ID: 1060880293

View in Genome Browser
Species Human (GRCh38)
Location 9:127113307-127113329
Sequence AAAGAGAAGCCCAAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060880293_1060880296 5 Left 1060880293 9:127113307-127113329 CCATGCTCCTTGGGCTTCTCTTT 0: 1
1: 1
2: 5
3: 38
4: 439
Right 1060880296 9:127113335-127113357 TCAGAGTCATTTATTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060880293 Original CRISPR AAAGAGAAGCCCAAGGAGCA TGG (reversed) Intronic
900287215 1:1907463-1907485 GAAGAGGACCCCAAGCAGCAGGG + Intergenic
901040094 1:6358491-6358513 AGAGGGAAGCCACAGGAGCAAGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901454278 1:9354228-9354250 AAAGAGAACCCAAAGGAACCCGG - Intronic
902989335 1:20175260-20175282 AAAGCGAAGTGCAAGGGGCATGG + Intronic
903828551 1:26161586-26161608 AAAGAGAACGCCAAGGGCCAGGG + Exonic
903981824 1:27194426-27194448 GAAGAGAGGACAAAGGAGCAAGG - Intergenic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
907485937 1:54778195-54778217 AAACTGAGGCCCAAAGAGCAGGG - Intergenic
907986032 1:59531523-59531545 AAAGAGAAGCCTACAGAGCTGGG + Intronic
908386866 1:63651246-63651268 CCAGAGAAGCCCAGGGAGCTTGG + Intronic
909281568 1:73761568-73761590 AAAGAGAAGCACTATGGGCATGG + Intergenic
910129629 1:83888065-83888087 AAAGAGGAACCCTAGAAGCAAGG + Intronic
910792838 1:91068957-91068979 AAAGACAAGCCTTAGAAGCAGGG + Intergenic
911295735 1:96112450-96112472 GATGAGAAGGCCATGGAGCAGGG - Intergenic
911895312 1:103426220-103426242 AGCGAGAAGCTAAAGGAGCAAGG - Intergenic
911967670 1:104387850-104387872 AAAGAGAAGCACAGGGACCAGGG - Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913474327 1:119222603-119222625 AAAGATGAGATCAAGGAGCAAGG - Intergenic
914682582 1:149949628-149949650 AAGGAGAATACCAAGGAACAAGG - Exonic
915027360 1:152843449-152843471 AAACAGAAGCCCAAGCTGCCTGG + Intronic
915086276 1:153390995-153391017 CAAGAGAAGCCCAAAGTGCGGGG + Intronic
915504943 1:156348544-156348566 AAAGACAATCCAAAGGAGAAGGG + Intronic
916254242 1:162770276-162770298 GAAGAGAAGAGCAAGGAGAAAGG - Intronic
916956884 1:169847022-169847044 ATAGGGAAGCCCAAGGAGAGGGG + Intronic
917000576 1:170353722-170353744 AATCAGAAGCCCAAGGATCTAGG + Intergenic
917738704 1:177943224-177943246 AAAGAGGAGCTCATGGGGCAAGG + Intronic
918062754 1:181076234-181076256 AAATAGAAGCCCAGCGAACATGG - Intergenic
921179588 1:212621380-212621402 ATAGAGAAGCACAAAAAGCAAGG - Intergenic
921530545 1:216277276-216277298 AGAGAGAAGCCCCAGGAACAAGG - Intronic
923358489 1:233183967-233183989 TAAGAGAAGCCCTAGGTGGATGG - Intronic
923406562 1:233666790-233666812 AGTGACAAACCCAAGGAGCACGG - Exonic
924144208 1:241057317-241057339 AATGAGAAACCCAAGGCTCAGGG - Intronic
1063093740 10:2890767-2890789 AAAAGAAATCCCAAGGAGCAGGG + Intergenic
1063237645 10:4135045-4135067 GCAGAGAAGCCCAAGGAGATGGG + Intergenic
1063959519 10:11295646-11295668 ACAGAGCAGCCCGAGCAGCAGGG - Intronic
