ID: 1060878960

View in Genome Browser
Species Human (GRCh38)
Location 9:127104377-127104399
Sequence CAAAGGATAGAGCAGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878960_1060878963 -1 Left 1060878960 9:127104377-127104399 CCAGGTGCCTGCTCTATCCTTTG 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878960_1060878970 28 Left 1060878960 9:127104377-127104399 CCAGGTGCCTGCTCTATCCTTTG 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1060878970 9:127104428-127104450 CCTCTTCTAATAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878960 Original CRISPR CAAAGGATAGAGCAGGCACC TGG (reversed) Intronic
900583265 1:3419700-3419722 CACATGATAGTGCAGGCACTGGG + Intronic
900615853 1:3565379-3565401 GAGAGGCCAGAGCAGGCACCAGG - Intronic
900942309 1:5807707-5807729 CTAAGGGAAGAGCAGACACCTGG + Intergenic
903141153 1:21339890-21339912 CCAAGGAAAGGGCAGGCCCCAGG + Intronic
904500987 1:30912804-30912826 CGAAGTAGAGAGCAAGCACCTGG - Intergenic
904790582 1:33017402-33017424 GAAAGGAGAGAGCAGGCTGCTGG + Intronic
904932734 1:34102848-34102870 CAACAAATAAAGCAGGCACCAGG - Intronic
907453111 1:54559930-54559952 CACAGGACAGAGCAGGCATAAGG - Intronic
907592574 1:55689879-55689901 CAGAAGCCAGAGCAGGCACCAGG - Intergenic
909054936 1:70809461-70809483 CAAAGGATCCAGCAGGCATCTGG - Intergenic
910655824 1:89616984-89617006 GAAAGGAAAGAGAAGGCACAAGG - Intergenic
910916986 1:92299393-92299415 CAAAGGACAGTGGAGGCCCCGGG + Intronic
912565344 1:110583743-110583765 GGTAAGATAGAGCAGGCACCAGG + Intergenic
912842833 1:113053729-113053751 GAAAGGATATAGCAGGCAAAGGG + Intergenic
913700827 1:121373013-121373035 CACAGAGTAGAGCAGGCACTAGG + Intronic
914041377 1:144053480-144053502 CACAGAGTAGAGCAGGCACTAGG + Intergenic
914136708 1:144907010-144907032 CACAGAGTAGAGCAGGCACTAGG - Intronic
915196499 1:154193789-154193811 GAAAGAATAGAGCAGACACCAGG + Intronic
917039442 1:170788118-170788140 GAAAGGAAACAGCAGACACCAGG + Intergenic
917123798 1:171668032-171668054 GAAGGGAAGGAGCAGGCACCAGG + Intergenic
918649891 1:186948917-186948939 CAAAGGATAGAGTAGTCACCAGG - Intronic
919961545 1:202475141-202475163 CAATAGAAAGAACAGGCACCTGG - Intronic
920488245 1:206391749-206391771 CACAGAGTAGAGCAGGCACTAGG + Intronic
920828616 1:209445838-209445860 CAAGGGACACAGCAGGCACCTGG - Intergenic
921429769 1:215052023-215052045 CATGGGCTAGAGCAGCCACCTGG - Intronic
922738755 1:228004342-228004364 CAAGGCATAGGGCAGGCTCCTGG - Intergenic
922891845 1:229067745-229067767 CAAGGCACAGAGCAGGCACGAGG - Intergenic
922952869 1:229573839-229573861 CAAAACATTGAGCATGCACCTGG - Intergenic
