ID: 1060878959

View in Genome Browser
Species Human (GRCh38)
Location 9:127104376-127104398
Sequence AAAGGATAGAGCAGGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878959_1060878970 29 Left 1060878959 9:127104376-127104398 CCCAGGTGCCTGCTCTATCCTTT 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1060878970 9:127104428-127104450 CCTCTTCTAATAGCAGCAGCAGG No data
1060878959_1060878963 0 Left 1060878959 9:127104376-127104398 CCCAGGTGCCTGCTCTATCCTTT 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878959 Original CRISPR AAAGGATAGAGCAGGCACCT GGG (reversed) Intronic
900942310 1:5807708-5807730 TAAGGGAAGAGCAGACACCTGGG + Intergenic
901295965 1:8161127-8161149 GAAAGAAGGAGCAGGCACCTAGG + Intergenic
903703234 1:25266608-25266630 AAAGGAAACAACAGTCACCTTGG + Intronic
903712498 1:25336937-25336959 AAAGGAAACAACAGTCACCTTGG + Intronic
904260392 1:29284441-29284463 ATAGGGGAGAGCAGACACCTGGG - Intronic
904790583 1:33017403-33017425 AAAGGAGAGAGCAGGCTGCTGGG + Intronic
905942454 1:41874921-41874943 AAAGGACAGAGCCAGCACCAAGG - Intronic
905995132 1:42375049-42375071 AAAGGACAGGCCAGGCACCATGG - Intergenic
906091214 1:43181061-43181083 AATGACTAGGGCAGGCACCTTGG - Intronic
906552888 1:46680780-46680802 AAAGTAGAGAGCATGCACTTTGG - Intronic
907431779 1:54416390-54416412 AAAGGACAGAGCATTCAACTGGG - Intergenic
907965051 1:59320774-59320796 AAAGGAAAGAGCATGAAACTTGG + Intronic
908181066 1:61606491-61606513 AAAGCATCGAGCAGGAAACTTGG + Intergenic
909616825 1:77620170-77620192 AAAAGGTAGAGCAGGCAGTTAGG + Intronic
910434001 1:87187012-87187034 AAGGGAGAGAGCAGGAACATAGG - Intergenic
914433185 1:147638371-147638393 AAAGGATGGAGCATCAACCTGGG + Intronic
914885193 1:151578813-151578835 AAATGATAGAGCAGGTAAGTTGG + Exonic
915904988 1:159871121-159871143 AAAAGGTGGAGAAGGCACCTGGG + Intronic
917476707 1:175374997-175375019 AAAGATTAGAGCAGTCACCTTGG + Intronic
919961544 1:202475140-202475162 AATAGAAAGAACAGGCACCTGGG - Intronic
920461350 1:206143131-206143153 AAAAAAAAGAGCAGGGACCTAGG + Intergenic
922738754 1:228004341-228004363 AAGGCATAGGGCAGGCTCCTGGG - Intergenic
922952868 1:229573838-229573860 AAAACATTGAGCATGCACCTGGG - Intergenic
924432338 1:244007778-244007800 AAAGGCTAGGCCAGGGACCTGGG + Intergenic
1063436496 10:6036292-6036314 AAAGGAGAGAGCAGGTGCCTGGG - Intronic
1063456464 10:6185997-6186019 ATAGGGAAGAGCAGGAACCTTGG + Intronic
1064263198 10:13802885-13802907 CAAGGACAGACCAGGCACTTTGG + Intronic
1064726223 10:18282413-18282435 AAAAGATAGACCAGTCACCTGGG + Intronic
1065261422 10:23927208-23927230 ATAAGATAGACCAGGCACTTTGG - Intronic
1065299937 10:24312130-24312152 CAGGGAGAGAGCAGGCATCTCGG - Intronic
1065918725 10:30372889-30372911 AATGTATAGAGCAGGCATGTGGG - Intronic
