCAGGAACCTGGGGTCTGGGGGG - Exonic
1143478419 17:7215893-7215915 GCAGGCAGCTGGGGGCTGGGGGG - Intronic
1143608905 17:8006491-8006513 GCAGGTCCCTGGCTTCTGCGGGG + Exonic
1144558737 17:16304371-16304393 GCAGGAAACTGGGTTCTGTCTGG + Intronic
1144670292 17:17129001-17129023 CCAGGCAGCTGGGAGCTGGGTGG + Intronic
1144813805 17:18019215-18019237 GCAGGCACCTGTGCTCTCTGTGG + Intronic
1148200424 17:45746518-45746540 GCAGGCATCGGGGTTCTGAGGGG + Intergenic
1148217000 17:45838776-45838798 GAAGGGGCTTGGGTTCTGGGAGG + Intergenic
1148443472 17:47724045-47724067 GCAGGGCCCTGGGTCTTGGGTGG + Intergenic
1149011700 17:51863695-51863717 GCATGATCCTGAGTTCTGGGAGG - Intronic
1150212202 17:63447297-63447319 CCAGGCACCGAGGTTCTGGGAGG + Intergenic
1150415922 17:64988774-64988796 GCAGGCACCTGGGCACAGAGGGG + Intergenic
1151489576 17:74424877-74424899 CCAGCCAGCTGGCTTCTGGGTGG - Intronic
1151495047 17:74453982-74454004 GCACGCACCTGGGTTGGGGGAGG + Intergenic
1152033242 17:77856579-77856601 GCAGGCGCCTGGCTCCAGGGTGG + Intergenic
1152341636 17:79729019-79729041 GCTGGCACCAGCGTTGTGGGAGG - Intergenic
1152457415 17:80424226-80424248 GCAGGCACCTGAGAGCTAGGAGG - Intronic
1153436286 18:5071427-5071449 GCAGGCACAAGGGGTCTGGATGG - Intergenic
1153894892 18:9549817-9549839 GCAGGCACGTGGGGTGTGTGTGG + Intronic
1155228594 18:23752107-23752129 GCAGGCACCTTGGGTGTAGGTGG + Intronic
1155988524 18:32255645-32255667 GCAGGCATTTGGGCTATGGGAGG + Intronic
1157552779 18:48592937-48592959 GGAGGCAGCGGGGATCTGGGAGG + Intronic
1158167421 18:54556139-54556161 GCAGGCAGCTGGGTTGGAGGTGG + Intergenic
1160003301 18:75048456-75048478 GAAGTCACCTGGGTGCTGCGTGG - Intronic
1160441368 18:78895314-78895336 GCAGGCACCTGTGTGCCTGGAGG - Intergenic
1160635206 19:70607-70629 GCAGGGACCCGGGCTCTGCGGGG - Intergenic
1161008329 19:1947678-1947700 GCAGGCTCCAGGGCTCTGGCTGG - Intronic
1161338678 19:3728722-3728744 CCAGGCAGCTGGGTTCTGGCGGG + Intronic
1161352917 19:3803751-3803773 GCAGAGAGCTGGGTTATGGGAGG + Intergenic
1161469017 19:4447201-4447223 GCAGGGACTGGGGTCCTGGGCGG - Intronic
1161724300 19:5919395-5919417 GTGGGCACCTGGGCTCAGGGAGG - Intronic
1162833045 19:13298881-13298903 GGAGCAACCCGGGTTCTGGGAGG - Exonic
1163721691 19:18900921-18900943 GCAGACACCAGGGCTCTGGCTGG - Intronic
1165415741 19:35692252-35692274 GCAGTCACCTGGGGTGTGGGGGG - Intergenic
1165858369 19:38893776-38893798 ACAGGGAGCAGGGTTCTGGGGGG - Intronic
1166365895 19:42278297-42278319 GCAGGAAGCTGGGAGCTGGGAGG - Intronic
1167102853 19:47414871-47414893 GGGGGCACCGGGGTACTGGGGGG + Intronic
