ID: 1060878961

View in Genome Browser
Species Human (GRCh38)
Location 9:127104384-127104406
Sequence TAAGAGGCAAAGGATAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878961_1060878973 30 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878973 9:127104437-127104459 ATAGCAGCAGCAGGATAGGTGGG No data
1060878961_1060878972 29 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878972 9:127104436-127104458 AATAGCAGCAGCAGGATAGGTGG No data
1060878961_1060878970 21 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878970 9:127104428-127104450 CCTCTTCTAATAGCAGCAGCAGG No data
1060878961_1060878971 26 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878971 9:127104433-127104455 TCTAATAGCAGCAGCAGGATAGG No data
1060878961_1060878963 -8 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878961 Original CRISPR TAAGAGGCAAAGGATAGAGC AGG (reversed) Intronic
900597556 1:3489442-3489464 GAAGAGGCAGAGGGTAGAGGTGG - Intergenic
900721744 1:4180637-4180659 TAATGGGCAAAGGATTGAACAGG - Intergenic
900873263 1:5321650-5321672 AAAGAGGCAGAGGATAAAGAAGG + Intergenic
901860421 1:12070769-12070791 AAACAAGCAAAGGATAGAACAGG + Intronic
902990962 1:20186593-20186615 TAAGAGGCAGAGGAGGGATCTGG - Intronic
903977378 1:27159693-27159715 AAAGAGGGAAAGGATGGGGCTGG + Intronic
904245713 1:29186520-29186542 TTAGGGGCTAGGGATAGAGCAGG - Intergenic
906343284 1:44999324-44999346 TAAAAGGCAAAGGACAGACTAGG + Intergenic
906679254 1:47714066-47714088 TTAGAGGCAGAGAATAGAGGAGG - Intergenic
907157035 1:52343996-52344018 TAAGAGGCAAAGGTTGCAGTGGG + Intronic
907850080 1:58247907-58247929 GAAGAGGCAAAGGAAGGAGTGGG - Intronic
908042872 1:60134005-60134027 GATCAGGCAAGGGATAGAGCTGG + Intergenic
908207966 1:61870409-61870431 TTATAGGCACAGGATAGAGCAGG + Intronic
909449907 1:75786246-75786268 TAACAGGGAAAGGAGAGAGCAGG - Exonic
910215381 1:84838757-84838779 TAAGGGCCAAAGGACACAGCCGG + Intronic
910403029 1:86855921-86855943 GGATAGGCAAGGGATAGAGCTGG + Intergenic
910944698 1:92577600-92577622 AAAGAGACAAATGATAGAACAGG - Intronic
912491926 1:110067156-110067178 GAAGAGGAAAGGGATAGAACTGG + Intronic
912842831 1:113053722-113053744 GAAGGGGGAAAGGATATAGCAGG + Intergenic
915732101 1:158061042-158061064 GAAGAGGTAGAGGACAGAGCAGG - Intronic
917033706 1:170722850-170722872 TAATAGGCAAAGGAAATATCCGG + Intronic
917045446 1:170854642-170854664 TTGGAGGGAAAGGAAAGAGCTGG + Intergenic
917269387 1:173256807-173256829 TAAGAGGTTAAAGATAGAGCAGG - Intergenic
917669636 1:177261078-177261100 TCAGAGACAAAGGACAGAACAGG + Intronic
918535508 1:185569979-185570001 TGAGAGGCCAAGGAGAGGGCTGG + Intergenic
919230915 1:194773103-194773125 AAAAAGGCAAAAGAAAGAGCTGG - Intergenic
919316998 1:195983643-195983665 TAACAGAGAAAGTATAGAGCTGG - Intergenic
919845543 1:201639930-201639952 CAACAGGGCAAGGATAGAGCAGG - Intronic
919984377 1:202662555-202662577 CAAGAGGCAACGGATGGAGCGGG + Intronic
920088963 1:203438648-203438670 TAAGAGGGAAAAGACAGAGAAGG + Intergenic
920223652 1:204422859-204422881 TAAAATGCCAAGGATAAAGCTGG - Exonic
920388287 1:205582953-205582975 GGAGAGGCATAGGATAGAGATGG - Intronic
