ID: 1060878963

View in Genome Browser
Species Human (GRCh38)
Location 9:127104399-127104421
Sequence GCCTCTTAGAGAATGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060878960_1060878963 -1 Left 1060878960 9:127104377-127104399 CCAGGTGCCTGCTCTATCCTTTG 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878957_1060878963 7 Left 1060878957 9:127104369-127104391 CCCAGAACCCAGGTGCCTGCTCT 0: 1
1: 0
2: 4
3: 24
4: 277
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878956_1060878963 10 Left 1060878956 9:127104366-127104388 CCTCCCAGAACCCAGGTGCCTGC 0: 1
1: 1
2: 1
3: 47
4: 325
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878959_1060878963 0 Left 1060878959 9:127104376-127104398 CCCAGGTGCCTGCTCTATCCTTT 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878953_1060878963 29 Left 1060878953 9:127104347-127104369 CCTGAGAAACAGTACCAGGCCTC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878955_1060878963 15 Left 1060878955 9:127104361-127104383 CCAGGCCTCCCAGAACCCAGGTG 0: 1
1: 0
2: 4
3: 42
4: 391
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878958_1060878963 6 Left 1060878958 9:127104370-127104392 CCAGAACCCAGGTGCCTGCTCTA 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data
1060878961_1060878963 -8 Left 1060878961 9:127104384-127104406 CCTGCTCTATCCTTTGCCTCTTA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060878963 Original CRISPR GCCTCTTAGAGAATGACCCC TGG Intronic
No off target data available for this crispr