1064425517 10:15225982-15226004 AAAGAGAAGCTCAGGGTGAAGGG - Intronic
1064591088 10:16891439-16891461 AGAGAGAAAACCAAGGAGGAAGG + Intronic
1066552068 10:36569529-36569551 AAAGAAAAGGCCAAGGAAAAGGG + Intergenic
1067291321 10:44945403-44945425 AAAGATAAGGACAGGGAGCAGGG - Intergenic
1068327824 10:55517863-55517885 AAAGAGAACTCAAAGGAGCCTGG - Intronic
1069267072 10:66473353-66473375 AGAGAGAAGCATGAGGAGCAAGG - Intronic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069997209 10:72349780-72349802 AAAGAGAGCCCAAAGGAGAATGG + Intronic
1070674948 10:78406071-78406093 AAAGAGAAGGATTAGGAGCATGG - Intergenic
1070946436 10:80395733-80395755 AAAGAGAAGCCACAGGTCCAAGG + Intergenic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1072144435 10:92621801-92621823 AAATAGAAGCCTAGGCAGCATGG - Intronic
1072936441 10:99717936-99717958 AACCAGAAGCTCAAGGAGCCAGG - Intronic
1073402697 10:103271948-103271970 AAAGTGAAGATCAAGAAGCAAGG + Intergenic
1073523680 10:104159266-104159288 AAAGAGAGGCCAAAGGAGTTGGG + Intronic
1073959535 10:108910883-108910905 ACACAGAAGCCAAAGGAGCAAGG + Intergenic
1073991400 10:109266196-109266218 ACAGAGATGCCAAAGGAGAAGGG - Intergenic
1074951622 10:118342391-118342413 AAAGGGAAGCCCCAGGAGGCCGG - Intergenic
1075585354 10:123653410-123653432 AATAAGAAGCCCAAGGGGCAGGG + Intergenic
1075662759 10:124209600-124209622 ATAGTGAAGCCCAAGGCTCAGGG + Intergenic
1075820202 10:125301162-125301184 AAAGAGAAGGCCCAGGAGCCCGG - Intergenic
1075940405 10:126386690-126386712 AAAGAGAAGTCTACTGAGCAGGG - Intronic
1076121356 10:127939603-127939625 AAAGAGCAACCCAAGGAGTTGGG + Intronic
1076246156 10:128949284-128949306 AAAGACAAGCCCCAGGGGCAGGG + Intergenic
1076400163 10:130177981-130178003 AAAAACAGGCACAAGGAGCATGG + Intronic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1078552262 11:12288923-12288945 AAAGAAAACCTCAGGGAGCAGGG + Intronic
1078716612 11:13846014-13846036 AAAGAGGAGAGCAAGGAACAAGG - Intergenic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079067381 11:17307290-17307312 ATAGATAAACCCAAGGAGGATGG - Intronic
1079486457 11:20940542-20940564 ACAAAGAAGCCCAAGGGGCCAGG - Intronic
1079515480 11:21262850-21262872 AAAGAGAAGACCAAGGAAAAAGG - Intronic
1079986021 11:27201698-27201720 AAAGTCAAGGCCAAGGAGGAGGG - Intergenic
1080133213 11:28820638-28820660 ATAGAGAAGCCCACTTAGCAAGG + Intergenic
1080276119 11:30505006-30505028 AAAGAGAATCCCAAGGCACCAGG + Intronic
1081290943 11:41324831-41324853 AAAGAAATGCACAAGAAGCAGGG - Intronic
1081645049 11:44784352-44784374 AAACAGAGGCCCTGGGAGCAGGG - Intronic
1081850445 11:46271897-46271919 AGGGAGAAGCCACAGGAGCAGGG - Intergenic
1081966262 11:47171918-47171940 AAACAGGAGCCCAACCAGCATGG + Intronic
1082160637 11:48884786-48884808 AAAGAGAAGCCCCTGGGGTAAGG + Intergenic
1082161729 11:48895620-48895642 AAAGAGAAGCCCCTGGGGTAAGG - Intergenic