920747799 1:208645256-208645278 TAAGGGGCAAAAGATAGGGAGGG - Intergenic
921016795 1:211199332-211199354 TAAGATGCAAAGGGTGGAGATGG + Intergenic
921867386 1:220100022-220100044 TCAAAGGCAAAGGATAGATTTGG - Intronic
921994931 1:221408037-221408059 AAAGAGTCACAGGATAGAGAAGG + Intergenic
923807364 1:237272292-237272314 ATAGAGGCAAAGGATAGAGAAGG + Intronic
1063248633 10:4249985-4250007 TAAGAGGCAAGGGAGAGGTCAGG - Intergenic
1063906923 10:10790314-10790336 CAAGGGGTAAAGGACAGAGCTGG - Intergenic
1064325907 10:14350998-14351020 TAATAGGCAAAAGAAAGAGAAGG + Intronic
1064480491 10:15735784-15735806 TGAGAAGCAAAGGATAAAGATGG - Intergenic
1064483014 10:15758403-15758425 TAATAGGCTAAGCATAGAACAGG - Intergenic
1064866947 10:19891374-19891396 AAAGAGGCAAAGGAAAGTGCAGG - Intronic
1067902671 10:50258422-50258444 TAAGAGGCTGAGGTTAGGGCAGG + Intergenic
1068104162 10:52592493-52592515 AAAGAGGCAATGAATAGAGTAGG - Intergenic
1068159366 10:53243996-53244018 TATTAGGCAAAGGAGAGAGAGGG - Intergenic
1068178114 10:53487703-53487725 TAATAGGCACAGGATGGCGCAGG + Intergenic
1068358600 10:55945275-55945297 TTATAGGCACAGGATAGGGCAGG + Intergenic
1069821866 10:71233454-71233476 GGAGAGGCAAAGGTGAGAGCTGG - Intronic
1069951093 10:72018689-72018711 TGTGAGGCAAAGGATAGGACAGG - Intergenic
1072223375 10:93346608-93346630 TAATATGTAAATGATAGAGCAGG - Intronic
1072267472 10:93744439-93744461 TCAGAGGCAAAGGAGGGAGGAGG + Intergenic
1072466142 10:95664100-95664122 TAAGAGGCACAGGATAAGGATGG + Exonic
1072830683 10:98655155-98655177 TAAGACGGAAAGGCTAGAGGGGG + Intronic
1072981851 10:100105108-100105130 TACGTGGCAAAGGAAAGATCAGG + Intergenic
1074276945 10:112012333-112012355 TAAAAGGAAATGAATAGAGCTGG + Intergenic
1075294039 10:121257443-121257465 AAACAGGCAAAGGATACAACAGG + Intergenic
1075978332 10:126716185-126716207 TAATAGGCAAAGAGAAGAGCAGG - Intergenic
1076333548 10:129690066-129690088 TAAGATCCAAAGGACAGAGGGGG - Intronic
1076349776 10:129808017-129808039 GAAGAGGGAAAGGAGAAAGCAGG - Intergenic
1077233027 11:1466990-1467012 TCAGAGGGAAAGGAAAGAACGGG - Intergenic
1077902029 11:6497413-6497435 TAACAGGCAAAGGAGGGGGCTGG - Intronic
1077956415 11:7024888-7024910 GAAGAGGAAAAAGATAGAGATGG + Intronic
1079310931 11:19365280-19365302 TAAGAGGAAAGTGATAGAGAAGG - Intronic
1079431792 11:20397026-20397048 AAAGGGGCAAAAGGTAGAGCTGG - Intronic
1080449218 11:32364887-32364909 TAACAGGGAAAGGATGGGGCAGG + Intergenic
1081240652 11:40702399-40702421 AAAGAAGCAAAGGAGAGAGGTGG - Intronic
1081764185 11:45597971-45597993 AAAGGGGCCAAGGGTAGAGCTGG + Intergenic
1081892600 11:46556633-46556655 TACCAGGAAAAGGATGGAGCTGG - Intronic
1083563289 11:63691823-63691845 AGAGAGGCAAAGGAGAAAGCAGG - Intronic
1083653116 11:64215481-64215503 TAAAAGGCAAAGCACAGAGGGGG - Intronic
1083690498 11:64405506-64405528 TAAGAGGCAGAGTCCAGAGCCGG + Intergenic
1085056377 11:73406503-73406525 TAGGAGGAAGGGGATAGAGCTGG + Exonic
1087044873 11:93836552-93836574 TAACAGGCAAACGAGGGAGCAGG - Intronic
1087735792 11:101831899-101831921 TAAAAGATAAAGGATTGAGCAGG + Intronic