1167665651 19:50821685-50821707 GTAGGGGCCTGGGGTCTGGGAGG - Intronic
1202696652 1_KI270712v1_random:131363-131385 GCAGGCACCGGGGCTTTGGAAGG + Intergenic
925218398 2:2117020-2117042 GGAGGCCACTGGGTTTTGGGTGG + Intronic
925238332 2:2298611-2298633 TCACACACCTGAGTTCTGGGAGG + Intronic
926104697 2:10142796-10142818 GCGGGCACCTGGGCTCAGGCAGG - Intronic
927213040 2:20650512-20650534 GCAGGAACCCGGTTTCTGGGAGG - Intronic
928282795 2:29963903-29963925 GCAGGCTCCAGGAGTCTGGGGGG - Intergenic
929925133 2:46201429-46201451 GCAGGCATCTGGGGTCTGCTGGG - Intergenic
932435820 2:71702104-71702126 GCCGGCATCTGGGTCCTGTGGGG + Intergenic
933415792 2:81985187-81985209 GCGGGAACCGGGGTTGTGGGAGG + Intergenic
933650696 2:84847619-84847641 GCAGGCACAAGGGTCCTGGATGG + Intronic
934277805 2:91588377-91588399 GCAGGCACCGGGGCTTTGGAAGG + Intergenic
934557709 2:95296284-95296306 TCAGGCACCTGGCTCCTGAGTGG + Intergenic
935818534 2:106870087-106870109 GCAGTCACCTGGGGGATGGGGGG + Intronic
936039735 2:109141140-109141162 GCAGAAACCTGGGCTCCGGGGGG - Intronic
936243803 2:110809406-110809428 TCAGGCACGTGGGTGCTGGGCGG + Intronic
936428129 2:112436476-112436498 GCAGACACGTGTGTCCTGGGAGG + Intergenic
936566274 2:113584436-113584458 GCAGGGACCCGGGCTCTGCGGGG + Intergenic
938365190 2:130728385-130728407 CCAGGCACCTGGCTTGTCGGGGG - Intergenic
938465297 2:131521035-131521057 TGAAGCACCTGGGCTCTGGGAGG - Intergenic
938940813 2:136168125-136168147 GCATGCACATGGGGTGTGGGGGG + Intergenic
940009250 2:149037889-149037911 CCAGGCAGCTGGGATGTGGGAGG - Intergenic
940805251 2:158180062-158180084 GTAGGCACCTGGGTTCTCAGGGG + Intronic
941731122 2:168919448-168919470 GCAGGGAAATGGGTTCTGAGAGG - Intergenic
945058124 2:205885743-205885765 GCGGGCTCCTGCTTTCTGGGCGG - Intergenic
946037647 2:216756491-216756513 GCATGCACCTGGGTTGGGGCTGG + Intergenic
947642445 2:231714554-231714576 CCAGGCACCAGAGTTCTGGGGGG + Intergenic
947914763 2:233823935-233823957 GAGGGCACCTGGGTTCTCGCTGG + Intronic
948012203 2:234657749-234657771 GAAGTAAGCTGGGTTCTGGGGGG + Intergenic
948770844 2:240250649-240250671 GAAGGCACCTGGGTGCAAGGAGG + Intergenic
1168931126 20:1624888-1624910 GCATACACCTGGCTTCTGGGAGG + Intergenic
1169656215 20:7926641-7926663 GCAGTCATCTGGGGTCTGTGTGG + Intronic
1171170544 20:23011688-23011710 GCTGGGAGCTGGGTTGTGGGAGG + Intergenic
1171427719 20:25058749-25058771 GCAGCCTCCTGGCTTCTAGGCGG - Intronic
1172181020 20:33003488-33003510 ACAGGAACCTGGGTCTTGGGTGG + Intronic
1172614943 20:36277179-36277201 GCAGAGACCTGGCTTCTGGAGGG + Intergenic
1174039349 20:47688046-47688068 GCAGGGCCCTGGGGTCTGCGGGG + Intronic
