ID: 1060878957

View in Genome Browser
Species Human (GRCh38)
Location 9:127104369-127104391
Sequence AGAGCAGGCACCTGGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878957_1060878963 7 Left 1060878957 9:127104369-127104391 CCCAGAACCCAGGTGCCTGCTCT 0: 1
1: 0
2: 4
3: 24
4: 277
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878957 Original CRISPR AGAGCAGGCACCTGGGTTCT GGG (reversed) Intronic
900168487 1:1254572-1254594 TGAGCAGGCTCCTGGCTTCCAGG + Intronic
900674049 1:3872877-3872899 AGGGCTGGGACCTGTGTTCTGGG - Intronic
900684754 1:3940937-3940959 AAAGGAGCCACCTGGTTTCTGGG - Intergenic
901455961 1:9362983-9363005 TCAGCAGGCACCTGGGTTTGTGG + Intronic
902389128 1:16092574-16092596 AGAGAAGGCACCAGGGCTGTGGG - Intergenic
902407326 1:16191858-16191880 GGAGCAGGGCCCTGGGTCCTTGG + Intergenic
902500380 1:16907143-16907165 AGAGCTGGGGCCTGGGTACTGGG + Intronic
902636188 1:17736469-17736491 ACAGCAGGCAGCAGGGTGCTGGG - Intergenic
902658994 1:17888249-17888271 AGAGCGGGCCCCTGGCTACTGGG - Intergenic
903557776 1:24206080-24206102 AGAGCAGGCGCCAGGGTGGTTGG + Intergenic
904092987 1:27958027-27958049 TGAACATGCACCTGGGTCCTAGG + Intronic
904631837 1:31848397-31848419 AGATCAGGCACCTGGGCCCGTGG - Intergenic
904921994 1:34015148-34015170 GGTACATGCACCTGGGTTCTGGG - Intronic
904982425 1:34517901-34517923 AGAGCAGCCACCTTGGACCTAGG + Intergenic
905445363 1:38025233-38025255 AGAACAGGGAGCGGGGTTCTGGG + Intergenic
906792880 1:48674147-48674169 AGAGGACGCTCCTGGGTCCTCGG + Intronic
913446000 1:118951510-118951532 AGAGGAAGGACCAGGGTTCTGGG - Intronic
915281295 1:154823882-154823904 AGAGCATGGACCTGGGCACTTGG - Intronic
917088929 1:171332724-171332746 AGAACTGGTACCTGGGTTCTTGG + Exonic
917784388 1:178437115-178437137 AAACAAGGCACCTGGGCTCTAGG - Intronic
918117216 1:181507812-181507834 AGGGCAGGCACTGGGCTTCTTGG + Intronic
920044676 1:203125709-203125731 AGAGCTGGAAGCTGGCTTCTAGG - Intronic
920068364 1:203285108-203285130 AGAGAAGGCAACTGGGACCTTGG - Intergenic
920282458 1:204854327-204854349 GGAGCTGGCACCTGGGAACTTGG + Intronic
920736006 1:208533679-208533701 AGAGCAAGCTGCTGGGCTCTAGG - Intergenic
922764856 1:228151404-228151426 TGGGCAGGCACTTGGGGTCTTGG + Intronic
924314314 1:242780075-242780097 AGACAAAGAACCTGGGTTCTTGG - Intergenic
1062937888 10:1401394-1401416 AGAGAAGACAGCTGGGTTCTGGG + Intronic
1063125963 10:3137053-3137075 AGAGCAGGAGCCTGGGGTCGAGG - Intronic
1063671612 10:8103852-8103874 ACAGAAGTCACCTGGGCTCTGGG - Intergenic
1065918723 10:30372882-30372904 AGAGCAGGCATGTGGGATCTGGG - Intronic
1066503192 10:36014748-36014770 GGGGCAAACACCTGGGTTCTGGG + Intergenic
1067077860 10:43198288-43198310 AGAGAAGGCACCTGGCCCCTGGG + Intronic