1090845403 11:130525882-130525904 TCAGAGGCAATGAATTGAGCAGG + Intergenic
1091021768 11:132106277-132106299 CAAAAGGCAAAGGAAAGAGAGGG - Intronic
1093093487 12:14946705-14946727 TAAGATGCAAAGGAAAGCTCTGG - Intronic
1093994553 12:25627812-25627834 TAAAAGGCAAAGGATGGGCCGGG + Intronic
1095572548 12:43699731-43699753 TAAGAGGCTGCGGATAGAGAAGG - Intergenic
1096045173 12:48556011-48556033 TAAGAGGCCACAGATAGAGAAGG + Intergenic
1098011454 12:66057529-66057551 GAAAAGGCAAATGATAGAACTGG + Intergenic
1099108957 12:78532672-78532694 TAAGAGGCAAAAGATGAAGCAGG - Intergenic
1099493810 12:83319587-83319609 TAAGAAGCACAGAATAAAGCAGG + Intergenic
1101006506 12:100406179-100406201 TAAGAGGAGAAGAATTGAGCTGG - Intronic
1101731394 12:107429305-107429327 TCAGAGGCAAAAGATATAGTGGG - Intronic
1101737752 12:107475745-107475767 TAAGAGGTCAAGAATAAAGCTGG + Intronic
1102167318 12:110817023-110817045 TAAGAGGCAGAGGAGATAGAGGG + Intergenic
1103874297 12:124115399-124115421 AAAGAGACAAAAGAAAGAGCTGG + Intronic
1104313189 12:127673748-127673770 TAAAAGGCAAAGGAAGGAACAGG - Intergenic
1105243195 13:18625730-18625752 TAAGAGGCAGAGTCCAGAGCAGG - Intergenic
1106849962 13:33779664-33779686 TAACAGGCAGAGGATAGAGCAGG + Intergenic
1108955021 13:56142557-56142579 TTAGATGCAAGGGATAGAACAGG - Intergenic
1112738958 13:102452792-102452814 TAAGAGGCAAAGTTAAGAGTAGG + Intergenic
1112869596 13:103953763-103953785 CAAGAGGTAAAGGACACAGCTGG - Intergenic
1113212919 13:108003278-108003300 TAAGAGCCAAAGCCTAGAACTGG + Intergenic
1114482630 14:23045129-23045151 TGAGAGGCTCAGGATAGGGCTGG - Intergenic
1114614611 14:24061674-24061696 TGAGAGGCAAAGGGCAGGGCTGG + Intronic
1117137179 14:52747520-52747542 TACTAGGGAAAGGATAGGGCAGG + Intronic
1117733336 14:58745753-58745775 TAAGATGGAGAGGACAGAGCTGG + Intergenic
1119437164 14:74605119-74605141 GGACAGGCAAAGGACAGAGCAGG + Intronic
1120741437 14:88113118-88113140 CAAGAGGCAAGGGAAAGAGATGG + Intergenic
1121855963 14:97270564-97270586 TAAGAGCCAAAGAATGGAGTTGG + Intergenic
1122313623 14:100812871-100812893 TCAGAGTCAGAGGATAGAGATGG - Intergenic
1123177457 14:106435050-106435072 TAAGAGGAAATGCATAGATCTGG + Intergenic
1124018653 15:25900548-25900570 CATGAGCCAAAGGTTAGAGCAGG + Intergenic
1125343393 15:38696254-38696276 TAAGAGGTGAAGGATAGACCAGG - Intergenic
1125664485 15:41418959-41418981 TAAGAAGAAAAGGATTGAGGAGG + Intronic
1127192307 15:56543402-56543424 CAAGAGGGAAAGGAAAGAGGAGG + Intergenic
1127889991 15:63241766-63241788 AGAGAGGTAAAGGATAGAGGAGG + Intronic
1128566053 15:68700908-68700930 TAAAAGGCAAAGGAAAGATGTGG - Intronic
1130109411 15:80952312-80952334 TGAGAGGCAGAGGTTAGAGCAGG + Intronic
1130746986 15:86664728-86664750 TAAAAGGCAAAGGAATGAGCTGG - Intronic
1131152189 15:90054137-90054159 GCAGAGGCAAAGGACAGAGGGGG + Intronic
1138551395 16:57750775-57750797 TAAGAGGCAAATGAGAAGGCTGG - Intronic
1138769103 16:59640951-59640973 TAAGAGGCTAAGGAGAGAATGGG - Intergenic
1140618595 16:76698313-76698335 TATGAGGCAAACGACAAAGCTGG - Intergenic
1143491807 17:7289435-7289457 GAGGAGCCAAAGGATAGAGTAGG + Intronic