923107207 1:230863849-230863871 CCATGGATACAGCAGGCACAAGG + Intronic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1063436497 10:6036293-6036315 GAAAGGAGAGAGCAGGTGCCTGG - Intronic
1064726222 10:18282412-18282434 CAAAAGATAGACCAGTCACCTGG + Intronic
1065464924 10:26009434-26009456 CAAATGAGAGAGCAGGCCCAAGG + Intronic
1067184764 10:44017144-44017166 CAAAGCATAGAGCAAACAACAGG - Intergenic
1067690521 10:48498557-48498579 CAAAGGATAGGGCAGGGGGCCGG - Intronic
1071480421 10:86061070-86061092 AGAAGGATAGTGGAGGCACCAGG - Intronic
1071523994 10:86347616-86347638 CACAGGAGAGAGCAGGGACAAGG + Intronic
1072431165 10:95372000-95372022 GGAAGGATAGAGCAGTCTCCAGG + Exonic
1073009297 10:100347305-100347327 TAAAGGCTAGAGCTGGCAACGGG - Exonic
1075906709 10:126088005-126088027 CAAAGGTTAGAAGAGGCAGCAGG - Intronic
1076250837 10:128982721-128982743 CAACAGAAACAGCAGGCACCTGG + Intergenic
1076985723 11:234784-234806 CTATGGATGGAGCAGGGACCAGG - Intronic
1077171000 11:1165665-1165687 CCAAGCACAGAGCAGGTACCCGG - Exonic
1077992295 11:7422827-7422849 CAAAGGAGAGTGCAGGGAGCAGG + Intronic
1079354469 11:19718477-19718499 GAAAGCATAGAGGAGGCCCCTGG + Intronic
1079745522 11:24124060-24124082 CAAAGGAAACAGAATGCACCTGG + Intergenic
1080580535 11:33639313-33639335 CATTGGATAGAGGAAGCACCTGG - Intronic
1080708902 11:34726920-34726942 AAAAGGAAAGAATAGGCACCAGG + Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1085210822 11:74776723-74776745 CAAAGGAGAGAGCAGTGAACAGG + Intronic
1086085169 11:82945971-82945993 CCAAGATTTGAGCAGGCACCAGG + Intronic
1088098887 11:106132187-106132209 CAAAGAATGGAGCAGGCCGCAGG - Intergenic
1088177820 11:107073977-107073999 CAAAGGTTTGAGCAGGCATGGGG + Intergenic
1090914680 11:131152812-131152834 CAAAGGAAACTCCAGGCACCTGG - Intergenic
1091274973 11:134343948-134343970 CAAGGGATGGAGCAGGCTCATGG - Intronic
1091781813 12:3218649-3218671 GAAAGGAAGGAGAAGGCACCAGG + Intronic
1094447922 12:30552252-30552274 CTGGGGACAGAGCAGGCACCAGG + Intergenic
1095120886 12:38417278-38417300 CACAGGACAGAGCAGTGACCAGG - Intergenic
1096109078 12:49018591-49018613 CACGGGATAGGGCAGACACCCGG + Intronic
1096650162 12:53058633-53058655 CAAAGGTAAGAGCAGGGACATGG + Exonic
1096807391 12:54148949-54148971 CAAAGGGTAGGGCAGGGGCCGGG - Intergenic
1097441707 12:59615902-59615924 CAAGTGATGGAGCAGGAACCAGG - Intronic
1098508610 12:71284655-71284677 CAAGGGATAGTGCAGGAACCAGG - Intronic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101446276 12:104738935-104738957 CCAAGGATGGAGCTGCCACCAGG + Intronic
1104992621 12:132634692-132634714 CAGAGGAGAGAACAGTCACCGGG - Intronic
1106129385 13:26926899-26926921 CAAAGAGTACAGCAGCCACCTGG + Intergenic
1108594560 13:51938201-51938223 CCCAGGACAGAGCAGGCAGCAGG - Intronic