1069291528 10:66786159-66786181 AAGGGATAGAGCAAGACCCTAGG - Intronic
1070007894 10:72443042-72443064 AAAGGACAGACCAGGCACTGTGG - Intronic
1070546721 10:77458317-77458339 TAAAGATAGGGCAGGCACCAAGG + Intronic
1070920214 10:80180011-80180033 AAAGCATAGAGCAGCTATCTGGG + Intronic
1071480404 10:86061006-86061028 GAAGGATGGTGCAGGCAACTGGG - Intronic
1075111340 10:119587503-119587525 AAAGGAGTTAGCAGGCACTTAGG - Intronic
1075420758 10:122298709-122298731 ACAGGCAAGAGCAGGAACCTGGG + Intronic
1075883453 10:125875427-125875449 AAAGGACAGAGAAGCCACATTGG + Intronic
1076250838 10:128982722-128982744 AACAGAAACAGCAGGCACCTGGG + Intergenic
1076694081 10:132238606-132238628 AAAGCATAGAGCAGACGGCTGGG + Intronic
1077546894 11:3175831-3175853 AGAGGAAATAGCAGGCACCCAGG + Intergenic
1079147120 11:17862780-17862802 GAAGGACAGAGCAGGCTCATGGG + Intronic
1079354470 11:19718478-19718500 AAAGCATAGAGGAGGCCCCTGGG + Intronic
1080260673 11:30346579-30346601 AGAGGAAAGAGCATGGACCTAGG + Intergenic
1085980691 11:81720217-81720239 AAAGGATAGGCCAGGCACAGTGG + Intergenic
1086553745 11:88085069-88085091 AAAGGTTAGAGCACACCCCTAGG + Intergenic
1090394913 11:126412552-126412574 AAAGGAGAGGGCAGCCACCATGG + Intronic
1092902066 12:13069196-13069218 AAAGGATAGAGCATGTTCCAAGG + Intronic
1096650163 12:53058634-53058656 AAAGGTAAGAGCAGGGACATGGG + Exonic
1098348018 12:69526142-69526164 AAAGGATGGGCCAGGCACCATGG - Intronic
1098632607 12:72742115-72742137 AAAGGAGAAAGCAAGCAACTTGG + Intergenic
1098759542 12:74405658-74405680 AAATCACAGAGCAGGCCCCTAGG + Intergenic
1099520140 12:83650242-83650264 ATAGGATGGATCAGCCACCTGGG - Intergenic
1104209847 12:126678237-126678259 ACAGGTTATGGCAGGCACCTGGG - Intergenic
1105779119 13:23690907-23690929 AAAGAACAGAGTAGCCACCTGGG + Intergenic
1105779547 13:23695081-23695103 TAAGGAAAGGGCAGGCCCCTAGG + Intergenic
1106160291 13:27195324-27195346 AAAGGAAAGGGAAGGCACTTGGG + Intergenic
1106302073 13:28476536-28476558 AAAGGAAAAAGCAGGTTCCTAGG - Intronic
1107409773 13:40147883-40147905 AGAGGTGAGAGCAGGCACATTGG - Intergenic
1107986995 13:45784221-45784243 AAAGGACAGAGTGGGCGCCTTGG + Intronic
1108830873 13:54476630-54476652 AAAAGACAGAGCAGGCAATTAGG + Intergenic
1111669864 13:91316984-91317006 AAAAGACAGTACAGGCACCTTGG - Intergenic
1112477047 13:99740920-99740942 AAGGGATGGTGCAGGGACCTGGG + Intronic
1113423247 13:110186320-110186342 GGAGGTTAGGGCAGGCACCTCGG - Intronic
1114721826 14:24890843-24890865 AAAGGATAGAGCAATCAGCTGGG - Intronic
1117432663 14:55684778-55684800 AAAGGACAGAGCAAGCATTTAGG + Intronic
1118223753 14:63879517-63879539 ATAGGATACACCAGCCACCTGGG - Intronic
1119936558 14:78597516-78597538 AAAGAATATAGCAAGGACCTTGG + Intronic
1120840954 14:89084346-89084368 TAGGGAGAGAGCAGGCACCAAGG + Intergenic