1144011205 17:11150043-11150065 TCAGAGGCCCAAGATAGAGCTGG + Intergenic
1144210900 17:13014658-13014680 TCAGATGCCAAGGATATAGCAGG + Intronic
1146737172 17:35248475-35248497 TAAGGGGGAAAAGAGAGAGCTGG - Intronic
1148432743 17:47655771-47655793 TAAATGGCAAAGGAGAGAGATGG - Intronic
1149375738 17:56042325-56042347 TAAGAGGGGAAGCAGAGAGCTGG + Intergenic
1149639086 17:58191643-58191665 TCAGAGGCAAAGGATGAACCTGG + Intergenic
1150007999 17:61481539-61481561 TGAGGGGCAAAGGAGAGAGCTGG + Intronic
1150632035 17:66886599-66886621 AAAGAGGGCAAGGAGAGAGCGGG - Intergenic
1151022379 17:70632327-70632349 CAAGAGACAAAGAATAGAACAGG + Intergenic
1151291368 17:73152775-73152797 GAAGTGGAGAAGGATAGAGCAGG + Intergenic
1151811120 17:76442672-76442694 GAAGAGGCAGGAGATAGAGCAGG + Intronic
1153309532 18:3664549-3664571 TAAGAGTCAAAGGATCAAGAAGG - Intronic
1154026908 18:10716513-10716535 TAAGAAGCAAGGAAAAGAGCGGG + Intronic
1155563215 18:27103141-27103163 TAAAAGGAAAAGGTTAGAGAAGG - Intronic
1156093860 18:33505546-33505568 TAAAGGGCAAAGAATAGAGTTGG + Intergenic
1157483782 18:48072989-48073011 TAAGAGGAAAAGGAATGAACGGG + Intronic
1157895737 18:51465155-51465177 AGAGAGGCCAAGGAGAGAGCAGG + Intergenic
1158113491 18:53968772-53968794 TAATATGCAAAGGATAGAAAGGG + Intergenic
1159119761 18:64154961-64154983 TAAGAGACCAAGTATAGAGGAGG + Intergenic
1159578062 18:70204103-70204125 TATGAGGCAGAAGATAGTGCAGG + Exonic
1159636790 18:70814179-70814201 AAAGAGGCAAAGGAGAGAAATGG - Intergenic
1162723403 19:12675646-12675668 TATGAGGCAGAGGATGGAGCAGG + Exonic
1164552134 19:29220825-29220847 AATGAGGCAGAGGATAGAGGGGG - Intergenic
1167123345 19:47532124-47532146 TCAGAGACACAGGATAGAGGTGG - Exonic
1168600064 19:57710355-57710377 TAAGAGACAAAGGGGAGAGGTGG + Intronic
926001861 2:9339775-9339797 TAAGAGGAGAAGCCTAGAGCTGG - Intronic
926668654 2:15553198-15553220 TAAGAGGCAACGGAATGATCTGG + Intronic
927262730 2:21109811-21109833 CAAGAGCCAAAGGATAGAAGAGG - Intergenic
928416739 2:31099265-31099287 TAATAGGCAAAGGATATAAACGG - Intronic
930389096 2:50737494-50737516 TAAAATGTAAATGATAGAGCTGG + Intronic
930533684 2:52620866-52620888 AAAGAGGGAAGGGAGAGAGCAGG + Intergenic
931122820 2:59239259-59239281 TAAGAGACATAGAACAGAGCTGG - Intergenic
931448485 2:62347456-62347478 TAACAGGCAAAAGAAAGAGAAGG + Intergenic
931665646 2:64608267-64608289 TAAGTGGCAGAGGGTGGAGCGGG - Intergenic
933271399 2:80236935-80236957 TAAGAGGGAAAGCAAAGAGAAGG + Intronic
933493111 2:83013882-83013904 TAAGAGGCAAACCATGGAGATGG + Intergenic
933743782 2:85555233-85555255 TAAAAAGGAAAGGAAAGAGCCGG - Intronic
935535244 2:104285842-104285864 TCACAGGCAAAGGGTGGAGCTGG + Intergenic
935556993 2:104520728-104520750 CAATAGGCAAAGGATAGAGGGGG - Intergenic
935930127 2:108114814-108114836 GAAGAGACAATGGACAGAGCAGG + Intergenic
936020830 2:108993654-108993676 TCAAAGGCAGAGGAAAGAGCTGG + Intergenic
937656559 2:124383343-124383365 TAAAAAGCAAATGATATAGCTGG - Intronic
937997858 2:127708666-127708688 GAGGAGGCAAAGGTAAGAGCAGG - Exonic
938921373 2:135998223-135998245 TAAGCAGCAAAGGGTAAAGCTGG + Intergenic