1067494095 10:46746894-46746916 AGAGCTGGCAGGTGGGGTCTTGG + Intergenic
1067600568 10:47593504-47593526 AGAGCTGGCAGGTGGGGTCTTGG - Intergenic
1067704622 10:48597699-48597721 ACAGCAAGCACCTGGGGTCCTGG - Intronic
1068238007 10:54263503-54263525 AGAGCTGGCAGGTGGGGTCTTGG - Intronic
1068582052 10:58752909-58752931 AGAGCAGGCACCTCGGTCCCTGG - Intronic
1069262508 10:66415486-66415508 TGAGCAGGTAAGTGGGTTCTTGG - Intronic
1069877062 10:71569329-71569351 GGAGGAGGCACCAGGCTTCTTGG + Intronic
1070418378 10:76211212-76211234 AGAGGAGGCAACTGGGTACCAGG - Intronic
1070558417 10:77547469-77547491 AGCTCAGACACTTGGGTTCTTGG - Intronic
1071652100 10:87401376-87401398 AGAGCTGGCAGGTGGGGTCTTGG - Intergenic
1072220859 10:93326469-93326491 ACGGCAGGGACCTGGGTTCATGG + Intronic
1073301175 10:102471775-102471797 AGAGCTGGGAACTGAGTTCTGGG + Intronic
1075336181 10:121610229-121610251 AGAGCAGGCAGCTGGACTCCAGG - Intergenic
1076015019 10:127020893-127020915 AGAGCAGGCCGCTGGGTGATGGG - Intronic
1076157663 10:128216038-128216060 ACAGCAGGGTCCTGGGTTCTTGG + Intergenic
1076520454 10:131077867-131077889 AGGGCAGGACCCTGGGCTCTGGG - Intergenic
1078195289 11:9132077-9132099 AAAGCAGGCCCCTGGGTTTCTGG + Intronic
1078730638 11:13971022-13971044 AGAGCTCACACCAGGGTTCTTGG - Intronic
1079445716 11:20554640-20554662 AGAACAGGCAGCTGGATACTAGG - Intergenic
1080172630 11:29324009-29324031 AGAGCATGTAACTGTGTTCTGGG + Intergenic
1080964902 11:37202948-37202970 AGAGCACGCAGCTAGCTTCTTGG + Intergenic
1083077368 11:60055104-60055126 AGAGCTGGCACCTGAGCCCTAGG - Intergenic
1083309365 11:61776588-61776610 AGAGCAGAAGCCTGGCTTCTGGG + Intronic
1083310207 11:61780041-61780063 AGATCAGGCAGCTGAGGTCTCGG + Intronic
1083609405 11:63998007-63998029 AGGGCAGGAAGCTGGGGTCTGGG - Exonic
1084713988 11:70862168-70862190 GGAGCTGGCACCTGGGCACTGGG - Intronic
1085243150 11:75075168-75075190 AGAGCAGGCACCCAGGATCCAGG - Intergenic
1085297986 11:75441635-75441657 AGGGCAGGCACCTGAGCTCCTGG + Exonic
1087134023 11:94695957-94695979 AGGCCAGGAACCTGGGATCTTGG + Intergenic
1088595839 11:111439558-111439580 ATAGGAGGGAGCTGGGTTCTGGG - Intronic
1089366871 11:117926008-117926030 AGGGCAGGTACCAGGGTCCTTGG + Intronic
1090391862 11:126394091-126394113 ACAGCAGGCATCTGGGGTCAGGG + Intronic
1092174688 12:6395214-6395236 AGAGCAGGGACCTTGGTGGTTGG - Intergenic
1092926765 12:13278815-13278837 AGAGCTGCCACTTGGCTTCTAGG - Intergenic
1094656359 12:32423214-32423236 AGAGAGGCCACATGGGTTCTCGG + Intronic
1095250504 12:39973416-39973438 AGAGAAGGAATCTGGGCTCTGGG - Intronic
1095477356 12:42599226-42599248 AGAGCATCCACCTCAGTTCTGGG - Intergenic
1095572761 12:43701311-43701333 AGAGCAGGCCCATGGGATCCTGG - Intergenic
1096188566 12:49599826-49599848 AGGGCAGGCTGCTGGGTACTAGG + Exonic