1123060576 14:105592438-105592460 ACAGGGTAGAGCAGGCACCTTGG - Intergenic
1123085054 14:105713409-105713431 ACAGGGTAGAGCAGGCACCTTGG - Intergenic
1123780395 15:23621181-23621203 CAAGGAGAGGGCAGGCACCCTGG - Intronic
1124086655 15:26557244-26557266 AAAGGAAACAGCAGACACCAGGG + Intronic
1124809369 15:32919289-32919311 AAATGGTAGAGCAGACACTTTGG + Intronic
1125502101 15:40246224-40246246 AAAGGGTAGGGGAGGCACCTGGG + Intronic
1125518645 15:40336483-40336505 CAGGGATGGAGCTGGCACCTGGG + Intronic
1126047024 15:44651398-44651420 AAAGGCAAGAGCAGGCACTGAGG + Intronic
1128777886 15:70337558-70337580 AAAGGCCAGAGCAGGACCCTGGG - Intergenic
1129212652 15:74079307-74079329 AACGTACAGAGCAGGCACGTGGG - Intronic
1129826315 15:78637335-78637357 AAAGCATAGAGGGGGCAGCTTGG + Intronic
1131084420 15:89564489-89564511 AAAAGATAGACCAGGCACAGTGG - Intergenic
1132918808 16:2371231-2371253 ACAGGATAGTGCAGAAACCTAGG - Intergenic
1133157941 16:3889116-3889138 AAGGGATAGGGCAGCAACCTAGG + Intergenic
1133166608 16:3952497-3952519 AAATGATATAAAAGGCACCTGGG - Intergenic
1133855806 16:9548219-9548241 AAAGGAGTGAGCATGGACCTGGG - Intergenic
1135200016 16:20429298-20429320 AAAAGATAGGCCAGGCACCATGG - Intronic
1135218683 16:20594310-20594332 AAAAGATAGGCCAGGCACCATGG + Intergenic
1135542313 16:23340233-23340255 AAATGAGAGAGCAAGCTCCTGGG - Intronic
1135687774 16:24512020-24512042 AGACGCTAGAGCAGGCACCAGGG - Intergenic
1136048925 16:27637030-27637052 AAATGAGAGCGCAGGCACCAAGG - Intronic
1136247564 16:28984545-28984567 AAAGACGAGAGCAGGCACCTGGG - Intronic
1136657047 16:31715804-31715826 AAAAGATAGCACAGGGACCTGGG + Intronic
1137005409 16:35270911-35270933 AAAGGATATAGCGGGCAGCAGGG + Intergenic
1137629218 16:49930516-49930538 GCAGCATAGAGCAGGCACATGGG + Intergenic
1139568068 16:67792265-67792287 ATAGGCTAGACCAGGCACCGTGG + Intronic
1139964995 16:70740499-70740521 AAAGGACAGAGGAGGCCTCTGGG - Intronic
1141093949 16:81149497-81149519 AAAGGATACAGCTGGCACGGTGG - Intergenic
1141245305 16:82301738-82301760 AAAGGACATAGCGGGCTCCTTGG - Intergenic
1141595411 16:85094375-85094397 AACAGATAGAGCAGCCACGTTGG + Intergenic
1142299887 16:89250548-89250570 AATGTAAAGAGCAGCCACCTCGG - Intergenic
1142751996 17:1994499-1994521 AGGGGATGGAGCAGGCCCCTTGG - Intronic
1143331804 17:6142634-6142656 AAGAAATACAGCAGGCACCTTGG - Intergenic
1145272150 17:21410442-21410464 CGAGGCTGGAGCAGGCACCTTGG + Intronic
1145310357 17:21697907-21697929 CGAGGCTGGAGCAGGCACCTTGG + Intronic
1145400142 17:22525065-22525087 ATAGGATAGAGTAGACAGCTAGG - Intergenic
1151952496 17:77362946-77362968 ACAGGATAGGGCAGGCACAGAGG + Intronic
1152709363 17:81862920-81862942 AATGGAGAGGGCAGGCACCTGGG - Intergenic
1152766056 17:82139745-82139767 AAAGGACTGGGCAGGCACCATGG + Intronic
1152984757 18:311489-311511 AAAGGATAGTGCAGGATCTTTGG + Intergenic