1083173880 11:60937686-60937708 AAAGAAAGGCCCAAGGAGGGAGG + Intronic
1083870040 11:65481476-65481498 AAAGATAAGACCAAGGAAAAAGG + Intergenic
1084054426 11:66623208-66623230 GAACAGAAGCCCAAGGTGTAAGG + Intronic
1084072090 11:66743482-66743504 AAAGAGTTGCCCAAGGAGAAGGG - Intergenic
1084299090 11:68234207-68234229 AAAGAGAAGAGAAAGAAGCAGGG - Intergenic
1085286677 11:75367034-75367056 ATAGATAACCTCAAGGAGCACGG + Intergenic
1085325008 11:75599852-75599874 AAAGGGAAGCTCAAAGAGGAGGG - Intronic
1085424617 11:76393112-76393134 AACAAGAAGCCCAAGGAAAAGGG + Intronic
1086745105 11:90415768-90415790 AAAGTGAAGGGCAAGGAACATGG - Intergenic
1089599704 11:119605730-119605752 AAGCAGAAGGCCAAGGAACAGGG - Intergenic
1089667415 11:120029316-120029338 GAAGAGCAGTCCAGGGAGCAGGG + Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1089948576 11:122504113-122504135 AAAGAAATCCCCAAGGAACATGG - Intergenic
1090604667 11:128408824-128408846 AGACACAAGCCCAAGGACCAAGG + Intergenic
1091360410 11:134974831-134974853 AAAGAACAGTCCAAGGTGCAGGG + Intergenic
1094423270 12:30294678-30294700 AGAGAGGAACCCAAGAAGCAAGG + Intergenic
1095754590 12:45750214-45750236 ATAGGGATGCCCAAGGAGAAGGG + Intronic
1095853040 12:46831409-46831431 TAAGAGAAGCCTAGGGAGGAGGG - Intronic
1095980504 12:47971191-47971213 CAAGAGAAGTCCCAGGATCAAGG - Intergenic
1096803667 12:54127482-54127504 CAAGAGATGCCCCAGGAGGAAGG + Intergenic
1096996345 12:55840568-55840590 AAAGAGCAGCCCAAACATCAAGG + Intronic
1097383872 12:58926064-58926086 AAAGAGAAGAAGAAGAAGCAAGG - Intergenic
1102295430 12:111733013-111733035 AAAGAGAGGCCCAAGGAGCCCGG - Intronic
1103202152 12:119096642-119096664 AAAGGGAGGCCCAAGAGGCAAGG - Intronic
1103206565 12:119134073-119134095 AAAGAGGAGCCCAAGCATGAAGG + Intronic
1103243732 12:119437102-119437124 AAAAAGAAGCCCAAGAAATAGGG - Intronic
1103341317 12:120222627-120222649 AAAGAGAAGCCTAAGCGGAATGG - Exonic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104482217 12:129117610-129117632 AAAGTGCAGCCCCAGGAGAAAGG - Intronic
1106888802 13:34219927-34219949 AAAGAGAGGACCAAGGGCCAGGG - Intergenic
1108889463 13:55235157-55235179 AAATAGCAGCCGAAGGGGCAAGG + Intergenic
1108944250 13:56002072-56002094 AAGGAGAGGCCCAAGCAGAAGGG + Intergenic
1109230025 13:59745202-59745224 AAAGAGAAGGCAAAAGAGAAGGG + Intronic
1109739440 13:66532803-66532825 AAAGAAAAGACCGAGGAGAATGG - Intronic
1112809056 13:103196681-103196703 AAAGAAGAGAACAAGGAGCATGG - Intergenic
1114555882 14:23562125-23562147 AAGGAAAGGCCCACGGAGCAGGG + Intronic
1116707814 14:48325414-48325436 AAAGAGAAAGGAAAGGAGCAAGG + Intergenic
1116984130 14:51202104-51202126 AAAGGGAACCCCAGGGAACAGGG - Intergenic
1117599128 14:57355617-57355639 CAAGAGAAGCCCATTCAGCATGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118264646 14:64283422-64283444 TAAGAGAAGATCAATGAGCAAGG + Intronic
1119044976 14:71310521-71310543 AAAGAGAAGTCCAATTAGCCAGG + Intergenic