1096683685 12:53273806-53273828 AGAGTGAGAACCTGGGTTCTTGG + Intronic
1096795128 12:54072094-54072116 ATTGCAGGCATCTGGTTTCTAGG - Intergenic
1097145560 12:56937188-56937210 AGAGCTGGCACCTGAGGTCTAGG + Intergenic
1097326495 12:58283221-58283243 AGAGAAGGCAACAGGATTCTGGG - Intergenic
1097842246 12:64332840-64332862 AGAACAGGCACCTGGGCTCCTGG + Intronic
1100764276 12:97846211-97846233 AGAGCAGGCAGAAGGGCTCTGGG - Intergenic
1101731210 12:107428067-107428089 AGAGCAAGGATCTGGGTTTTGGG - Intronic
1102500540 12:113349144-113349166 AGAGCAGGCAGCTGGGGTTTTGG - Intronic
1102868168 12:116390938-116390960 AGAGCTGGCACTTGGGATGTGGG + Intergenic
1103214857 12:119194219-119194241 AGAGTAGGAACCTGGGTGATGGG - Exonic
1103929898 12:124444586-124444608 TGAGCAGAGCCCTGGGTTCTAGG + Intronic
1113683285 13:112260241-112260263 AGTGCAGGGACCTCGGTTCTGGG + Intergenic
1114665361 14:24374362-24374384 AGAGCAGGCACTGGGGCTGTAGG - Exonic
1115141945 14:30182036-30182058 CCAGCAGGAACCTGGTTTCTAGG + Intronic
1117690629 14:58301626-58301648 ACAGAAGGCACCTCGGTACTTGG - Exonic
1119745699 14:77042376-77042398 AGTCCAGGCAGCTGGGTTTTTGG + Intergenic
1120760893 14:88284269-88284291 TGAGCATGCACCTGGGGACTGGG + Intronic
1121330214 14:93044952-93044974 AGGGCAGGCCCCAGGGCTCTAGG + Intronic
1122147146 14:99698217-99698239 AGGGCAGGCCTCTGGGCTCTGGG + Intronic
1122882149 14:104695004-104695026 AGAGGAGGGACCTGGGGCCTCGG + Intronic
1124143024 15:27094168-27094190 AAGGCAAGCACCTGGGTCCTTGG - Intronic
1126096644 15:45095138-45095160 GGTGAAGGCACCTGGGATCTAGG - Intronic
1126974592 15:54161230-54161252 ATAGCATGCACCTGTGGTCTCGG - Intronic
1127776339 15:62267009-62267031 AGAGCAGGCATGTGGGATTTGGG - Intergenic
1127790232 15:62391996-62392018 AGAGGAGGCGCCTTGGTTCGTGG + Intronic
1127978695 15:64018181-64018203 AGAGCAGGCCCCTGGTTCCCTGG + Intronic
1129037237 15:72657926-72657948 AGAGCAGGCATGTGGGATTTGGG + Intronic
1129063540 15:72881109-72881131 CTAGCAGCCCCCTGGGTTCTTGG - Intergenic
1129212650 15:74079300-74079322 AGAGCAGGCACGTGGGATTTGGG - Intronic
1129244460 15:74271112-74271134 GGAGCAGGCACCAGGGTGATGGG + Intronic
1129397749 15:75261786-75261808 AGAGCAGGCATGTGGGATTTGGG + Intronic
1129401360 15:75286063-75286085 AGAGCAGGCATGTGGGATTTGGG + Intronic
1129701917 15:77773135-77773157 ATGGCAGGGACCTGGGCTCTGGG - Intronic
1129729794 15:77923622-77923644 AGAGCAGGCATGTGGGGTTTGGG - Intergenic
1130679763 15:85986208-85986230 AGACCAGGCACGTGGGGCCTGGG + Intergenic
1132155614 15:99493481-99493503 ATTGCAATCACCTGGGTTCTTGG + Intergenic
1132735368 16:1383440-1383462 AGAGCGGGGCCCTGGGTGCTTGG + Intronic
1134191650 16:12125927-12125949 AGAGCAGGTATCTGGGTTCTGGG - Intronic
1135375128 16:21939772-21939794 AGAGCAGGCGTCTGGCTACTGGG - Intergenic