1153705366 18:7739603-7739625 AGTGGATACAGCAGGCACCTTGG + Intronic
1157633034 18:49119505-49119527 AATGGAAAGAGCAAGCACATGGG + Intronic
1158887291 18:61840377-61840399 AAAAGATAGACCAGGATCCTAGG - Intronic
1159018481 18:63122594-63122616 AAAGGATGGAGTATGGACCTTGG + Intergenic
1160122260 18:76141241-76141263 GAAGGATGGGGGAGGCACCTTGG + Intergenic
1160220392 18:76973056-76973078 AAAGCAGAGAGCAGGAATCTGGG - Intergenic
1162148666 19:8629679-8629701 AAAGGATAGGCCAGGCACGGTGG + Intergenic
1162541675 19:11300313-11300335 ACAGCATAGAACATGCACCTAGG + Intronic
1166407166 19:42529295-42529317 AAGGGACAGAGCAGGTACATGGG + Intronic
1167849994 19:52194133-52194155 AGGGAATAGAGCAAGCACCTGGG + Intronic
927494518 2:23543649-23543671 AACCGATGGAGCAGGCTCCTAGG - Intronic
929410660 2:41694855-41694877 AAAAGACAGAGCAGTCACATGGG + Intergenic
929802083 2:45112798-45112820 CATGGACAGAGCTGGCACCTTGG + Intergenic
930873681 2:56191148-56191170 AAACATTTGAGCAGGCACCTGGG - Intronic
935211931 2:100945822-100945844 AAAGGGTAGAGGAGACTCCTGGG - Intronic
935745073 2:106183215-106183237 AAAGACTTGAGCAGGCAGCTGGG - Intronic
936543325 2:113369696-113369718 AAAGAAGAGAGCAAGCAACTTGG - Intergenic
936891404 2:117373982-117374004 AAAGGAGAGAGCAGTCACAGAGG + Intergenic
938161536 2:128988785-128988807 AGAGGCAAGAGCAGGCACCAAGG - Intergenic
939387378 2:141518190-141518212 AAAGGAAAGAGCAGAGAGCTCGG + Intronic
945585688 2:211659484-211659506 AGAAGATAGAGCAGGAACTTAGG - Intronic
945943508 2:215972635-215972657 AAAGGATAGAGGAAGCATTTTGG + Intronic
947636785 2:231684328-231684350 AACGGACAGAGCAGGGCCCTGGG - Intergenic
948173884 2:235928347-235928369 ACAGGACAGTGCAGGCACCAGGG + Intronic
948280071 2:236740320-236740342 AAAGGATGGAGCAGTGACCGAGG + Intergenic
948770842 2:240250639-240250661 TGAGGACAGAGAAGGCACCTGGG + Intergenic
1168919641 20:1520613-1520635 AAAGGACAGTACAGGCCCCTGGG + Intergenic
1169287546 20:4322179-4322201 AAAAGAAAGGGCAGGCACCCTGG - Intergenic
1169300783 20:4440440-4440462 AAGTGATAGAGCAAGCACCTAGG + Intergenic
1169317981 20:4609093-4609115 CAAGGATAGTGCTGGCCCCTTGG + Intergenic
1169826154 20:9770975-9770997 AAAGGACAGAGGAGACTCCTGGG + Intronic
1170457995 20:16551427-16551449 AAAGGAGAGAGAAAGCGCCTCGG - Intronic
1171062314 20:21977809-21977831 GAAGGGCAGAGCAGGCCCCTGGG - Intergenic
1173123363 20:40314518-40314540 AAAGGATAGAGCATTTTCCTAGG + Intergenic
1173240974 20:41296982-41297004 AAGGGATAGTGCAGGAACCAGGG - Intronic
1173608722 20:44351074-44351096 AAGGCATAGAACTGGCACCTTGG + Exonic
1174147076 20:48459450-48459472 ACAGGGTAGAGCAGGCACGTGGG + Intergenic
1178220628 21:30654190-30654212 CAAAGATAGAGAAGGCACTTTGG + Intergenic
1179303635 21:40135342-40135364 ATAGCATAGCGCTGGCACCTAGG - Intronic