1119101689 14:71885789-71885811 AAAGAGAAGGCCAAAGGACAGGG - Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1122120686 14:99552003-99552025 TAAGAGGAGGCCAAGGAGGATGG + Intronic
1122704110 14:103609344-103609366 AGAGAGAAGCCAAAGGGACAAGG + Intronic
1122784950 14:104159331-104159353 AAACAGGACCCAAAGGAGCACGG - Intronic
1122822142 14:104353111-104353133 AAAGAGAGGCCGAAGAAGCTAGG - Intergenic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123966816 15:25467664-25467686 ACAGAGAAGCTCAAGGAGCTGGG + Intergenic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1125577629 15:40766289-40766311 AAAGCTAAGCCCTAGAAGCAGGG + Exonic
1125956129 15:43792398-43792420 AAAGAAAAGGGCAAGGAGAAGGG - Intronic
1126567121 15:50112423-50112445 AAAAAGCAGGCCAAGGAGGAAGG + Intronic
1126715759 15:51515690-51515712 AAAAATAGGCACAAGGAGCAGGG + Intronic
1127077974 15:55346849-55346871 CAAGAGAAGCCTAAGGTCCATGG - Intronic
1127656389 15:61060287-61060309 AAAGAGATGTCCAAGTACCAGGG - Intronic
1127954442 15:63840976-63840998 AAATTGAAGCCCAGGCAGCAAGG - Intergenic
1128158990 15:65410788-65410810 AAAGAAAAGCAGAAGGAACAGGG + Intronic
1128732196 15:70028934-70028956 GAAGAGAAGCCCAGGAAGAATGG - Intergenic
1129660689 15:77551243-77551265 AAAGAGGATCCCAAGGCCCAGGG + Intergenic
1130445519 15:83997803-83997825 TAACAGAAAACCAAGGAGCAAGG - Intronic
1130633006 15:85588082-85588104 CAAGTGTAGCCCAAGGAACATGG - Intronic
1130713219 15:86304760-86304782 CAAGAGAAGTCCAAGCATCAGGG - Intronic
1130717112 15:86345892-86345914 AAGAAGAAGGCCAAGGAGTAAGG - Intronic
1130819740 15:87482089-87482111 GAAGAGATGACAAAGGAGCATGG + Intergenic
1132460671 16:52924-52946 AAAGACAAGACCAATGAGTAAGG + Intronic
1134467573 16:14492874-14492896 AAAGAGAAGTCCAGGGAGGCAGG - Intronic
1134885760 16:17789997-17790019 AAAGAGAAACTCCAGGAGCGGGG + Intergenic
1136060559 16:27723481-27723503 CCAGAGAAGCGCAAGGGGCAGGG - Intronic
1137034802 16:35560761-35560783 ACAGATAACCTCAAGGAGCACGG - Intergenic
1137044522 16:35643106-35643128 AGAGAAGAGGCCAAGGAGCATGG + Intergenic
1137452383 16:48589107-48589129 AAAGACAATCCCAAAGATCATGG + Intronic
1137937158 16:52645638-52645660 AAAGAGAGTCCCAAGGAGATAGG - Intergenic
1138760426 16:59537242-59537264 AAATAGAAGCCTAAGGAGTACGG + Intergenic
1139372099 16:66475340-66475362 AAAAAGCAGCCCAAGAAGAAAGG + Intronic
1140715444 16:77722263-77722285 CCATAGAAGCCCAAGGAGCCCGG + Intergenic
1142889970 17:2936848-2936870 AAAACGAAGAGCAAGGAGCATGG - Intronic
1143743589 17:8973095-8973117 AAAAAGAAGCCTAAGGGGCCAGG + Intergenic
1144004107 17:11084483-11084505 AAAACGAAGCCCAGGGAGCATGG + Intergenic
1144589789 17:16514387-16514409 AAAGAGAAGCGAGAGGAGCAAGG - Intergenic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146264028 17:31439183-31439205 AGAGACACACCCAAGGAGCATGG - Intronic
