ID: 1060878958

View in Genome Browser
Species Human (GRCh38)
Location 9:127104370-127104392
Sequence TAGAGCAGGCACCTGGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878958_1060878963 6 Left 1060878958 9:127104370-127104392 CCAGAACCCAGGTGCCTGCTCTA 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878958 Original CRISPR TAGAGCAGGCACCTGGGTTC TGG (reversed) Intronic
901625720 1:10623852-10623874 TTGAGCAGGCAGCTTGGGTCAGG + Intronic
901971450 1:12912149-12912171 TGCTGCAGGCACCTGGGTTTGGG - Intronic
902013718 1:13289591-13289613 TGCTGCAGGCACCTGGGTTTGGG + Intergenic
902043221 1:13507220-13507242 AAGAGCTGGCACCTGGTTCCTGG + Intronic
902636189 1:17736470-17736492 TACAGCAGGCAGCAGGGTGCTGG - Intergenic
903713933 1:25348943-25348965 CAGAGCAGGCTGCTGGGCTCAGG + Intronic
904312214 1:29636142-29636164 TTGAGAAGGCACCTGGGGGCAGG + Intergenic
904447488 1:30586962-30586984 TGGGGAAGGCACCTGGGTGCAGG - Intergenic
904473587 1:30750692-30750714 TGGAGCAGACACCTGGGCTCGGG + Intronic
906424606 1:45700133-45700155 TAGAGCAGGCATGTGTGTTGTGG - Exonic
909398090 1:75193312-75193334 TTGAGCAGCCACTTAGGTTCAGG + Intergenic
911097767 1:94069111-94069133 CAGCGCAGGCAGCTGTGTTCAGG + Intronic
911467702 1:98275744-98275766 TTGATTAGGCACCTTGGTTCTGG - Intergenic
913389223 1:118291839-118291861 TAGAGAAGGCCCCCGAGTTCTGG + Intergenic
913525606 1:119689654-119689676 TAGAGCTGGGACTTGAGTTCAGG - Intronic
915095010 1:153456296-153456318 TAGAGAAGGCAGCAGGGGTCTGG + Intergenic
915301387 1:154953494-154953516 TAGATCAGGCCCCAGGGGTCAGG - Intronic
916958859 1:169868871-169868893 AAGAGCAGGCAGCAGTGTTCCGG + Intronic
921370541 1:214418413-214418435 TAGAGAAGGCAACTGTGTTGAGG + Intronic
921481516 1:215669315-215669337 AAGGGCAGGCACGTAGGTTCTGG + Intronic
922134541 1:222812213-222812235 TATAGCATGCACCAGAGTTCTGG - Intergenic
923495646 1:234522040-234522062 AAGTGCAGGGACATGGGTTCTGG + Intergenic
1062878958 10:963104-963126 GAGAGCAGGCACCTGGCCACAGG - Intergenic
1062937887 10:1401393-1401415 CAGAGAAGACAGCTGGGTTCTGG + Intronic
1063103606 10:2973393-2973415 CAGAGCAGCCATCAGGGTTCTGG + Intergenic
1065918724 10:30372883-30372905 TAGAGCAGGCATGTGGGATCTGG - Intronic
1071496069 10:86168502-86168524 GACAGCAGGCTCTTGGGTTCTGG - Intronic
1077108350 11:851476-851498 TAGAGAAGGAGCCTGGGCTCAGG - Intronic
1079004739 11:16783642-16783664 TAGAGACGCCACCTGGGGTCAGG + Intronic
1081263627 11:40991711-40991733 TATACCAGGAATCTGGGTTCTGG - Intronic
1083091406 11:60202706-60202728 CAGAACAGGCACCTGGAGTCAGG - Intronic
1083670572 11:64297732-64297754 TAGAGCAACCACATGGGATCTGG - Intronic
1084113631 11:67029138-67029160 ATGAGCAGTCACCTAGGTTCAGG + Intronic
1085249688 11:75134856-75134878 GGGAGCAGGCATCTGGTTTCTGG - Intronic
1085991409 11:81851320-81851342 GAGGCAAGGCACCTGGGTTCCGG - Intergenic
1088519725 11:110682505-110682527 AAGACCAGACACCTGGGTTCTGG + Intronic