1179440437 21:41389833-41389855 CAAGGAAAAAGCTGGCACCTTGG - Intronic
1180072122 21:45441816-45441838 AAAGGATGGAGCACGCTGCTGGG + Intronic
1181688209 22:24543560-24543582 AAAGGGTAAGGCAGGGACCTGGG + Intronic
1181691816 22:24567022-24567044 AAGGAAAAGAGCAGGCACTTGGG - Intronic
1182246861 22:28965039-28965061 AAAGGATAGAGCTGGTTCCCAGG + Intronic
1184410293 22:44322370-44322392 AAGGGGTAGAGGGGGCACCTGGG - Intergenic
1185140131 22:49095472-49095494 GAAGGGCAGGGCAGGCACCTCGG + Intergenic
949786464 3:7746993-7747015 AAGGGAAAGAGAAGGCACATAGG - Intergenic
950104102 3:10377459-10377481 AAAGGATCGAGCAGCCAGGTGGG + Intronic
952359321 3:32614019-32614041 AAAGGATAGAGCAGGGGCAGAGG + Intergenic
953091873 3:39735973-39735995 AAAGGAGAGAGCTGGCAACTTGG - Intergenic
953328822 3:42035026-42035048 AAAGGAGAAAGAAGGCACTTTGG - Intronic
957561646 3:81829538-81829560 AAAGGATAGAGGAAGCATTTTGG + Intergenic
957728308 3:84097295-84097317 AAAGGAAAGAGCAGACATATGGG + Intergenic
957946580 3:87070735-87070757 AAAGGACTGACCAGTCACCTAGG + Intergenic
960053564 3:113260318-113260340 AAAGGATAAAGCAGGGACTCAGG + Intronic
960758628 3:121048442-121048464 TAAGGAGAGAGCAAGCAACTTGG - Intronic
961228022 3:125271506-125271528 AAAGGGTAGATCAAGCACCAAGG - Intronic
961791479 3:129379718-129379740 GCAGGAAAGAGCAGTCACCTGGG - Intergenic
963991360 3:151659613-151659635 AAATCATAGAGCAGGCACCAGGG - Intergenic
966887588 3:184385317-184385339 AAAGCAGAGAGCAGGCAGCCTGG + Intronic
968982641 4:3858760-3858782 ATAGCATACAGCAGGCACCCAGG - Intergenic
969155454 4:5205887-5205909 AAAGGTTAGGGCAGGATCCTGGG + Intronic
970921816 4:21403449-21403471 AAAGGATAGATCTGGCCTCTTGG - Intronic
971493053 4:27234693-27234715 AGATGATAGAGCAGGAAGCTAGG + Intergenic
972354468 4:38267504-38267526 CATGGACAGAGCAGGAACCTGGG + Intergenic
972723787 4:41727794-41727816 AAAATATAAAGCAGCCACCTCGG - Intergenic
973053350 4:45622676-45622698 AAAAGCTAGTGCAAGCACCTTGG - Intergenic
975202123 4:71603526-71603548 ATAGTATAAAGCATGCACCTTGG - Intergenic
976015188 4:80543735-80543757 AAAGGAGAGAGCAAGTAACTTGG + Intronic
977867691 4:102049582-102049604 AAAGGGTAGTGTAGGCAGCTAGG + Intronic
978131914 4:105208807-105208829 AAAGGAAACAGCAGGAAACTTGG + Intronic
981226875 4:142306903-142306925 AAAGGATAGGAAAGGCAACTCGG + Intronic
984855947 4:184196273-184196295 ACAGGATAGAACAGGCACAGGGG - Intronic
985200389 4:187478658-187478680 CAAGGATAGAGCAAGCACAGAGG + Intergenic
985634370 5:1028664-1028686 ACAGGCTAGAGGAGGCGCCTAGG + Intronic
986226025 5:5813472-5813494 AGAGCAAAGAGTAGGCACCTGGG + Intergenic
989331876 5:40269299-40269321 ACAGAATATAGCAGGCATCTGGG - Intergenic
994006284 5:94841073-94841095 AAAGCATAGAGCTGGCTGCTTGG + Intronic
996634968 5:125678317-125678339 AAATCATAGTGCAGACACCTAGG + Intergenic