1108693555 13:52882055-52882077 CAAGGGATAGTGCAGTCCCCAGG - Intergenic
1109000087 13:56789402-56789424 CAAAAGATATAGCTGGCAACAGG + Intergenic
1109459497 13:62637269-62637291 CAAATGTTGGAGCAGACACCTGG - Intergenic
1110415373 13:75246499-75246521 CAAAGGAACGATCAGGCAGCAGG - Intergenic
1111091849 13:83457060-83457082 CAAAGGAAAGAACAGACACTGGG - Intergenic
1112477046 13:99740919-99740941 CAAGGGATGGTGCAGGGACCTGG + Intronic
1112829178 13:103427753-103427775 TAACAGGTAGAGCAGGCACCAGG - Intergenic
1112957631 13:105080789-105080811 CAAAGAAGGGAACAGGCACCAGG - Intergenic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1114721827 14:24890844-24890866 TAAAGGATAGAGCAATCAGCTGG - Intronic
1116397197 14:44461128-44461150 CAAAAGTTAGAGCACCCACCTGG - Intergenic
1116485023 14:45437262-45437284 CAGAGGATGGCCCAGGCACCAGG + Intergenic
1118223754 14:63879518-63879540 CATAGGATACACCAGCCACCTGG - Intronic
1121957286 14:98226082-98226104 CAAAGCCTAGAGCAGGGACTTGG + Intergenic
1122918812 14:104871215-104871237 CCGAGGACAGAGCAGGCTCCAGG - Intronic
1124086654 15:26557243-26557265 AAAAGGAAACAGCAGACACCAGG + Intronic
1125502100 15:40246223-40246245 CAAAGGGTAGGGGAGGCACCTGG + Intronic
1125518644 15:40336482-40336504 CCAGGGATGGAGCTGGCACCTGG + Intronic
1126643290 15:50850215-50850237 CAAAGGATAGTGCAATAACCTGG + Intergenic
1127286974 15:57541037-57541059 TGAAGGGTAGAGGAGGCACCAGG + Intronic
1128777887 15:70337559-70337581 CAAAGGCCAGAGCAGGACCCTGG - Intergenic
1133166609 16:3952498-3952520 CAAATGATATAAAAGGCACCTGG - Intergenic
1134714529 16:16350375-16350397 AAGGGGATAGAGCAGGCACTCGG - Intergenic
1134722404 16:16393739-16393761 AAGGGGATAGAGCAGGCACTCGG - Exonic
1134945023 16:18318130-18318152 AAGGGGATAGAGCAGGCACTCGG + Exonic
1134952287 16:18358283-18358305 AAGGGGATAGAGCAGGCACTCGG + Intergenic
1135687775 16:24512021-24512043 AAGACGCTAGAGCAGGCACCAGG - Intergenic
1135993839 16:27233761-27233783 CAAAGGATTCAGTGGGCACCTGG + Intronic
1136247565 16:28984546-28984568 GAAAGACGAGAGCAGGCACCTGG - Intronic
1136534106 16:30889064-30889086 GAGAGGAGAGAGCAGGAACCTGG + Intronic
1137005408 16:35270910-35270932 GAAAGGATATAGCGGGCAGCAGG + Intergenic
1137574302 16:49588395-49588417 CAAAGGACAGAGCTCTCACCAGG + Intronic
1137749009 16:50844822-50844844 CAAAGGAGAGAGCTGGGAACGGG - Intergenic
1138293233 16:55866052-55866074 CCCAGGACAGAGCAGCCACCTGG + Exonic
1139964996 16:70740500-70740522 CAAAGGACAGAGGAGGCCTCTGG - Intronic
1142249495 16:88984595-88984617 CCAAGGATATTCCAGGCACCCGG + Intergenic
1142891955 17:2949439-2949461 CAGGGCATAGAGCAGGCACTCGG - Intronic