1090391861 11:126394090-126394112 CACAGCAGGCATCTGGGGTCAGG + Intronic
1091219752 11:133923181-133923203 GGGAGCAGGCAGCTGCGTTCTGG - Intronic
1092194832 12:6542837-6542859 GAGTGCAGGGAGCTGGGTTCTGG + Intronic
1095477357 12:42599227-42599249 TAGAGCATCCACCTCAGTTCTGG - Intergenic
1100307721 12:93366579-93366601 AAGATGAGACACCTGGGTTCTGG - Intergenic
1100489155 12:95062058-95062080 TAGCACAGGCAGCTTGGTTCTGG + Intronic
1102908519 12:116695396-116695418 TAGAGATGGCACCTGGAATCTGG - Intergenic
1103136045 12:118508827-118508849 AACAGCAAGAACCTGGGTTCTGG + Intergenic
1104099849 12:125597025-125597047 TAGAGCATGCACCATGGCTCTGG + Intronic
1104779216 12:131409058-131409080 TTGAATAGGCACCTTGGTTCAGG + Intergenic
1105898711 13:24739640-24739662 TAGAGCCGGGTCCTGGGATCAGG - Intergenic
1111314756 13:86539957-86539979 TAGAACATGCAGCTGTGTTCTGG - Intergenic
1113453967 13:110434101-110434123 AAGAGCATGTCCCTGGGTTCTGG - Intronic
1113683284 13:112260240-112260262 CAGTGCAGGGACCTCGGTTCTGG + Intergenic
1115002642 14:28440782-28440804 TAGAGTAGGCACATTGATTCTGG + Intergenic
1118884853 14:69858099-69858121 CAGAGCAGGCACCAGGACTCAGG + Intronic
1119674867 14:76546172-76546194 TAGAGTAGGAAGCTGGGTCCGGG + Intergenic
1120760892 14:88284268-88284290 TTGAGCATGCACCTGGGGACTGG + Intronic
1121816792 14:96934807-96934829 CAGAGCAGGCAGCTGGGTAATGG - Intergenic
1122576718 14:102747527-102747549 AACAGCAGGCACCTGGGAACGGG - Intergenic
1124434200 15:29634146-29634168 TACAGCAGGCACTTGGCATCTGG - Intergenic
1124581999 15:30964633-30964655 TAGAGCAGGCCACTGGTATCAGG - Intronic
1126168411 15:45673457-45673479 TAGAGCAGGCAGGTGGGTGAGGG - Intronic
1129212651 15:74079301-74079323 CAGAGCAGGCACGTGGGATTTGG - Intronic
1129244459 15:74271111-74271133 TGGAGCAGGCACCAGGGTGATGG + Intronic
1129648179 15:77457681-77457703 AATAGCATGCACCTGGGTACAGG - Intronic
1129701918 15:77773136-77773158 TATGGCAGGGACCTGGGCTCTGG - Intronic
1130155203 15:81344420-81344442 TGGAGCAGATTCCTGGGTTCAGG + Intronic
1130997145 15:88910224-88910246 AAGAGCTGGCAGCTGGGGTCTGG + Intronic
1134191651 16:12125928-12125950 AAGAGCAGGTATCTGGGTTCTGG - Intronic
1135521542 16:23182372-23182394 TAGGGCAGGCACCTGCCATCTGG + Intergenic
1136247562 16:28984539-28984561 GAGAGCAGGCACCTGGGGTCTGG - Exonic
1136450667 16:30352800-30352822 TGGAGAAGGCCCCTGGCTTCTGG + Exonic
1136455202 16:30376373-30376395 TGGAGCAGGCTCCTGGGGCCGGG - Intronic
1136547824 16:30965479-30965501 CAGAGGAGGCACCTGGGCTCTGG + Intronic
1137629221 16:49930522-49930544 TAGAGCAGGCACATGGGGCTGGG + Intergenic
1137729366 16:50678683-50678705 GAGAACAGGCAGCTGGGATCTGG + Intronic
1141614091 16:85200496-85200518 GAGAACAGGGCCCTGGGTTCAGG - Intergenic
1143250766 17:5521532-5521554 TGGAGCAGTCACTTGGGATCAGG + Exonic
1143747732 17:9005853-9005875 AAGAGAAGGCCCCTGGGTTTGGG - Intergenic
1145259966 17:21348896-21348918 TTGAGCAGGCCCCTGGGGACGGG + Intergenic