1136547825 16:30965480-30965502 AGAGGAGGCACCTGGGCTCTGGG + Intronic
1137340570 16:47599276-47599298 AAAACTGGCACCTGGGATCTGGG + Intronic
1138182252 16:54949554-54949576 AGGCAAGGCACCTGGGTCCTCGG - Intergenic
1139205358 16:65023446-65023468 CGGGAAGCCACCTGGGTTCTTGG + Intronic
1139374757 16:66490003-66490025 AGGACAGCCACCTGGGTGCTTGG - Intronic
1139450253 16:67023755-67023777 ATAGCAGTCCCCTGGATTCTAGG - Intergenic
1141223349 16:82091907-82091929 AGAGCAGGCACCAGGGGACCAGG - Intronic
1143214028 17:5210589-5210611 AGAGGAGACACATGGGTGCTCGG - Exonic
1143406245 17:6678852-6678874 ACAGCAGGGGCCAGGGTTCTAGG + Intergenic
1143747731 17:9005852-9005874 AGAGAAGGCCCCTGGGTTTGGGG - Intergenic
1143916972 17:10301417-10301439 AGAGCAGGTACCTGAGATGTAGG - Intronic
1143916998 17:10301543-10301565 AGAGCAGGTACCTGAGATATAGG - Intronic
1144347364 17:14361250-14361272 AGAGCAAGCAGCAGGCTTCTGGG - Intergenic
1144628425 17:16857358-16857380 GGAGGAGCCACCTGGGGTCTTGG - Intergenic
1145160014 17:20567929-20567951 GGAGGAGCCACCTGGGGTCTTGG - Intergenic
1145998940 17:29120174-29120196 AAGGCAGGCACCTGGGGTCTGGG - Intronic
1148114759 17:45169169-45169191 TGAGCAGCCCCCTGGGCTCTGGG - Exonic
1148701691 17:49591096-49591118 AGAGCACACACCTGGAGTCTAGG - Intergenic
1149097020 17:52855476-52855498 AGAGAAGGTACCTGGAGTCTAGG - Intergenic
1150516377 17:65814290-65814312 AGAGCAGACAGCTTGGTTTTGGG - Intronic
1151470324 17:74313974-74313996 AGAGCTGGCACCCGGGTTCCAGG + Intronic
1152702911 17:81828322-81828344 ACAGCAGGCCCCTGGCCTCTTGG - Intronic
1159571620 18:70120671-70120693 ACAACAGGGACCTGGCTTCTTGG + Intronic
1160032941 18:75278381-75278403 TTTGGAGGCACCTGGGTTCTGGG + Intronic
1160712435 19:558763-558785 AGAGCAGGCTCGGGGGTTTTGGG + Intergenic
1161783177 19:6307068-6307090 GGAGTAGGCACCTGGGGGCTGGG - Intronic
1161852424 19:6744693-6744715 AGACCAGGCACCCACGTTCTTGG - Exonic
1162001392 19:7746882-7746904 GGAGCAGGTACCTGGGTTACTGG - Intronic
1162221737 19:9183176-9183198 GGAGCAGGCAGCTGGGTTGGCGG - Intergenic
1163150895 19:15413344-15413366 AGAGAAGTCACGTGGGGTCTGGG - Intronic
1165853979 19:38869236-38869258 TGGGCAGTCACCTGGGCTCTGGG + Exonic
1166218713 19:41352490-41352512 AGACCAGACACCTGGGTGGTAGG + Intronic
1166549560 19:43656287-43656309 TGAGAAGGCATCTGGGTTCCTGG + Intronic
1166777406 19:45321589-45321611 ATAGCAGCCACCAGGGTTCCAGG - Intronic
1166947043 19:46403899-46403921 AGCGCAGCCACCTGGGCTCCGGG - Intergenic
1167044025 19:47039558-47039580 AGAGCAGGTACCGGGGTTGGGGG + Exonic
1168293082 19:55366414-55366436 AGGGCTGGCATCTCGGTTCTAGG + Intronic
925066012 2:929336-929358 GGAGCAGGCAGCTGGCTTCCTGG - Intergenic
925420987 2:3711583-3711605 AGAGCAGGCACTAGGTTGCTGGG - Intronic