1174460382 20:50678278-50678300 CCAGGAACCTGGGGGCTGGGTGG + Intronic
1174481450 20:50834026-50834048 TCAGGCACCTGGGGCCTGGGAGG + Intronic
1175223829 20:57433400-57433422 AACGGCACCTGGGTTGTGGGAGG - Intergenic
1175223877 20:57433637-57433659 GCAGGCCCCTGGGGTGTGGAAGG + Intergenic
1175404802 20:58719017-58719039 ACAGCCACTTGGGTTCTGGTGGG - Intronic
1176177759 20:63736728-63736750 GGGGGCAGCTGGGGTCTGGGAGG + Intronic
1177302313 21:19263899-19263921 GCATGACCCTGGGTTCTGGCGGG - Intergenic
1178095568 21:29211832-29211854 CCAGGCACCTGAGCTGTGGGGGG - Intronic
1179248681 21:39655422-39655444 GCAGGGAGCTGGGTGCCGGGAGG + Intronic
1179466830 21:41581438-41581460 GAAGGGCCCTGGGTCCTGGGCGG - Intergenic
1180091839 21:45537483-45537505 GTGGGCACCGGGGTGCTGGGCGG - Intronic
1181956264 22:26589885-26589907 GCTGGGAGCTGGGATCTGGGAGG - Intronic
1182480464 22:30605584-30605606 GGAGCCACCTTGGTCCTGGGTGG - Intronic
1183604109 22:38858766-38858788 TCAGGCTGCTGGCTTCTGGGAGG - Intergenic
1184468126 22:44680761-44680783 GCAGGCAGCTAGGCTCTGGCAGG - Intronic
1184652352 22:45925069-45925091 GCTGGCAGGTGGGTGCTGGGTGG + Intronic
1184652370 22:45925131-45925153 GCTGGCAGGTGGGTGCTGGGTGG + Intronic
1184872002 22:47246704-47246726 GTAGGACCCTGAGTTCTGGGAGG + Intergenic
1185110838 22:48899230-48899252 GTGGGCTCCTGGGTTATGGGGGG + Intergenic
1185212271 22:49577046-49577068 GCAGGAACCAGGGTCCTGGGGGG - Intronic
950212773 3:11136198-11136220 GCAGGCACCTGGGGTAGGGGAGG - Intergenic
950544081 3:13628713-13628735 TCAGGTGCTTGGGTTCTGGGAGG + Intronic
952876268 3:37946948-37946970 GCTGGAATCTGGGGTCTGGGGGG + Intronic
952969726 3:38643310-38643332 GCGGGCACCTTGGCTCTGAGGGG + Intronic
953981638 3:47416213-47416235 GAAGGCACCTGGCCACTGGGTGG + Intronic
954656412 3:52197005-52197027 GGAGGCACCTGGGTTCAGAGTGG - Intergenic
956981898 3:74648683-74648705 GAAGTCACCTGGGTTCTGGCTGG - Intergenic
957191927 3:77021077-77021099 GCATACACCTGGGTCCTAGGAGG + Intronic
961429889 3:126874026-126874048 GCAGTGAGCTGGGTTCTGCGGGG - Intronic
961601126 3:128062905-128062927 TCAGGCACTTGGGGTCTGGATGG + Intronic
962808161 3:138941291-138941313 CCAGACTCCTGGCTTCTGGGTGG - Intergenic
963702864 3:148647950-148647972 GCATGAACCTGGGACCTGGGAGG - Intergenic
964810058 3:160653987-160654009 GCTGGCATCTAAGTTCTGGGAGG + Intergenic
967409561 3:189153668-189153690 GCTGGCAAATGGGATCTGGGTGG + Intronic
968521103 4:1035198-1035220 CCAGGGACCTGGGGTCAGGGAGG + Intergenic
968673422 4:1864325-1864347 GGAGCCACCTGGGGCCTGGGAGG + Intergenic