1145316651 17:21739042-21739064 TTGAGCAGGCCCCTGGGGACGGG - Intergenic
1145988257 17:29062024-29062046 TAATGCAGGCACCTGGGTTAGGG + Intergenic
1145998941 17:29120175-29120197 GAAGGCAGGCACCTGGGGTCTGG - Intronic
1148228942 17:45919250-45919272 TAGAGGAGGCACCAGGGGCCCGG - Intronic
1156296777 18:35799463-35799485 TAAAGCAGGCTCCTGGCTTCAGG + Intergenic
1158093990 18:53749304-53749326 GAAAGCAGGCATCTGTGTTCAGG - Intergenic
1158138219 18:54228728-54228750 TAAAGCTGGCATCTGGGTCCAGG + Intergenic
1160783467 19:889003-889025 TTGGGGGGGCACCTGGGTTCAGG - Intronic
1161796531 19:6389975-6389997 TACAGCAGGCATCTGGTTCCAGG + Intronic
1165708317 19:37991871-37991893 CACTGCAGGCAGCTGGGTTCGGG + Intronic
1166947044 19:46403900-46403922 CAGCGCAGCCACCTGGGCTCCGG - Intergenic
1167044024 19:47039557-47039579 GAGAGCAGGTACCGGGGTTGGGG + Exonic
1167454194 19:49590104-49590126 TGGAGGAGGAACCTGGGCTCAGG + Intronic
1167665756 19:50822101-50822123 TAGAGCAGCCTCCAGGGATCAGG + Intronic
925420988 2:3711584-3711606 TAGAGCAGGCACTAGGTTGCTGG - Intronic
927077032 2:19589014-19589036 CAAGGCAGGGACCTGGGTTCTGG - Intergenic
934049464 2:88198234-88198256 TAGATCAGGCACCTGAGCCCAGG - Intergenic
935333317 2:101993458-101993480 CAGATCAGACACCTGAGTTCTGG + Intronic
935404791 2:102697667-102697689 TAGAGCAGGGAAGTGGGTGCGGG + Intronic
937198607 2:120181930-120181952 CAGAGCAGGCAACTGAGTCCTGG - Intergenic
937838804 2:126503691-126503713 TAAAGCTGGCACCTGGTTCCAGG + Intergenic
938243644 2:129761488-129761510 TGCTGCAGGCACCTGGGTCCAGG + Intergenic
938794530 2:134706675-134706697 AAGAGCAGGTACGTGGGTTTGGG + Intronic
939766908 2:146262136-146262158 TAAAGCAGTCACTTGGATTCTGG - Intergenic
940006655 2:149014523-149014545 TGGACAAGGGACCTGGGTTCAGG + Intronic
940543350 2:155050409-155050431 TAGTACAGGCACTTGGGTACAGG - Intergenic
941688947 2:168478349-168478371 GAGAGCAGTCACCTGGTTTCGGG + Intronic
942383083 2:175413124-175413146 TACAGAAGGAGCCTGGGTTCTGG - Intergenic
944213159 2:197227348-197227370 TAGAGCAGGGACCTGGAAGCAGG + Intronic
946037646 2:216756487-216756509 CAGTGCATGCACCTGGGTTGGGG + Intergenic
948732716 2:239977272-239977294 GAGCACAGGCACCTGGGATCCGG + Intronic
1168851822 20:982128-982150 TAGAGCAGCCAGATGAGTTCGGG + Intronic
1168891856 20:1300116-1300138 AAGACGAGGTACCTGGGTTCTGG + Intronic
1169866318 20:10203661-10203683 TGGAGCTGGCACCTGGGTCCTGG + Intergenic
1171385937 20:24769616-24769638 TAGAGCTGGCACCCGGAATCTGG - Intergenic
1171415870 20:24979982-24980004 TAGGGCAGGGGCCTGGGTTCGGG - Intronic
1172613071 20:36266101-36266123 TAGAGGAGACACTTGGATTCTGG + Intronic
1174869262 20:54168229-54168251 GAGAGCAGGCAGCTGTGATCAGG - Intronic
1175821022 20:61908871-61908893 AAGGTCAGGCTCCTGGGTTCAGG + Intronic
1175986183 20:62765182-62765204 GAGAGCAGGGACCTGGTTGCAGG - Intergenic
1176048410 20:63104177-63104199 TGGAGCAGCCCCCTGGGATCAGG + Intergenic