940214579 2:151291098-151291120 TAAAAGGCAAATGATACAGGTGG + Intergenic
940680479 2:156779036-156779058 TAAGATCCAAAGGTTAGAACAGG - Intergenic
941046990 2:160687460-160687482 TAAGAGGAAAAAGATAAAGGAGG + Intergenic
941890794 2:170579467-170579489 TAAGAGAAGAAGGATAGAACTGG - Intronic
942418811 2:175786484-175786506 CAAGAGGCAGAGGATGGAGGAGG + Intergenic
945326468 2:208488006-208488028 TTAGAGGGAAAGGATAAAACAGG + Intronic
945456862 2:210060712-210060734 GAAGAGGAAAAGAAAAGAGCTGG + Intronic
946135804 2:217645990-217646012 TAAGGGGCAAAGGCTAGATATGG - Intronic
946815280 2:223570890-223570912 TGAGAGGAAAAGGGCAGAGCAGG + Intergenic
947167902 2:227281059-227281081 TAAGCAGCAAAGCACAGAGCAGG - Intronic
947268618 2:228308305-228308327 TAAGAGGCCGCGGATAGAGAAGG + Intergenic
1169774808 20:9240804-9240826 TGAGAGGGAAAGGAGAGAGGGGG + Intronic
1170650552 20:18236516-18236538 TTAAAAGCAAAGGATAGAGCAGG - Intergenic
1171074675 20:22110552-22110574 TGAGAGGCAGGGGAAAGAGCAGG - Intergenic
1172315852 20:33953637-33953659 TAACAGGCTGAGGACAGAGCAGG + Intergenic
1173000900 20:39105028-39105050 TGAGAAGGAAAGGAGAGAGCTGG + Intergenic
1174013519 20:47469771-47469793 TAAGATGCACTGAATAGAGCTGG + Intergenic
1175762170 20:61568686-61568708 AAGGAGGCACAGGATGGAGCTGG - Intronic
1176450246 21:6855695-6855717 TAAGAGGCAGAGTCCAGAGCAGG - Intergenic
1176828415 21:13720713-13720735 TAAGAGGCAGAGTCCAGAGCAGG - Intergenic
1177353558 21:19977845-19977867 TAAGATGCAAAGTCTAGGGCAGG + Intergenic
1178359499 21:31936348-31936370 TAAGTTACAAAGGACAGAGCAGG + Intronic
1178487296 21:33027153-33027175 CAAGAAGCAAATGACAGAGCCGG + Exonic
1178724004 21:35035300-35035322 TCAGCGGGAAAGGACAGAGCTGG + Intronic
1178924320 21:36762331-36762353 TAAGAAGCAGAGAAGAGAGCAGG + Intronic
1179019686 21:37627231-37627253 TAAGAGGAAGAGCACAGAGCTGG - Intronic
1179049986 21:37880917-37880939 TAAGAGCCCATGGATAGAGATGG + Intronic
1181667189 22:24406462-24406484 CAAGAGGCCAAGCACAGAGCTGG + Intronic
1182733997 22:32518001-32518023 GAAAAGGTATAGGATAGAGCTGG - Intronic
1183281335 22:36934195-36934217 AAAGAGGCAAAGAGTAAAGCAGG + Intronic
950016765 3:9759926-9759948 TAAGAGAGAAAGGAAAGAGCTGG - Intronic
950271273 3:11617230-11617252 TATGAGGCAAGGCAGAGAGCAGG + Intronic
952359318 3:32614011-32614033 AAGAAGGTAAAGGATAGAGCAGG + Intergenic
952425624 3:33171568-33171590 GAAGACACAAACGATAGAGCTGG - Intronic
953500985 3:43434175-43434197 CAAGAGACAAAGAATAGACCAGG + Intronic
953511153 3:43540741-43540763 TAGGAGGGAATGGAGAGAGCTGG + Intronic
955207674 3:56911212-56911234 TGAGAGGTAAAGGAGAGAGGTGG + Intronic
957300816 3:78389538-78389560 TAACAGGCAAAGGCTGGAACAGG + Intergenic
957738728 3:84234622-84234644 TAACAGGCAGAGGTTAGAACAGG - Intergenic
957819702 3:85355589-85355611 TTAGATGCAGAGGGTAGAGCAGG + Intronic
958778374 3:98512154-98512176 TAAGAGACAAAAGATAGACCTGG + Intronic
959040767 3:101420855-101420877 TAAAAGGGAAAGGGCAGAGCAGG + Intronic
959442634 3:106397037-106397059 AAAAAGGCAAAGGGTGGAGCAGG + Intergenic
959561506 3:107788241-107788263 TAATAAGCAAAGGAGAGAGAGGG + Intronic
961511094 3:127404192-127404214 CAAGAGGCAAAGAGAAGAGCTGG + Intergenic