1145184729 17:20784446-20784468 TAAAGGCTAGAGCTGGCAACGGG - Intergenic
1146945188 17:36868904-36868926 CTAAGGAGAGAGCAGGTCCCCGG - Intergenic
1147987427 17:44314693-44314715 CAGAGGATGCAGCAGGCCCCTGG - Intronic
1152130061 17:78471154-78471176 CGAAGGATGGAGCAGCCACTGGG - Intronic
1152421849 17:80197908-80197930 CAAAGGATGGAACAGGCAGTGGG + Intronic
1152709364 17:81862921-81862943 GAATGGAGAGGGCAGGCACCTGG - Intergenic
1156536193 18:37866932-37866954 TAAAGTATATAGCAGGCACTTGG - Intergenic
1157633033 18:49119504-49119526 CAATGGAAAGAGCAAGCACATGG + Intronic
1157683932 18:49627991-49628013 CAAAGGATAGGGCCAGGACCAGG - Intergenic
1161220051 19:3114232-3114254 GAAAGGTCTGAGCAGGCACCCGG + Intronic
1161420900 19:4175438-4175460 CACTGGATAGAGGAGACACCTGG + Intronic
1162331607 19:10033225-10033247 CAAAGAATAGAGCAACCACAGGG + Intergenic
1162793970 19:13077228-13077250 GAAAGGAGAGAGCAGGAGCCAGG - Intronic
1164552133 19:29220818-29220840 CAGAGGATAGAGGGGGCTCCAGG - Intergenic
1165747097 19:38236055-38236077 CAAAGGGGAGAGCAGAGACCAGG + Intergenic
1166848515 19:45745514-45745536 CAAAGGAGAGAGGAGAAACCGGG + Intronic
1167419771 19:49395910-49395932 CAAGGGATAGGGTAGGAACCAGG + Intronic
1167849993 19:52194132-52194154 CAGGGAATAGAGCAAGCACCTGG + Intronic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
925326194 2:3023810-3023832 CAAAAGATGGAGGAGGCAGCGGG + Intergenic
927703676 2:25283964-25283986 CAGAGCACACAGCAGGCACCCGG - Intronic
929013691 2:37473195-37473217 CAAAGGGTTGAGCAGGCAGAGGG - Intergenic
932735013 2:74248310-74248332 CAAATGCGAGAGCAGGCACTGGG + Intronic
935554100 2:104488377-104488399 CAGAGCATATAACAGGCACCTGG + Intergenic
939359475 2:141150004-141150026 CAAAGAATAGAATGGGCACCAGG + Intronic
945974134 2:216257766-216257788 CAAGGGATGGAGCAGACACAGGG + Intergenic
946734404 2:222740107-222740129 CAAGAGATGGGGCAGGCACCAGG + Intergenic
947310636 2:228798046-228798068 GAAAGGACAGAGCAGGAAGCTGG - Intergenic
947747529 2:232516647-232516669 GAAAGGAGACAGCCGGCACCTGG - Intergenic
947999979 2:234559848-234559870 CACAGGACACAGCAGGCACCTGG + Intergenic
948053236 2:234993464-234993486 CAAAGGAAAGAAGAGGCACTAGG + Intronic
948134350 2:235625151-235625173 AAGAGTCTAGAGCAGGCACCTGG - Intronic
948173883 2:235928346-235928368 CACAGGACAGTGCAGGCACCAGG + Intronic
948770841 2:240250638-240250660 CTGAGGACAGAGAAGGCACCTGG + Intergenic
1168919640 20:1520612-1520634 CAAAGGACAGTACAGGCCCCTGG + Intergenic
1169672314 20:8116004-8116026 CAAAGGCTAGGGCAGACAGCAGG + Intergenic
1169958453 20:11131911-11131933 CAAAGGAAAGAGGAGGAAACAGG - Intergenic
1173240975 20:41296983-41297005 TAAGGGATAGTGCAGGAACCAGG - Intronic