1179658954 21:42862624-42862646 TAGAGCAGGCTTCTGGGGTGGGG + Intronic
1180004070 21:45011941-45011963 TCGAGCCCACACCTGGGTTCTGG + Intergenic
1180031111 21:45208763-45208785 AAGAGCAGGCACCGGGGTTGTGG + Intronic
1182317695 22:29458970-29458992 TAGAGGAGGGAACTGGATTCAGG + Intergenic
1183720002 22:39557264-39557286 CAGAGCAGGCACCTGGGACCCGG + Intergenic
1184445611 22:44545189-44545211 TAGGGCTGGCACCTGGGCCCGGG - Intergenic
1184504718 22:44893774-44893796 AAGAGTGGGCACCTGGATTCTGG - Intronic
1184902727 22:47457710-47457732 TTGAGCAGCCCCCTGGGTGCTGG + Intergenic
1184983982 22:48116948-48116970 TGGAGCAGGCACTTGTGCTCAGG - Intergenic
949324473 3:2848040-2848062 TTGACCAGGCTCCTGGGTTCAGG - Intronic
949439253 3:4062839-4062861 TAAAGCAGGCATCTGGTTGCAGG - Intronic
952617518 3:35292690-35292712 CCCAGCAGGCAGCTGGGTTCAGG + Intergenic
953876602 3:46670265-46670287 TACAGCAGGGTCCTGGGTCCTGG + Exonic
956426398 3:69140157-69140179 TAGAGCTCTCACCTGAGTTCTGG - Intergenic
956454149 3:69404176-69404198 GAGACCAGGCACATTGGTTCAGG - Intronic
956624427 3:71252856-71252878 AACAGCAGACACCTGGGCTCAGG + Intronic
956692482 3:71890973-71890995 TAAAGCAAGCTCCTGGTTTCTGG + Intergenic
956981899 3:74648687-74648709 AAGTGAAGTCACCTGGGTTCTGG - Intergenic
961631139 3:128299652-128299674 CAGAGCACAGACCTGGGTTCAGG + Intronic
962624305 3:137210242-137210264 AAGGGCAGGCACCTGGGCTGAGG + Intergenic
963456095 3:145549846-145549868 TAAAGCAGGCATCTGGTTCCAGG - Intergenic
966347615 3:178996974-178996996 TAGAGCAAGCATCTGGTTCCAGG - Intergenic
967172363 3:186831695-186831717 CAGAGGAGTCTCCTGGGTTCTGG + Intergenic
967613566 3:191537565-191537587 TAGGGGAGGAACCTGGGTGCAGG + Intergenic
969086131 4:4657888-4657910 TAGAGGAGGACCCTGGGGTCCGG + Intergenic
969517770 4:7657105-7657127 TGGAGCAGGCACCAGGCCTCAGG + Intronic
969832381 4:9808139-9808161 TGGAGCAGGGACCTGACTTCTGG + Intronic
977026111 4:91821160-91821182 CAGTGCAGGGACCTGGGTCCTGG + Intergenic
980309108 4:131102579-131102601 TAGAGCAGGCACCAGGAGTGGGG + Intergenic
980897479 4:138874105-138874127 TGGAGAAGGCAGCTGGGTTCAGG - Intergenic
985592660 5:773663-773685 GTGAGCAGGCACCTGGGTCGGGG - Intergenic
987262880 5:16221414-16221436 TGGAGCAGGGACCTGGGTGCAGG - Intergenic
988796337 5:34656429-34656451 TGGAGCAGCCAGCTGGGTCCGGG + Intronic
990341037 5:54823370-54823392 TAGAGGAGGCAGCTGGGTGGTGG - Intergenic
991930121 5:71746064-71746086 TAGAGCAGGCACTCAGCTTCAGG - Intergenic
996470374 5:123853050-123853072 TGGATCAGTCACCTGGGTTTTGG + Intergenic
997043667 5:130287829-130287851 GAGACCAGGCCCCTGGATTCTGG + Intergenic
997885167 5:137623430-137623452 AAGACCAGGCACCTGGACTCAGG - Intronic
999241296 5:150129073-150129095 TACAGCAGGCACATGTGTACGGG + Intronic
999971468 5:156868125-156868147 TAGAGAATGCCCCTGGGCTCTGG - Intergenic
1001313417 5:170626936-170626958 GAGAGCAGGCACCTGAGGCCTGG + Intronic
1001383136 5:171316841-171316863 TGGTGCAGGCGCCTGCGTTCTGG + Intergenic