998549483 5:143063656-143063678 AAAGGATGGAGCAGGGAGGTGGG - Intronic
999891473 5:155982595-155982617 AAATGACAGAGCAGGCACTCTGG - Intronic
1001236030 5:170030363-170030385 AAAGGATGGAGCAGGCACAGGGG - Intronic
1001311123 5:170611715-170611737 AGAGGAAAGAGCAGGAACTTTGG + Intronic
1001372404 5:171218852-171218874 AAAGGACACAGAAGGCAACTTGG - Intronic
1001655280 5:173344492-173344514 AAAGGTTAGGCCAGGCACCGTGG - Intergenic
1003553453 6:7119671-7119693 AAGGGCTAGAGCAGGCTGCTAGG + Intronic
1003860990 6:10321614-10321636 AAAGGATAGGCCAGGCACGGTGG + Intergenic
1004565656 6:16794511-16794533 AAAGGATAGGCCAGGCACGGTGG + Intergenic
1006290765 6:33134632-33134654 GAAGGATAAGGCAGCCACCTTGG + Intergenic
1007969327 6:46034810-46034832 AGAGGCTAGAGCAGGCATGTAGG + Intronic
1008486693 6:52043673-52043695 ACTGGAAAGAGCAGGAACCTGGG + Exonic
1011185347 6:84669388-84669410 AAATGATTGTGCAGGCAACTTGG - Intergenic
1014638587 6:123880186-123880208 AAAGGATAAAGCAGGAAAGTAGG + Intronic
1014946869 6:127509299-127509321 AGAGGATGGAGTAGGCACCTGGG - Intronic
1015351123 6:132221295-132221317 GAAGGACAGAGTCGGCACCTGGG - Intergenic
1016910284 6:149192313-149192335 AAAGGAAGGAGCAGCTACCTAGG + Intergenic
1017305503 6:152913911-152913933 GAAGGAAAGAGCAAGCAACTTGG - Intergenic
1021676731 7:23087716-23087738 AAAGGATAGAGAAAGCATTTTGG - Intergenic
1022036038 7:26535653-26535675 AAGCGATAGAGCTGGCTCCTAGG + Exonic
1022176316 7:27874941-27874963 AAGGGATAGAGCCTGGACCTCGG - Intronic
1022358762 7:29640007-29640029 AAAGGACACAGCAGGCAGCAGGG + Intergenic
1023713569 7:43020350-43020372 AAAGGAAATTCCAGGCACCTAGG - Intergenic
1024087861 7:45911536-45911558 AAATGAGAAAGCAGGCCCCTTGG - Intergenic
1024896538 7:54267662-54267684 AAATGATAGAGCACTGACCTAGG - Intergenic
1026216412 7:68353325-68353347 AAAGGATCTTGGAGGCACCTGGG - Intergenic
1026396961 7:69965148-69965170 AAAGGATAGAAAAAGCAACTCGG - Intronic
1026545327 7:71317146-71317168 AAAAGAAACAGCAGGCACGTTGG - Intronic
1026870041 7:73845256-73845278 CAAGGCTAGAACAGGCTCCTGGG - Intergenic
1028112681 7:86961577-86961599 AGAGGATAGAGCAGTTTCCTGGG - Intronic
1028518797 7:91706662-91706684 ACAGGAGTGAGCAGGCAGCTTGG + Intronic
1028980072 7:96958190-96958212 AAAGGTTAGTGCAGGCAGGTGGG + Intergenic
1029477213 7:100792181-100792203 AAAGACCAGAGCAGGCACCTGGG - Intronic
1031467547 7:122131881-122131903 AAAGGACAGAGAAGCCCCCTTGG + Intronic
1031579331 7:123451857-123451879 AAAGAATAGTGCAGGAACCCAGG - Intergenic
1032206577 7:129871046-129871068 AATGGATAGAATAGGTACCTTGG - Intronic
1032499732 7:132391456-132391478 AAGGGATAGTGCAGGATCCTGGG + Intronic
1033497774 7:141916869-141916891 AAATGAGAGAGCAGGGACTTGGG - Intronic
1034490946 7:151392739-151392761 GAAGGAGCTAGCAGGCACCTAGG - Intronic