1174147075 20:48459449-48459471 AACAGGGTAGAGCAGGCACGTGG + Intergenic
1174258952 20:49279099-49279121 CACAGGTTAGAGCAGCCAGCGGG + Intergenic
1174759064 20:53188438-53188460 CAAAGTGAAGAGCAGGCTCCAGG - Intronic
1180695002 22:17746189-17746211 AGATGGAGAGAGCAGGCACCGGG + Intronic
1181507845 22:23373684-23373706 CCCAGGATAGAGCAGCCACCTGG + Intergenic
1181691817 22:24567023-24567045 CAAGGAAAAGAGCAGGCACTTGG - Intronic
1182427902 22:30284507-30284529 CGGAGGACAGAGCAGGCTCCAGG + Intergenic
1183018544 22:35009090-35009112 CAAAGGGTAGTGCAGACCCCAGG - Intergenic
1183025028 22:35058516-35058538 CCGAGATTAGAGCAGGCACCAGG + Intergenic
1184839062 22:47041960-47041982 CCAAGCACAGAGCAGGCATCAGG + Intronic
950104101 3:10377458-10377480 CAAAGGATCGAGCAGCCAGGTGG + Intronic
950113938 3:10438504-10438526 AAAGGGAGAGAGCAGGCAGCAGG - Intronic
950330131 3:12149559-12149581 CAAAGGAAAGTGCAGGCTCCCGG - Intronic
952337836 3:32420498-32420520 CAAAGGAGAATGCAGGCAGCAGG + Intronic
952886601 3:38016267-38016289 CAAAGGAGAGAGCCCTCACCAGG + Intronic
954799028 3:53176292-53176314 CAAAGCAGAGAGCAGGACCCAGG - Intronic
955241569 3:57182903-57182925 CCAAGATTGGAGCAGGCACCAGG + Intergenic
955415422 3:58686971-58686993 GAAAGGATGGAGGAGGCACCTGG + Intergenic
957633456 3:82748905-82748927 CAAAGAAGAGAACAGACACCAGG + Intergenic
958671701 3:97213778-97213800 GAAAGGATAGAGTAAGCACATGG - Intronic
959308771 3:104703207-104703229 CAAAAGAAAGAGCAGGCTTCAGG + Intergenic
959830574 3:110857059-110857081 CAAAGGATGGAGCTTGAACCTGG + Intergenic
961661592 3:128471578-128471600 CAAAGGGAACAGCATGCACCAGG + Intergenic
962701979 3:138009317-138009339 CAAAGGCCAGAGGAGGGACCAGG - Intronic
963308503 3:143681140-143681162 CAAAGAATAGTGCAGGCATCTGG - Intronic
963991361 3:151659614-151659636 TAAATCATAGAGCAGGCACCAGG - Intergenic
967159440 3:186722518-186722540 CAGAGGATAAACCAGCCACCTGG - Exonic
968195112 3:196700039-196700061 CAGTGGACAGAGCAGGCATCAGG - Intronic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968982745 4:3859430-3859452 CCAAGTATACAGCAGGCACCAGG - Intergenic
969523714 4:7693519-7693541 CAAAGGACAGTGCAGGGAGCAGG - Intronic
969538803 4:7773059-7773081 CAAACAACAGAGAAGGCACCTGG + Intronic
972354467 4:38267503-38267525 CCATGGACAGAGCAGGAACCTGG + Intergenic
972772733 4:42213030-42213052 TAAATGATAGACCACGCACCAGG + Intergenic
973657078 4:53059126-53059148 CAAGGGAGAGATCAGTCACCTGG - Intronic
977138553 4:93337911-93337933 CAAAGGGTGGAGCAGGGACTAGG - Intronic
977648267 4:99439149-99439171 TAAAATATAGAGCAGGCTCCTGG + Intergenic
978700655 4:111640768-111640790 CAAAGTCTAGAGCAGGCATCAGG + Intergenic
979191094 4:117859704-117859726 CAAAGGAAACAGCAGACACTGGG + Intergenic