961744993 3:129059022-129059044 CAAGAGGCACAGGATAATGCAGG - Intergenic
962505245 3:136040106-136040128 TAATAGGCAAAGGAGAGAGAAGG + Intronic
962842187 3:139244556-139244578 TAAGAGGTAAAAGATAGAAAGGG - Intronic
963893197 3:150658680-150658702 TAATAGGCAAAAGAAAGAGAAGG - Intergenic
964666804 3:159183407-159183429 TAACAGACAAAGTATAGAGAGGG - Intronic
966953425 3:184846708-184846730 TAAGAGGACAAAGATAGAGCTGG - Intronic
966962003 3:184949457-184949479 TAAGAGGCACAGAACAAAGCAGG - Intronic
967142983 3:186578688-186578710 CAAGAGGCAAAAGAAAGAACAGG - Intronic
970530234 4:16974306-16974328 TAAGAAGCAAAGAATAAAGGAGG + Intergenic
970710730 4:18859349-18859371 TAAGAGGAAAAGGCTGGAGCTGG - Intergenic
970959355 4:21855002-21855024 GCAGGGGCAAATGATAGAGCAGG - Intronic
971057515 4:22930449-22930471 CAAAAGGCAAAGGAGAGAGATGG + Intergenic
971941112 4:33216569-33216591 TAAGAGGCAGGGGATAAAGTAGG + Intergenic
972880863 4:43419775-43419797 TCAGAGGCATATGGTAGAGCAGG + Intergenic
973105610 4:46332722-46332744 TAAGAGCCACAGGAGAGAGAAGG + Intronic
973189011 4:47365826-47365848 GAAGAGTCAAGGGAGAGAGCAGG - Intronic
974778868 4:66525294-66525316 AAAGAGGCAAATGATGAAGCAGG + Intergenic
975067228 4:70081993-70082015 TAAGAAGTAAATGGTAGAGCAGG + Intergenic
975429955 4:74277483-74277505 TAAGTGGCAGGGGAAAGAGCTGG + Intronic
975766910 4:77678235-77678257 TGAGAGGGAAAGGGTAGAGAGGG - Intergenic
975879086 4:78880874-78880896 TAAGATCCAAAGGAAAGTGCAGG + Intronic
976198350 4:82555814-82555836 TAAGATGCAAAGCATTCAGCTGG + Intronic
976902779 4:90199579-90199601 TGAGAGGCAAAGGAGAGAACTGG - Intronic
977250246 4:94681365-94681387 TGACAGGCAAAGCATAGTGCAGG + Intergenic
979411365 4:120383871-120383893 TAACAGGCAGAGGATGGAACAGG + Intergenic
979741054 4:124151687-124151709 TGAGAGGAAAAAGATAGAGGTGG - Intergenic
981242327 4:142492701-142492723 TAAGAGGCAAAGCATAGAAAAGG + Intronic
981768814 4:148282894-148282916 AAAGAGGCAAAGGCTATGGCGGG + Intronic
983468549 4:168126495-168126517 TGAGATGCAAAAGATAGAGTTGG - Intronic
984648723 4:182246506-182246528 TAAGAGACTAAAAATAGAGCCGG + Intronic
984871257 4:184327230-184327252 TAAGAGTGAAAGGATAGGCCAGG + Intergenic
985909550 5:2868150-2868172 GAAAAGGCAAAGGAAAGTGCAGG - Intergenic
987112720 5:14702098-14702120 GAAGAGGAAAAGGAGAGAGTGGG + Intergenic
987147337 5:15005153-15005175 AAAGAAAGAAAGGATAGAGCAGG - Intergenic
987154271 5:15072184-15072206 GAAGAGGCAAATGATAGATAAGG - Intergenic
987161476 5:15148716-15148738 GAAGAGGCAAGGAAAAGAGCAGG + Intergenic
988290092 5:29273311-29273333 TAAATGGCAAAGGAGAAAGCAGG + Intergenic
988674179 5:33414419-33414441 TGAGAGACAAAGCACAGAGCTGG + Intergenic
988732751 5:33989660-33989682 TTAGAGCCAAAGGCTAGAGAGGG + Intronic
990587040 5:57222184-57222206 TAAGAGGGAATGGATGGAGATGG + Intronic
990614334 5:57491806-57491828 TAAATGTCAAAGGATAGAGAAGG - Intergenic
990679407 5:58224204-58224226 AAAGATGCAGAGGATAGAGAAGG - Intergenic
991342366 5:65625216-65625238 TTGGCGGCAAAGGACAGAGCAGG - Intronic
992995658 5:82329859-82329881 TATGTGGCAAAATATAGAGCTGG - Intronic