926008321 2:9389730-9389752 ACAGCAAGCAGCTGGCTTCTGGG - Intronic
926076151 2:9944620-9944642 AGAGCTGGCTGCTGGCTTCTTGG + Intergenic
927213041 2:20650515-20650537 AGGGCAGGAACCCGGTTTCTGGG - Intronic
927467994 2:23351299-23351321 AGGACAGACCCCTGGGTTCTGGG - Intergenic
928298287 2:30104429-30104451 AGAGCAGGCAGGTGGGAACTGGG - Intergenic
929031314 2:37652206-37652228 ATAGAAGACACCTGGGTTCCAGG + Intronic
933567549 2:83969331-83969353 TGAGCAGGAACCTGTGTCCTTGG + Intergenic
933727824 2:85436543-85436565 AGAGCAGGCAGGTGAGTTCCCGG - Exonic
935372616 2:102363694-102363716 AGGGCAGGCAGCTGGGAGCTTGG - Intronic
938065840 2:128281586-128281608 AGAGAAAGAGCCTGGGTTCTTGG + Intronic
938645621 2:133327194-133327216 AGAGCAGGCAGCTGAGAGCTCGG - Intronic
938794531 2:134706676-134706698 AGAGCAGGTACGTGGGTTTGGGG + Intronic
940701515 2:157049912-157049934 AGATCAGGAATCTAGGTTCTGGG + Intergenic
941688948 2:168478350-168478372 AGAGCAGTCACCTGGTTTCGGGG + Intronic
947201177 2:227615927-227615949 AGAGCAGGCTCTTGGGCTATTGG + Intronic
947623090 2:231603501-231603523 AGAGCCCACACCTAGGTTCTGGG + Intergenic
947642441 2:231714551-231714573 ACACCAGGCACCAGAGTTCTGGG + Intergenic
948676676 2:239600954-239600976 AGCACAGGGACCTGGGATCTGGG + Intergenic
948770843 2:240250646-240250668 AGAGAAGGCACCTGGGTGCAAGG + Intergenic
948975625 2:241461765-241461787 AGAGCAGGATCATGGTTTCTGGG + Intronic
949027266 2:241772142-241772164 AGAGAAAGCAGCTGGGCTCTGGG + Intergenic
1168891857 20:1300117-1300139 AGACGAGGTACCTGGGTTCTGGG + Intronic
1169741928 20:8904101-8904123 AAAGCAGGTACCTGGTTCCTTGG - Intronic
1171415869 20:24979981-24980003 AGGGCAGGGGCCTGGGTTCGGGG - Intronic
1172613072 20:36266102-36266124 AGAGGAGACACTTGGATTCTGGG + Intronic
1172632824 20:36390642-36390664 AGAGCAGGGTCCTGGATCCTGGG + Intronic
1173019418 20:39254605-39254627 AGAGGAGGACCCTGAGTTCTGGG + Intergenic
1173185888 20:40839884-40839906 GAAGCAGGCACCTTGGTTGTTGG + Intergenic
1174238949 20:49117408-49117430 TGAGCAGACACCTAGGTTCCTGG - Intronic
1174870863 20:54180710-54180732 AGACCAGGCACCTAGCTTTTTGG + Intergenic
1175860318 20:62147038-62147060 TGCGCAGGCACCAGGGGTCTGGG + Intronic
1175965626 20:62658776-62658798 AGCGCAGGCAGCTGGGTGCGCGG - Intronic
1176366759 21:6037885-6037907 GCAGCAGGCACTTGGGTTTTTGG + Intergenic
1177855696 21:26398061-26398083 AGAGAAGGCACCTGGATATTTGG - Intergenic
1178577657 21:33808894-33808916 AGATCAGCCACCTTGGTTCTAGG - Intronic
1179539131 21:42072830-42072852 AGAGCAGGAGCCGGGGGTCTTGG - Intronic
1179603502 21:42496651-42496673 CGAGGAGCCACCTGGGTACTGGG + Intronic
1179756759 21:43500659-43500681 GCAGCAGGCACTTGGGTTTTTGG - Intergenic
1180031112 21:45208764-45208786 AGAGCAGGCACCGGGGTTGTGGG + Intronic