1035690792 8:1558062-1558084 GCAGGTTGGAGCAGGCACCTTGG + Intronic
1039785844 8:40833600-40833622 AAAGGGAACAGCAGGCAGCTAGG + Intronic
1040060533 8:43099774-43099796 ATAGGAGAGTGCAGGAACCTGGG + Intronic
1040419985 8:47230164-47230186 GAAGGATATAGCAGGCAGTTAGG + Intergenic
1041715765 8:60930654-60930676 AAAGGAAACAGCAGACACCAGGG - Intergenic
1042961274 8:74306244-74306266 GCAGGACAGAGCTGGCACCTAGG + Intronic
1045269255 8:100648448-100648470 AAAGTATAGGCCAGGCACCGTGG - Intronic
1046496837 8:115024962-115024984 AAGGGATAGAGCAGGACCCAAGG - Intergenic
1046699216 8:117381296-117381318 ACAGGATAGAGCAAGCAACATGG + Intergenic
1047681591 8:127259179-127259201 ATTGGATAGAGCAGGGACCCTGG + Intergenic
1047777385 8:128084199-128084221 TAAGGACAGAGAAGGCACTTAGG - Intergenic
1047978598 8:130156770-130156792 AGATGAGTGAGCAGGCACCTGGG + Intronic
1048028027 8:130604701-130604723 AAAGGATGGAAAAGGCACCTGGG - Intergenic
1048310412 8:133318285-133318307 GAAGGATACAGCAGCTACCTGGG + Intergenic
1048943542 8:139423860-139423882 AAGGGATAGTGCAGTCCCCTTGG - Intergenic
1051172535 9:14333034-14333056 ACAGGATAGAGCAGCCTCCAAGG + Intronic
1051219097 9:14830011-14830033 AGAGGAGAGAACAGGTACCTGGG + Intronic
1053475696 9:38380709-38380731 AAAGCACAGAACAGGCGCCTGGG + Intergenic
1056893082 9:90514185-90514207 AGAGGGTAGAGAAGGCACGTGGG + Intergenic
1057804032 9:98208139-98208161 AAAGGAGAGAGCAGGGACGAGGG + Intronic
1058503430 9:105646068-105646090 CAAGGATAGAGCAGGGATTTAGG + Intergenic
1060006152 9:120001645-120001667 AAAAGAAAGAGCAGTCACGTTGG + Intergenic
1060878959 9:127104376-127104398 AAAGGATAGAGCAGGCACCTGGG - Intronic
1061729774 9:132604827-132604849 CAAGGCCAGAGCAGGCACCCAGG - Intronic
1062287658 9:135780224-135780246 AGAGCAGGGAGCAGGCACCTTGG + Intronic
1187219392 X:17308887-17308909 GAAGGATAGAGCATGCATCTTGG - Intergenic
1192212470 X:69136753-69136775 AAAGCCGAGAGCAGGCGCCTGGG - Intergenic
1192221837 X:69202744-69202766 CAAGGGTGGAGAAGGCACCTGGG - Intergenic
1192222616 X:69207548-69207570 AAAGGAAAGGCCAGGAACCTGGG + Intergenic
1193998418 X:88395430-88395452 AAAGCATGGAGAAGGAACCTGGG - Intergenic
1194398215 X:93412294-93412316 AGAGAATAGAGCAGGCCCATTGG + Intergenic
1196014213 X:110920161-110920183 AGAGGATAGAGGAGGACCCTGGG - Intergenic
1197041695 X:121944096-121944118 AAAGAATAGAGGTGGCAGCTTGG + Intergenic
1198564102 X:137885571-137885593 TAAGGATGGTGCAGGCACCTTGG + Intergenic
1199890623 X:152075728-152075750 AGAGGATAGAGTTGGCAGCTTGG - Intergenic
1200143878 X:153915887-153915909 AAAGGATATAGCAGGGATTTTGG + Intronic
1200144023 X:153916709-153916731 AAAGGATATAGCAGGGATTTTGG + Intronic
1200326184 X:155242132-155242154 AAAGGACATAGGAGTCACCTTGG + Intergenic
1201144888 Y:11058929-11058951 AATGGCCAGAGCAGGCATCTGGG + Intergenic