1001865828 5:175104643-175104665 TAGAGAAGGCACCTGACTTTGGG + Intergenic
1003221348 6:4163650-4163672 TGTAGCAGGCCCCTGGTTTCTGG - Intergenic
1003506865 6:6746816-6746838 CAGAGCAGCCACCTGCTTTCAGG - Intergenic
1006024653 6:31139229-31139251 GAGAGCAGGCAGCTGGGTCCTGG - Exonic
1006582867 6:35086798-35086820 AAGAGCAGGCCCCTGGGGGCAGG - Intronic
1006788796 6:36685508-36685530 TAGAGCAGACCCATGGGTGCGGG + Intronic
1006936593 6:37723055-37723077 TGCAGCAGGCACCTGGTTCCTGG - Intergenic
1007819573 6:44551275-44551297 TAGATAAGAAACCTGGGTTCTGG - Intergenic
1010529491 6:76949960-76949982 CTGACCAGGCACCTTGGTTCTGG - Intergenic
1011804900 6:91060837-91060859 CAGACCAGCCACCTGGGTTGTGG + Intergenic
1017186894 6:151610755-151610777 TAGAGCAGGCACCTGAGACAGGG - Intronic
1018908663 6:168089436-168089458 TTGAGAAGGCGCCTGGGGTCTGG + Intergenic
1019887717 7:3919927-3919949 TAGAGTAAGCACCTGGGCTCTGG + Intronic
1022042764 7:26596064-26596086 TAGATAAGGCACTGGGGTTCAGG - Intergenic
1023198335 7:37666103-37666125 TAAAGCCAGCACCTGGTTTCAGG + Intergenic
1026658152 7:72275412-72275434 TAGAGCAGGCACGCAGGGTCTGG - Intronic
1031968510 7:128046111-128046133 TAGAGCAAGACCCTGGCTTCAGG - Intronic
1034762728 7:153688622-153688644 TAGAGCAGGAAGCTGGGGCCTGG - Intergenic
1034825624 7:154259881-154259903 CAGAGCAGGCACGTGGCTGCTGG + Intronic
1034832594 7:154322177-154322199 TAGAGCAGCCACCTGGCCTGGGG + Intronic
1037165371 8:15821675-15821697 TAGAGAAGGAACCTGGCTTAGGG - Intergenic
1039846907 8:41331925-41331947 TAGAGCAAGCACCTGAGGCCTGG - Intergenic
1040278942 8:46028091-46028113 CAGAGCAGGCACCTCTGTTCTGG - Intergenic
1040296445 8:46151495-46151517 TTTAGCCGTCACCTGGGTTCTGG + Intergenic
1041003731 8:53479194-53479216 AAGAGCAGGCCCCTGGCTTCCGG - Intergenic
1042730293 8:71926090-71926112 CAAAGCAGGCACCTGGCTTCAGG - Intronic
1045750099 8:105473199-105473221 TAGACCAGGCACAGTGGTTCAGG - Intronic
1047916717 8:129591758-129591780 TAGAGAAGGCACATGGGGACAGG + Intergenic
1048112923 8:131487446-131487468 TGGATCAGGCACCGGGGTGCAGG - Intergenic
1054449715 9:65397309-65397331 TGGAGCAGGCCCCTGGGTCTTGG + Intergenic
1060878958 9:127104370-127104392 TAGAGCAGGCACCTGGGTTCTGG - Intronic
1062549269 9:137078413-137078435 CAGAGCCGGCATCGGGGTTCGGG - Intronic
1185721932 X:2389244-2389266 TGGAGCACCCACCTGGGTGCAGG - Intronic
1189692896 X:43635507-43635529 TAAAGCAGGCATCTGGTTCCAGG - Intergenic
1190581882 X:51897952-51897974 TAGATCAGGGTCCAGGGTTCAGG + Intronic
1192505474 X:71679345-71679367 TAAAGAAGGCACCAGGGTCCAGG - Intergenic
1194995415 X:100586769-100586791 TAGAGAAGCCACCTGTGTTCAGG + Intronic
1197406944 X:126065203-126065225 TGGAGCAGGCACCAGGATTGGGG - Intergenic
1198727406 X:139692038-139692060 AAGTGCAGCCATCTGGGTTCTGG + Intronic
1200083472 X:153591207-153591229 CACAGGAGGCACCTGGATTCCGG + Intronic
1200384273 X:155874347-155874369 TCCAGCAGGCAGCTGCGTTCTGG + Intergenic