969212213 4:5696488-5696510 GCAGGCCCCTGGGCTCAGCGTGG - Intronic
973716174 4:53678650-53678672 GAAGGAACCTGGGTTCATGGTGG + Intronic
981108745 4:140911268-140911290 GCTGGCACCTGTGATCTGGTTGG + Exonic
985492018 5:185801-185823 GGAGGCACCAAGGTCCTGGGAGG - Exonic
985592659 5:773659-773681 GCAGGCACCTGGGTCGGGGCAGG - Intergenic
985822924 5:2172611-2172633 GCAGGCACCCCTGTGCTGGGCGG - Intergenic
986061715 5:4197903-4197925 TGAGGCACCTGGGTGTTGGGGGG + Intergenic
986233645 5:5887549-5887571 GCAGGGACCTGGGTAAGGGGTGG - Intergenic
990136791 5:52654863-52654885 GTCAGGACCTGGGTTCTGGGTGG + Intergenic
993525928 5:88965588-88965610 GCATGCACCTGTAGTCTGGGAGG + Intergenic
998296677 5:140976743-140976765 GCAGGCTTCTGGCATCTGGGAGG - Intronic
999233955 5:150079400-150079422 GCAGGATTCTGGTTTCTGGGAGG - Intronic
1001596740 5:172903307-172903329 GCAGGCACCTGGGCCCTGGTGGG + Intronic
1001771932 5:174303200-174303222 ACAGGGTCCTGGGTTCTGGCAGG + Intergenic
1001865909 5:175105271-175105293 GCAGGGACCTGGGTTCTGGGAGG + Intergenic
1002185010 5:177450314-177450336 GCACACACCAGGGCTCTGGGGGG - Intronic
1002306473 5:178286678-178286700 GCACCCAACTGGGTCCTGGGAGG + Intronic
1002581106 5:180209659-180209681 GAAGACACCGGGGTTCTGGGAGG + Intergenic
1006022201 6:31123889-31123911 GTAGGCACTTGGCTTCAGGGAGG + Intronic
1006153616 6:32002315-32002337 ACAGGCATCTGGCTTCTGAGGGG - Intronic
1006159924 6:32035052-32035074 ACAGGCATCTGGCTTCTGAGGGG - Intronic
1006259213 6:32854105-32854127 GGAGGCGCCTGGGTGCTGCGGGG - Intronic
1007069160 6:39022534-39022556 GCAGGCAGGTGGGCTCTGGAAGG - Intronic
1014456185 6:121637188-121637210 GCAGGCAGCATGGGTCTGGGAGG + Intergenic
1015239146 6:131004677-131004699 ACAGGCACCTCATTTCTGGGTGG - Intronic
1017406903 6:154129222-154129244 GCATGCACCGGTGGTCTGGGAGG + Intronic
1018908664 6:168089440-168089462 GAAGGCGCCTGGGGTCTGGTCGG + Intergenic
1019173892 6:170150079-170150101 GCAGGCAGCAGGCTTGTGGGGGG - Intergenic
1019344745 7:523697-523719 GCCTGCACCTGGGTTGGGGGTGG + Intergenic
1019492634 7:1322399-1322421 GGGGGCAGCTGGATTCTGGGGGG - Intergenic
1019540123 7:1547581-1547603 ACAGGCACCTGGGCTGTGTGGGG - Intronic
1019543405 7:1561332-1561354 GCAGGCCCCTGGCTAATGGGTGG + Intergenic
1019606592 7:1913278-1913300 GCAAGGAGCAGGGTTCTGGGCGG + Intronic
1019621737 7:1995801-1995823 GCTGGCACCGGGGTTCTGTATGG - Intronic
1020529402 7:9311979-9312001 CCAGGTACCTGGCTTCTGGTAGG + Intergenic
1022042338 7:26592847-26592869 GCAGGCACCTGGCAGCTGTGGGG - Intergenic
1022472987 7:30693076-30693098 GCAGACACCTGGGTCACGGGAGG + Intronic