1180032904 21:45224464-45224486 AGCCAAGGCAACTGGGTTCTGGG + Exonic
1181002194 22:19993080-19993102 AGAGCAGAGACCTTGGTGCTGGG + Intronic
1181599639 22:23941881-23941903 AGAGGAGGGACCTGGGGTCCTGG + Intergenic
1181608868 22:23999425-23999447 AGAGGAGGGACCTGGGGTCCTGG - Intergenic
1181648788 22:24247670-24247692 TGAGAAGGCACCCGGGTTCCCGG + Intergenic
1183348283 22:37319758-37319780 CTGGCAGGCACCTGGGTCCTGGG + Intergenic
1183720003 22:39557265-39557287 AGAGCAGGCACCTGGGACCCGGG + Intergenic
1184504717 22:44893773-44893795 AGAGTGGGCACCTGGATTCTGGG - Intronic
1184506954 22:44909676-44909698 AGAGCAGTCAGCTGGGCTTTCGG - Intronic
1184765410 22:46569573-46569595 CCAGCAGGCACCTGTGATCTTGG - Intergenic
1184902728 22:47457711-47457733 TGAGCAGCCCCCTGGGTGCTGGG + Intergenic
1185212274 22:49577049-49577071 TGAGCAGGAACCAGGGTCCTGGG - Intronic
949448529 3:4161804-4161826 TGAGCTGGCACCTGGGTTGCAGG + Intronic
950669889 3:14519662-14519684 TGAGCAGGGAGCTGGGTGCTGGG - Intronic
950987448 3:17390242-17390264 CTATCAGGCACCTGGGTTCCTGG - Intronic
953876603 3:46670266-46670288 ACAGCAGGGTCCTGGGTCCTGGG + Exonic
954133551 3:48571865-48571887 AGAGCAGGCTCCTGGATGTTGGG + Intronic
955411269 3:58657151-58657173 AGTCCAGGAACCTAGGTTCTTGG + Intronic
956624428 3:71252857-71252879 ACAGCAGACACCTGGGCTCAGGG + Intronic
956692483 3:71890974-71890996 AAAGCAAGCTCCTGGTTTCTGGG + Intergenic
957712071 3:83874613-83874635 AGACCCGTCATCTGGGTTCTTGG - Intergenic
961503100 3:127351171-127351193 AGAGGAGGCAGCTGGCTTCCTGG - Intergenic
962410561 3:135137991-135138013 ATGGCAGGTACCTAGGTTCTGGG - Intronic
963787180 3:149546915-149546937 AGACAAGTCACCTGGCTTCTAGG - Intronic
964342950 3:155727806-155727828 AGAGCAGGTGCCTGATTTCTTGG - Intronic
964794551 3:160482928-160482950 ACAGGAGGCATCTGGGTTGTGGG + Intronic
967100718 3:186213311-186213333 AGAGCAGCCAGGTGGGATCTGGG + Intronic
967893586 3:194380495-194380517 AGAGCCGCCACCTGAGTCCTTGG + Intergenic
968595099 4:1478129-1478151 CCAGCAGCCACCTGGGTTCATGG - Intergenic
968996351 4:3948095-3948117 AGTGAAGGCTGCTGGGTTCTCGG + Intergenic
969150865 4:5167464-5167486 AACTCAGGCACATGGGTTCTGGG - Intronic
969470832 4:7388361-7388383 AGAAAAGCCACCTGTGTTCTGGG + Intronic
969529394 4:7722335-7722357 CGAGCAGCCTCCTGGGTCCTGGG + Intronic
969817615 4:9698124-9698146 AGTGAAGGCTGCTGGGTTCTCGG - Intergenic
969832382 4:9808140-9808162 GGAGCAGGGACCTGACTTCTGGG + Intronic
970093837 4:12439682-12439704 AGTGTAAGGACCTGGGTTCTGGG - Intergenic
971321417 4:25608925-25608947 ACAGCTTGCACCTGAGTTCTGGG - Intergenic
971326914 4:25652256-25652278 AGAGGAGGCAGCTGACTTCTGGG - Intergenic
972585442 4:40433333-40433355 GGAGCAGGCATCTGGGTACATGG - Intronic