993117454 5:83735055-83735077 TAAGAGGCAAAGCATTGAAGAGG + Intergenic
993350426 5:86843482-86843504 TCAGAGGGAAAGGAGAAAGCTGG + Intergenic
995282144 5:110348372-110348394 TAAGAGGAAAGGGTGAGAGCTGG + Intronic
998228210 5:140342951-140342973 TAAGAGGCAGAAGGAAGAGCAGG + Intronic
998426198 5:142030760-142030782 TGGGAGGCAAAGGTTGGAGCAGG - Intergenic
1000398506 5:160800922-160800944 TAAGAAGCAAAAGAAAGACCTGG - Intronic
1001050892 5:168413529-168413551 TAACAGTTAAAGGAAAGAGCTGG - Intronic
1003630824 6:7785206-7785228 TAAGAAGCAAAGAAGATAGCGGG + Intronic
1006105436 6:31713635-31713657 GAAGAGGCCAAGAAGAGAGCTGG - Intronic
1006576263 6:35048682-35048704 TAAGAGGCAGAAGACAGAGATGG + Intronic
1006654815 6:35581944-35581966 TAAGAGAAAAACCATAGAGCAGG + Intronic
1007511533 6:42378032-42378054 TAAGAGGCAAGGGATTGGGAAGG + Intronic
1007992050 6:46266818-46266840 AAAGATGCAAAGCACAGAGCAGG + Intronic
1008261845 6:49376049-49376071 TAAGAGACAAATGAGAAAGCTGG - Intergenic
1009246377 6:61243632-61243654 TTAGAGGCAAACTATATAGCAGG - Intergenic
1009855030 6:69251164-69251186 TAGGAGGCAGAGAAAAGAGCTGG - Intronic
1014038639 6:116798331-116798353 TTATAGGCAAAGGAAATAGCAGG + Intronic
1015941933 6:138461436-138461458 TGAGAGGCAATGGCTAGAGAGGG + Intronic
1017643728 6:156518777-156518799 ATAGAGGCAAAGGAAAGAGAAGG + Intergenic
1020458695 7:8403509-8403531 TCAGAGGCAAAAGCTGGAGCAGG + Intergenic
1022715231 7:32892162-32892184 AAAGAGGAAACGGAAAGAGCAGG + Intronic
1024067412 7:45752236-45752258 TAGGAGGCAAAGGAAAGGCCAGG - Intergenic
1024283438 7:47737662-47737684 AAAGAGGGAAAGGATGGAGGTGG - Intronic
1024471357 7:49771004-49771026 AAAGAGGAAAAGGAGAGAGACGG + Intergenic
1026274209 7:68862750-68862772 TAACAGGCAAAAGAAAGAGAAGG + Intergenic
1026379272 7:69782957-69782979 TAAGAGGTAAAGCCCAGAGCAGG - Intronic
1026512161 7:71036432-71036454 TAAGAGGGAAGGAATGGAGCTGG - Intergenic
1027549238 7:79570447-79570469 TCTGAAGCAAAGGATAGAACAGG - Intergenic
1027999145 7:85468653-85468675 TAGGAGGGAAAGGGTGGAGCTGG + Intergenic
1028457465 7:91054136-91054158 TAAGTGGGAAAGGAGATAGCAGG - Intronic
1029906033 7:104094207-104094229 TAAGAGGCAGAGTATTGAGATGG + Intergenic
1030355068 7:108532476-108532498 TAAGTGGCAAAGCTTAGAACTGG - Intronic
1031377234 7:121042392-121042414 TGAGAGAGAAAGGCTAGAGCTGG + Intronic
1031521097 7:122766838-122766860 TAACTAGCAAATGATAGAGCTGG - Intronic
1031561182 7:123240455-123240477 TCACAGGCAAAGGAAAGGGCGGG - Intergenic
1031817507 7:126456268-126456290 TAAGAGGCAGTGGAGAGTGCTGG - Intronic
1035161836 7:156956399-156956421 TAATAGGCATAGGAAAGAGCTGG + Intronic
1035278449 7:157762778-157762800 TCAGAGCCAAAGGAGAGAGGTGG + Intronic
1035679468 8:1477369-1477391 TCAGAAGGAAAGGACAGAGCCGG - Intergenic
1035690482 8:1556462-1556484 TAGGAGGGAAAGAACAGAGCCGG - Intronic
1035791487 8:2309698-2309720 TAAGAGGCAAAGGAGTAAGAAGG - Intergenic
1035801318 8:2412007-2412029 TAAGAGGCAAAGGAGTAAGAAGG + Intergenic
1037940160 8:22945208-22945230 TAAGAGGGAAAAGATAAGGCTGG - Intronic
1038255155 8:25944144-25944166 TAAGAGAAAAAGCATAGGGCAGG + Intronic