1146502361 17:33374943-33374965 AAACAGAAGCCCAGGGAGGTTGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1147958502 17:44151456-44151478 AACCAGAACCCCAAGGAGAAGGG - Intronic
1149178091 17:53899505-53899527 AAAGAGAAGGGTATGGAGCATGG - Intergenic
1149454538 17:56777209-56777231 AGAGAGAAGCCAAGGCAGCATGG - Intergenic
1149660569 17:58332243-58332265 AAAGAGGTGTCCAAGGAGGAGGG - Intergenic
1149897092 17:60436772-60436794 AAACAGAGGCCCAAGAAGAAAGG + Intergenic
1150578402 17:66450537-66450559 AAAGAGAAGTCCCAGGAAAAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152528038 17:80900715-80900737 ACCGAGAACCCCATGGAGCATGG - Intronic
1152601514 17:81264572-81264594 AGAGAGAAGCACCAGGGGCAGGG + Intronic
1152891360 17:82883455-82883477 ATAATGAAGCCCAAGGAGCCTGG + Intronic
1154371043 18:13763489-13763511 CAGGAGAAGTCCAGGGAGCAGGG - Exonic
1155013902 18:21812804-21812826 AAAGAGAATTTCAAGGAACAAGG - Intronic
1155505231 18:26526613-26526635 AAAGTCAAGCCCAAGGCACACGG + Intronic
1157513452 18:48294864-48294886 AAAGAGGAGGCCAAGTGGCAGGG - Intronic
1157594485 18:48855924-48855946 AAAGTGAAGCCCAATGAGTGTGG + Intronic
1158085312 18:53643950-53643972 AAAGGGAAGCAAAAGGAGTAAGG - Intergenic
1159413437 18:68111562-68111584 AAAGATCAGCTCAAGGATCAAGG + Intergenic
1160123467 18:76150453-76150475 AAGGAGGAAACCAAGGAGCATGG - Intergenic
1160361393 18:78284822-78284844 CAAGACAAGCCTAAGGAGTAAGG - Intergenic
1161286971 19:3473520-3473542 AAAGAAAAGGGCCAGGAGCAGGG + Intergenic
1161554900 19:4935608-4935630 TCAGAGAAGCCCATGGGGCAAGG - Intronic
1163175823 19:15563597-15563619 ACAAAGAAGCCCCAGGAGGAGGG + Intergenic
1163201161 19:15770152-15770174 AAAGACAAGGCAAAGGAGCTGGG - Intergenic
1164853543 19:31503456-31503478 AATGAGATCCCCAAGGGGCAGGG - Intergenic
1165108255 19:33486928-33486950 CAATCGAAGCCCAAGGTGCAAGG + Intronic
1165550051 19:36576195-36576217 AAAAAGAATCCAAAAGAGCAAGG + Intronic
1165791135 19:38493222-38493244 AAAGAGAAGCCCCAAGGCCACGG - Intronic
1166878676 19:45913930-45913952 ACAGAGAAGTCGAAGGGGCAGGG + Exonic
1167179186 19:47889239-47889261 CAAGAGGAGCCCAAGGAGACAGG - Intergenic
1167300849 19:48676582-48676604 AAAGAGCAGCCCCCGGAGAAGGG + Intergenic
925925567 2:8667705-8667727 AAGGAGAAGTGCCAGGAGCAAGG - Intergenic
926402936 2:12517745-12517767 AGAGGGAAGTCCAAAGAGCAAGG + Intergenic
926839142 2:17059128-17059150 ATAAAGGAGCCGAAGGAGCAAGG - Intergenic
926863135 2:17329968-17329990 AGATAGGAGCCCAAGGACCAGGG + Intergenic
927504132 2:23602324-23602346 CAAGAAAAGCGCAAGGAGAAAGG - Intronic
927635540 2:24813386-24813408 AAAGCTAAGCCCTAGGAGTAAGG - Intronic
927719299 2:25372751-25372773 AAAGAGGAGCCCACGGAGGAGGG + Intergenic
927755320 2:25703928-25703950 ATAGGGAGGCCCAAGGAGCGGGG - Intergenic
928630232 2:33183993-33184015 AAAGAGCAGGCCAAGGAAGAGGG - Intronic
929225728 2:39510220-39510242 ACAGAGAAGCCCAAAGTGCTGGG - Intergenic
929247570 2:39719584-39719606 TAAGAGAAGCCCAAGGACTCAGG - Intergenic