978124522 4:105120047-105120069 AGAGAAGGGAACTGGGTTCCAGG - Intergenic
980897478 4:138874104-138874126 GGAGAAGGCAGCTGGGTTCAGGG - Intergenic
985203654 4:187509359-187509381 AGAGCTGCAACCTGTGTTCTAGG + Intergenic
985387097 4:189459542-189459564 GGAGCATGCACCTGACTTCTTGG - Intergenic
989340107 5:40364524-40364546 AGAGCAGGCCCTTGGGATTTTGG + Intergenic
989694990 5:44189861-44189883 AAAGCAGGCTCCTGGGATTTTGG - Intergenic
990985624 5:61638609-61638631 AGAGCAGGCTGGTGGGATCTGGG + Intronic
992237122 5:74722021-74722043 AGGACAGGCACCTGGGTTGCCGG - Intronic
992749004 5:79844861-79844883 AGAGGAGGCACCTTGGACCTGGG + Intergenic
994432786 5:99690180-99690202 AGAGCAGGCAAATGGAATCTAGG + Intergenic
995289862 5:110439496-110439518 AGGGCAGGCTCCAGGGTCCTTGG + Intronic
997208749 5:132065614-132065636 TGAGCAGACACCTGGGATGTGGG - Intergenic
997944640 5:138189063-138189085 GGAGCAGGCACCTCGGTGGTAGG + Exonic
998149521 5:139748869-139748891 GGAGCAGTCACCTGATTTCTAGG + Intergenic
999779925 5:154841086-154841108 AGAGCAGGCACCAGGATGTTTGG + Intronic
1000117274 5:158165619-158165641 AGAGCAGGCACCAGTGTGCTTGG - Intergenic
1000303664 5:159976859-159976881 TGAGCATGCACCTGGATTCAAGG + Intergenic
1001865908 5:175105268-175105290 TCTGCAGGGACCTGGGTTCTGGG + Intergenic
1003221347 6:4163649-4163671 GTAGCAGGCCCCTGGTTTCTGGG - Intergenic
1006024652 6:31139228-31139250 AGAGCAGGCAGCTGGGTCCTGGG - Exonic
1006188342 6:32192643-32192665 TGAGCAGGAAGCTGGGTTCCTGG + Exonic
1006738223 6:36290381-36290403 ATAGCAGGAGCCTGGGCTCTGGG + Intronic
1007635573 6:43297963-43297985 AGAGGAGGCCCCTGGGGCCTGGG - Intronic
1007819572 6:44551274-44551296 AGATAAGAAACCTGGGTTCTGGG - Intergenic
1008535650 6:52504505-52504527 AGCCAAGGCACCTGGCTTCTTGG - Intronic
1010043650 6:71416957-71416979 AGCCCAGGCACCTCTGTTCTTGG - Intergenic
1010529490 6:76949959-76949981 TGACCAGGCACCTTGGTTCTGGG - Intergenic
1011388687 6:86826390-86826412 ACAGCATGCACCAGGGTTCCAGG - Intergenic
1017641568 6:156499076-156499098 AGGGCAGGTAGCTGGGTTCTAGG + Intergenic
1018433803 6:163743893-163743915 AGCCTGGGCACCTGGGTTCTAGG + Intergenic
1018544224 6:164918408-164918430 AGACCTGGCACCTGGGTTTGTGG + Intergenic
1018706604 6:166468000-166468022 GGGGCAGGCATCTGGGTTCCAGG + Intronic
1018804415 6:167248000-167248022 AGAGCAGGCACCCGGCCTCCAGG + Intergenic
1019887718 7:3919928-3919950 AGAGTAAGCACCTGGGCTCTGGG + Intronic
1023817494 7:43961875-43961897 AGAGCAGAAACCTGAGGTCTGGG - Intergenic
1023832127 7:44045330-44045352 AGCTCAGGGATCTGGGTTCTTGG + Intronic
1029451928 7:100646359-100646381 GAAGCAGACACCTAGGTTCTGGG + Intronic
1029742119 7:102496749-102496771 AGAGCAGAAACCTGAGGTCTGGG - Intronic
1029760108 7:102595914-102595936 AGAGCAGAAACCTGAGGTCTGGG - Intronic