981229785 4:142339171-142339193 CAAAGAATAGTGCAGTAACCTGG - Intronic
981320681 4:143387898-143387920 CAAAGTACAGCGCAGGCACAAGG - Intronic
982491686 4:156038386-156038408 CAAATGATAGAGAAGTCTCCTGG + Intergenic
984855948 4:184196274-184196296 TACAGGATAGAACAGGCACAGGG - Intronic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
985645669 5:1083664-1083686 CTAAGGCGAGAGCAGCCACCAGG + Intronic
989331877 5:40269300-40269322 CACAGAATATAGCAGGCATCTGG - Intergenic
991037684 5:62144417-62144439 CAAAGGAAAGCGCAGGCATTTGG + Intergenic
992789760 5:80202733-80202755 GAAAGCATAGAGCAGGCTTCAGG + Intronic
994432785 5:99690172-99690194 CATAGGAGAGAGCAGGCAAATGG + Intergenic
996856591 5:128014959-128014981 CAAAAAATAGCTCAGGCACCTGG + Intergenic
998443130 5:142178797-142178819 CAAGGAAGGGAGCAGGCACCAGG + Intergenic
1001236031 5:170030364-170030386 GAAAGGATGGAGCAGGCACAGGG - Intronic
1001428388 5:171640298-171640320 CCACTGATAGAGCAGCCACCAGG - Intergenic
1002341581 5:178519717-178519739 CACAGGACATAGCAGCCACCAGG + Intronic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1002755564 6:156369-156391 CAAACGAAAGAGCAGGATCCTGG + Intergenic
1004123140 6:12845359-12845381 CAAAAGAATGAGCAAGCACCTGG - Intronic
1005356280 6:24986609-24986631 GAAAGGATAGAGCACACAGCAGG - Intronic
1006921075 6:37627553-37627575 CAAAGGCTAGAGCTGGGACCAGG - Intergenic
1008416047 6:51241584-51241606 CAGAGGTCAGAGCAGGCACAGGG - Intergenic
1009477292 6:64108943-64108965 CAAAGGAGAAATCAGGCACCTGG + Intronic
1012288821 6:97425508-97425530 CAAAGGGAAGAGCAGGTGCCAGG - Intergenic
1012289760 6:97438375-97438397 CAAAGGATTGAACGGGCACAGGG + Intergenic
1013780724 6:113725934-113725956 CAAAAAATAGAGCAGGGGCCAGG - Intergenic
1014946870 6:127509300-127509322 GAGAGGATGGAGTAGGCACCTGG - Intronic
1016914153 6:149229171-149229193 CTAAGGATAGGGCAGGGAGCAGG + Intronic
1018446833 6:163866167-163866189 CAAAGCAGAGAACAGGCACTTGG + Intergenic
1019023576 6:168939699-168939721 GAGAGGACATAGCAGGCACCTGG - Intergenic
1022358761 7:29640006-29640028 GAAAGGACACAGCAGGCAGCAGG + Intergenic
1023119796 7:36897889-36897911 AGAAGGAAAAAGCAGGCACCTGG + Intronic
1024122421 7:46257986-46258008 CAAAGCAGAGAGGAGGAACCAGG - Intergenic
1026216413 7:68353326-68353348 CAAAGGATCTTGGAGGCACCTGG - Intergenic
1026870042 7:73845257-73845279 CCAAGGCTAGAACAGGCTCCTGG - Intergenic
1029307137 7:99628701-99628723 CAGGGGACTGAGCAGGCACCTGG + Intronic
1029375505 7:100174732-100174754 CAAAGGCTCGGGCAGCCACCAGG + Exonic
1029477214 7:100792182-100792204 GAAAGACCAGAGCAGGCACCTGG - Intronic
1030679100 7:112415589-112415611 CCACGGTTACAGCAGGCACCAGG - Intergenic