1038680593 8:29663744-29663766 TCGGAGCCAATGGATAGAGCTGG + Intergenic
1039133455 8:34294077-34294099 CAAGAGGCACAGGAATGAGCTGG - Intergenic
1039447626 8:37645304-37645326 TAAAAGGCAAAAGATAAACCAGG + Intergenic
1039607626 8:38895496-38895518 TCAGAGGCAAAGCACAGAGCAGG - Intergenic
1042888546 8:73580478-73580500 TTGCAGGCAAAGGTTAGAGCAGG - Intronic
1044366640 8:91355699-91355721 AAAGAGGCAAAAGATAGATTTGG - Intronic
1044513390 8:93110100-93110122 TAAGAGGCCAGGAAGAGAGCTGG + Intergenic
1044580201 8:93818874-93818896 TAGGAGGCAGAGGTTAGAGTGGG - Intronic
1044804158 8:95987758-95987780 AAAGAGGAAAACGATAGTGCTGG - Intergenic
1045048229 8:98299560-98299582 TGAAAAGCAAAGGATAGACCAGG + Intergenic
1046647304 8:116800338-116800360 TAAGGAGGAAGGGATAGAGCTGG + Intronic
1051336424 9:16070318-16070340 TCAGAGGTAAAGGACAGAGGAGG + Intergenic
1051689057 9:19689960-19689982 AAAAAGGCAGAGGACAGAGCTGG + Intronic
1052176147 9:25464961-25464983 TAAGAGACAAAGGAGAGATAGGG + Intergenic
1052739656 9:32381321-32381343 TAGGAGGCAGAGGATACAGGAGG + Intergenic
1054933889 9:70666231-70666253 TAGGAGGCAAAAGCAAGAGCTGG - Intronic
1055427121 9:76207730-76207752 TAGGAGTGGAAGGATAGAGCTGG + Intronic
1055494112 9:76837561-76837583 CATGTGGAAAAGGATAGAGCAGG + Intronic
1055778230 9:79790056-79790078 GGAGAGGGGAAGGATAGAGCAGG - Intergenic
1057147525 9:92768258-92768280 TTATAGGCAAAGGATGGGGCAGG + Intergenic
1058679081 9:107425655-107425677 CCAGAGACAAAGGAAAGAGCGGG + Intergenic
1058713567 9:107702456-107702478 AAAGAGGAAGAGGATAGAGAAGG + Intergenic
1059306396 9:113356552-113356574 TAGGCGGCAAAGGTTAAAGCAGG + Intronic
1059458258 9:114413296-114413318 GAAGAAGCAAAGAAAAGAGCAGG + Intronic
1059543417 9:115153087-115153109 CAAGAGGGAAAGTATAGACCGGG - Intronic
1060878961 9:127104384-127104406 TAAGAGGCAAAGGATAGAGCAGG - Intronic
1061215958 9:129222249-129222271 AAAGAGGGAAAGGTTTGAGCTGG - Intergenic
1061978934 9:134088682-134088704 TAAGAAGGGAAGGATAGACCGGG + Intergenic
1062173985 9:135150857-135150879 GAGGAGGCACAGGAGAGAGCCGG - Intergenic
1062419923 9:136475578-136475600 TAAGAGGCAGGGGACAGACCTGG + Exonic
1203518936 Un_GL000213v1:28822-28844 TAAGAGGCAGAGTCCAGAGCAGG + Intergenic
1186634308 X:11386072-11386094 TAGAAGGGAAAGGACAGAGCAGG + Intronic
1186688834 X:11953319-11953341 CAACAGGCACAGGATACAGCAGG - Intergenic
1187788235 X:22917896-22917918 GAAGGGGAAAAGGATAGAGGAGG + Intergenic
1188074410 X:25757772-25757794 TAAGAGACAAAAGAGAGAGAGGG + Intergenic
1189665738 X:43352875-43352897 GAAGAGCCAAAGGATAGAAAAGG - Intergenic
1192546652 X:72019774-72019796 TGAGAAGGAAAGGATAGGGCTGG + Intergenic
1193188483 X:78540870-78540892 TAATAGGAAAAGGATTGTGCTGG - Intergenic
1193809495 X:86035032-86035054 ATAGAGGCAAAGGAAAGAGAAGG + Intronic
1195543454 X:106088359-106088381 TAAGAAGCACTGAATAGAGCGGG - Intergenic
1196937824 X:120747004-120747026 TAAGAGATAAAGGCAAGAGCTGG + Intergenic
1197124437 X:122927631-122927653 TAAAAAGAAAATGATAGAGCTGG + Intergenic
1197765082 X:130055031-130055053 GAAGTGGCAAAGGCTGGAGCTGG + Intronic
1199029226 X:142976879-142976901 TAGGAGGTTAAGGATAGAGGTGG + Intergenic