1034714030 7:153222782-153222804 AGGGCAGGCTCCTCTGTTCTTGG - Intergenic
1034762727 7:153688621-153688643 AGAGCAGGAAGCTGGGGCCTGGG - Intergenic
1034910830 7:154997176-154997198 AGAGAAGCCACCTGGCTGCTGGG - Intronic
1035676102 8:1456805-1456827 AGTGCAGGCACCCGGGCTCACGG - Intergenic
1035682741 8:1500350-1500372 AGAGTCGGCACCTGGTTTCCTGG + Intergenic
1035682758 8:1500443-1500465 AGAGTCGGCACCTGGTTTCCTGG + Intergenic
1035682775 8:1500536-1500558 AGAGTCGGCACCTGGTTTCCTGG + Intergenic
1035970654 8:4244266-4244288 AGAGCAGGCCCCCGGGTCTTCGG + Intronic
1037315792 8:17598264-17598286 AGATAAGGCAACTGGGTTCTAGG - Intronic
1037751773 8:21686926-21686948 TGAGCAGGGACCTGTGTCCTTGG + Intergenic
1039473445 8:37827342-37827364 AGGGCAGCCCCCTGGGCTCTTGG - Intronic
1039877350 8:41598319-41598341 TTAGCAGTGACCTGGGTTCTTGG - Exonic
1040296446 8:46151496-46151518 TTAGCCGTCACCTGGGTTCTGGG + Intergenic
1040646571 8:49403730-49403752 CGAGCAGTCCTCTGGGTTCTTGG + Intergenic
1040928930 8:52714279-52714301 CGAGCAGGCCCCTCGGCTCTGGG + Exonic
1045326183 8:101119400-101119422 AGAGCAGACATGTGGATTCTGGG + Intergenic
1046924068 8:119767858-119767880 AGGGCAGGTCCCTGGCTTCTTGG - Intronic
1047978599 8:130156777-130156799 TGAGCAGGCACCTGGGTGTGTGG + Intronic
1048210916 8:132453515-132453537 AGTGCAGGCCCCTCGGTTTTAGG - Intronic
1049542259 8:143213967-143213989 AGATCAGGCAGCAGGGCTCTGGG - Intergenic
1053462613 9:38282266-38282288 AGAGCAGGAAGCTTGGTCCTGGG - Intergenic
1054449716 9:65397310-65397332 GGAGCAGGCCCCTGGGTCTTGGG + Intergenic
1054741025 9:68805872-68805894 CTAGCAAGCAACTGGGTTCTGGG - Intronic
1060785955 9:126451706-126451728 AGAGGAGGCACAAGGGTCCTGGG + Intronic
1060878957 9:127104369-127104391 AGAGCAGGCACCTGGGTTCTGGG - Intronic
1061379611 9:130246291-130246313 ACAGCAGGGACCGGGGCTCTGGG - Intergenic
1061932628 9:133841107-133841129 GTAGCAGGTGCCTGGGTTCTAGG + Intronic
1062061030 9:134495073-134495095 GGGGCAGGGACCTGGATTCTAGG - Intergenic
1062118001 9:134819340-134819362 AGAGCAGCAACCTGGGATCCTGG - Intronic
1062263861 9:135677862-135677884 AGCACAGGCACCTGGGCTCGTGG - Intergenic
1062308988 9:135925705-135925727 AGAGCAGCCACCTGGGGACACGG + Intergenic
1062549268 9:137078412-137078434 AGAGCCGGCATCGGGGTTCGGGG - Intronic
1187046774 X:15655108-15655130 AGAGCAGGGACCTGAGTGGTGGG + Intronic
1187053003 X:15713303-15713325 AGAGCAGGGACCTGAGTGGTGGG + Intronic
1187780083 X:22811461-22811483 AGAAAAGGCACATGGCTTCTGGG + Intergenic
1187958302 X:24542460-24542482 AAAGCAAGCACTTGGGTGCTTGG + Intergenic
1198458252 X:136838454-136838476 CCAGCAGCCACCTGGGCTCTGGG - Intergenic
1198727407 X:139692039-139692061 AGTGCAGCCATCTGGGTTCTGGG + Intronic
1199670804 X:150146720-150146742 AGAGCTGGCCCTTGGGTTTTAGG + Intergenic