1031976046 7:128094262-128094284 CAAAGGTCAGATCAGTCACCAGG + Intergenic
1032495851 7:132361630-132361652 GAAAGGTTAGAGCAGGAACAGGG + Intronic
1032499731 7:132391455-132391477 CAAGGGATAGTGCAGGATCCTGG + Intronic
1033674034 7:143520021-143520043 CAATGGCTAGAGCAGGCAGCTGG + Intergenic
1035817778 8:2559906-2559928 CAGAGGACAGAGCATGCCCCTGG - Intergenic
1036134822 8:6151188-6151210 CAAAGGATTCAGGAGCCACCAGG + Intergenic
1036434323 8:8719363-8719385 CTAAGAATAGAGCAGGAGCCAGG + Intergenic
1038340224 8:26679827-26679849 CAAAGGACAGAGCAGTGCCCAGG - Intergenic
1039880613 8:41623234-41623256 AAAAGGATGGAGCAGTCGCCTGG - Exonic
1040696968 8:50011654-50011676 CAAAGGAAACAGAAGGAACCAGG - Intronic
1041357011 8:57012066-57012088 CAAAGGACAGAACAGACACTGGG - Intergenic
1041715766 8:60930655-60930677 AAAAGGAAACAGCAGACACCAGG - Intergenic
1042507703 8:69578533-69578555 CAATGGGAAGAGCCGGCACCGGG + Intronic
1048028028 8:130604702-130604724 AAAAGGATGGAAAAGGCACCTGG - Intergenic
1050673737 9:8028047-8028069 CCAAGGATAGCACTGGCACCTGG + Intergenic
1051219096 9:14830010-14830032 CAGAGGAGAGAACAGGTACCTGG + Intronic
1053475695 9:38380708-38380730 CAAAGCACAGAACAGGCGCCTGG + Intergenic
1054731723 9:68707493-68707515 ATAAGTACAGAGCAGGCACCTGG - Intronic
1055651673 9:78412202-78412224 CAAAGGAAATTCCAGGCACCTGG + Intergenic
1057246215 9:93456554-93456576 GAAAGGATCTAGCAAGCACCTGG - Intronic
1057796497 9:98161645-98161667 GAAAGGATAGAGCAGGTAAGAGG + Intronic
1057804031 9:98208138-98208160 CAAAGGAGAGAGCAGGGACGAGG + Intronic
1059515850 9:114894445-114894467 CAAAGGAATCAGCAGGCACCAGG + Intronic
1060878960 9:127104377-127104399 CAAAGGATAGAGCAGGCACCTGG - Intronic
1061533975 9:131236168-131236190 CAAAGCTGAAAGCAGGCACCAGG - Intergenic
1062530593 9:136997801-136997823 CAAAGGATGGGGCAGCCACATGG - Intergenic
1062549311 9:137078607-137078629 CAAAGGTCACAGCAGGCAGCAGG - Exonic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1186280951 X:7992518-7992540 CAGAGGACAGAGCTGGAACCAGG - Intergenic
1188619667 X:32204775-32204797 CAAAGGGGAGAGCAGGAAACAGG + Intronic
1189133915 X:38529493-38529515 CAAAGGGTGGGGCAGGAACCTGG + Intronic
1190233937 X:48601867-48601889 CAAAGGACAGAGCAAGGACACGG - Exonic
1192221838 X:69202745-69202767 CCAAGGGTGGAGAAGGCACCTGG - Intergenic
1195920544 X:109979018-109979040 GAAAGGATAGAGCTGCCATCAGG + Intergenic
1200421286 Y:2971487-2971509 CAAAGGATACAGCAGGTAGGGGG - Intronic
1201144887 Y:11058928-11058950 CAATGGCCAGAGCAGGCATCTGG + Intergenic
1202296702 Y:23366050-23366072 CAATAGAAAGAACAGGCACCTGG - Intergenic
1202574105 Y:26304547-26304569 CAATAGAAAGAACAGGCACCTGG + Intergenic