1023338568 7:39195467-39195489 GAAGGCATCTGGGGTCTTGGAGG + Intronic
1023739490 7:43265987-43266009 GAATACACCTGGGTGCTGGGAGG - Intronic
1024440840 7:49415875-49415897 GAAGCCACCTGGGTCCTTGGAGG - Intergenic
1025017467 7:55450349-55450371 CCCAGCTCCTGGGTTCTGGGTGG - Intronic
1025912555 7:65840091-65840113 GCAGGCGCTTGGCTTGTGGGGGG - Intergenic
1026100664 7:67382064-67382086 GCAGTCAGCTTGGTGCTGGGGGG + Intergenic
1026484071 7:70802530-70802552 GCAGGTCCCTGGGGTCTAGGTGG - Intergenic
1026621524 7:71953835-71953857 GGAGGCACCTGTCTCCTGGGGGG + Intronic
1028933118 7:96436422-96436444 GCTGGCTCCTGGGTTCTCAGTGG + Intergenic
1029123795 7:98284277-98284299 GCAGGGACGTGTGTGCTGGGAGG - Intronic
1029482633 7:100822527-100822549 GCAGGCACCCTGGTCCTGGAAGG + Exonic
1029736160 7:102467095-102467117 GTAGGCACCTGGGTTGTTGCTGG + Intronic
1029736167 7:102467137-102467159 GTAGGCACCTGGGTTGTTGCTGG + Intronic
1030659332 7:112204093-112204115 GCAGACACCTCGGTTTTGGGTGG - Intronic
1031976251 7:128095428-128095450 GAAGGCACATGGGTCCTGGCTGG + Intergenic
1032154898 7:129459640-129459662 CCAGGCTCCTGGATACTGGGTGG + Intronic
1032396258 7:131592205-131592227 GCAGACAGCTGGCTTCTGGTAGG + Intergenic
1033686731 7:143647148-143647170 GCAGTGGCCAGGGTTCTGGGAGG + Intronic
1033689003 7:143720159-143720181 GCAGTGGCCAGGGTTCTGGGAGG - Exonic
1033697878 7:143810466-143810488 GCAGTGGCCAGGGTTCTGGGAGG - Intergenic
1035104881 7:156434150-156434172 GGAGGCAACTGAGGTCTGGGAGG + Intergenic
1035112787 7:156497341-156497363 GGAGGCAGCTGGGTGCTGAGAGG + Intergenic
1035331376 7:158099128-158099150 GGAGGCAGCCGGGTTGTGGGGGG - Intronic
1035338431 7:158144872-158144894 GCAGGCACTTGGCCTCTGTGTGG - Intronic
1035612978 8:980700-980722 GAAGGAAGCTGGGTTCCGGGAGG + Intergenic
1035690794 8:1558072-1558094 GCAGGCACCTTGGTCCTCGAGGG + Intronic
1042864566 8:73345785-73345807 CCAGGCAGCTGTGGTCTGGGGGG + Intergenic
1044844162 8:96364031-96364053 GCAGGCTCAGGGGTTCTTGGTGG - Intergenic
1045543272 8:103106046-103106068 GGAGGCCCCCGGGTTCCGGGAGG - Intergenic
1046745246 8:117868992-117869014 GCAGGCACTTGGCTCCGGGGAGG - Intronic
1048019512 8:130525576-130525598 GCAGACACCGTGGTGCTGGGTGG - Intergenic
1048900458 8:139032483-139032505 CCTGGCATCTGGGTTCTGAGAGG - Intergenic
1049035396 8:140071580-140071602 GCAGGCACCGGGCCTCTGGCAGG - Intronic
1049397625 8:142408890-142408912 GCTGGCACCTGGCTTCTTGGTGG + Intergenic
1049477322 8:142802793-142802815 GCTGGCACCTGTGTGCTGTGTGG + Intergenic
1049564887 8:143332872-143332894 GCAGGCAGCTGGAGTCTGGAGGG + Intronic
1049646899 8:143739599-143739621 GAAGGCACCTGGGCTCTTGTGGG - Intergenic
1049689605 8:143952876-143952898 GCAGGCCCCTGGCTGGTGGGAGG - Intronic
1049728149 8:144160862-144160884 CCCGGCGCCTGGGTTCTGGCTGG - Intronic
1049813088 8:144585058-144585080 GGAGACACCTTGGCTCTGGGTGG - Intronic
1049886259 9:29113-29135 GCAGGGACCCGGGCTCTGCGGGG - Intergenic
1052373197 9:27689153-27689175 TCAGGCACTTGGATTCTGGCAGG - Intergenic
1052751144 9:32492245-32492267 GCAGGAAGCTGGATTCTGGGAGG - Intronic
1052775433 9:32728174-32728196 ACAGGCACCTGGAGTCAGGGGGG + Intergenic
1053158771 9:35799261-35799283 GCAGGAACCTGGATGCTGGAAGG + Intronic
1053303566 9:36968702-36968724 GCAGGCACCTGTCTTGTGGAAGG - Intronic
1054460372 9:65459120-65459142 GGAGGCCCCTGGGCCCTGGGAGG + Intergenic
1057298186 9:93861324-93861346 ACAGGCTCCTGAGTGCTGGGTGG + Intergenic
1057371746 9:94480014-94480036 ACCGGCACCTGGGTGGTGGGGGG + Intergenic
1059398739 9:114055220-114055242 GCTGGCACCTGGGTTATGGCAGG - Exonic
1059671091 9:116493277-116493299 GCAGCAGCCTGGGTTCTAGGAGG - Intronic
1059715758 9:116911771-116911793 GCAGGCGCCTGTTGTCTGGGAGG + Intronic
1060523418 9:124307483-124307505 GCAGGCACATGGGATTTGAGAGG - Intronic
1060548601 9:124474946-124474968 GCCGGGACTTGGGTTCTGAGGGG - Intronic
1060785956 9:126451709-126451731 GGAGGCACAAGGGTCCTGGGTGG + Intronic
1060824493 9:126680137-126680159 GGGGGCACCAGGGTTATGGGGGG - Intronic
1060878956 9:127104366-127104388 GCAGGCACCTGGGTTCTGGGAGG - Intronic
1061299163 9:129694945-129694967 GCAGGCAAGTGGGTCTTGGGGGG - Intronic
1061612229 9:131754770-131754792 TAAGGGACCAGGGTTCTGGGGGG - Intergenic
1061812050 9:133167888-133167910 GGATGCCGCTGGGTTCTGGGTGG - Intergenic
1062160200 9:135075684-135075706 GCAGGGCCCTGGGTGCTGGCCGG - Intronic
1062353411 9:136150069-136150091 GCAAGCCCCTGCTTTCTGGGAGG + Intergenic
1062501210 9:136852806-136852828 GCAGGGAACTGGGCACTGGGAGG - Intronic
1185566287 X:1097829-1097851 GCAGAATCCTGGGTCCTGGGAGG + Intergenic
1186897076 X:14014314-14014336 GCATGTACCTGTGTTCTGGGTGG - Intronic
1188389723 X:29604882-29604904 GAAAGCACATGGGTTATGGGAGG - Intronic
1188691609 X:33136187-33136209 GCACGCACCTGTGGTCTGGGAGG + Intronic
1189393891 X:40602849-40602871 AAAGGCACCTGGGCTCTGGGTGG + Intronic
1190100327 X:47518047-47518069 GCAGGCAGGTGGGTTCTGGGGGG - Intergenic
1195599232 X:106727006-106727028 GCAGGCACCCGGTTCCCGGGGGG + Exonic
1198915159 X:141662528-141662550 GCAGGCACCTGAATGATGGGAGG + Intronic
1200384275 X:155874351-155874373 GCAGGCAGCTGCGTTCTGGCTGG + Intergenic
1201534107 Y:15026615-15026637 GCAGGTGCCTGTGTTCTGTGTGG + Intergenic