929629966 2:43449565-43449587 AAAGAGAAGCCCGGGCAACATGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931534198 2:63254225-63254247 TAATAGAAGGGCAAGGAGCAAGG + Intronic
931835881 2:66097937-66097959 GAAGAGAAGCCCACAGAGGAGGG + Intergenic
932047957 2:68368925-68368947 AAAGGGAAGGGCAAGCAGCAGGG + Intronic
933706605 2:85295591-85295613 AAAGAGAAGCACAAAGCCCAGGG - Intronic
933982912 2:87568124-87568146 CAAGAGAAGCCTAAGGAGATGGG + Intergenic
934219710 2:90071102-90071124 AAAGAAAATTCCAAGGATCATGG - Intergenic
934650127 2:96085866-96085888 ACAGGGAAGCCCAAGGGCCAGGG + Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
935135200 2:100293989-100294011 CAAGAGAAGGGCAAGTAGCATGG + Intronic
935309874 2:101773059-101773081 ACAGAGAAGCCCAAGGAAGGGGG - Intronic
935353786 2:102179097-102179119 AGCCAGAAGCCCATGGAGCAGGG + Exonic
936310928 2:111382670-111382692 CAAGAGAAGCCTAAGGAGATGGG - Intergenic
936439084 2:112534568-112534590 AAAGACAAGACCTAGGAGTAGGG - Exonic
937224506 2:120360434-120360456 ATAGAGCAGGCCCAGGAGCAGGG - Intergenic
937250566 2:120521245-120521267 AAAGAGAAGGCTCAGGAGAATGG + Intergenic
937305639 2:120868864-120868886 AAAGAGGAGCTCAAGGAAGAGGG + Intronic
937768240 2:125686672-125686694 GGAGAGAAGCCCATGCAGCAGGG - Intergenic
939133564 2:138267244-138267266 ACAGAGAAGCACAAGGACCTGGG - Intergenic
940515542 2:154680005-154680027 TAAGAGAAGCCCAAACAGTATGG + Intergenic
941079283 2:161041315-161041337 AAAGAGAAAGCCATAGAGCAAGG - Intergenic
942191281 2:173473114-173473136 ACCTAGTAGCCCAAGGAGCAGGG - Intergenic
942563458 2:177244502-177244524 AAGTAGAAGCCCAGGCAGCATGG + Intronic
944758458 2:202788376-202788398 AAAGTGACCCCCAAGGTGCAGGG + Intronic
944963908 2:204907340-204907362 AAAGACAAGACCTAGAAGCATGG - Intronic
945099314 2:206249851-206249873 AAAGAAAAGCCCGCGGGGCAGGG - Intergenic
946169462 2:217885996-217886018 CCAGAGAAGCCCAAGGCCCAGGG - Intronic
946400610 2:219466508-219466530 ATGGAGGGGCCCAAGGAGCAGGG + Intronic
946976004 2:225152132-225152154 AAAAAGAAGCCAGAGAAGCAAGG - Intergenic
947052197 2:226058118-226058140 AAAGAGGAGACTAAGGAGCTGGG - Intergenic
948388251 2:237595015-237595037 CAAGAAAACCCCAAGGAGGAGGG - Exonic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
948981353 2:241496509-241496531 AAAGAGAAGCACAAGCAGAGCGG - Exonic
1168868705 20:1110570-1110592 AAAGAGAAGGGGAGGGAGCAAGG - Intergenic
1168972530 20:1940389-1940411 AAAGTGAGGCCCCAGGAGGAGGG - Intronic
1169587344 20:7100355-7100377 AAAGAAAAGCCCAAGACCCAAGG + Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170161978 20:13322617-13322639 AAAGAAAAGCCCAAGACCCAGGG + Intergenic
1170327367 20:15171378-15171400 AAAGAGAGACACAAGGAGAAAGG - Intronic
1170352810 20:15460443-15460465 AAAGAGGTCCCCAAGGAGCTGGG - Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1170929867 20:20759223-20759245 CAAGAGCAGCCCAGGCAGCATGG - Intergenic
1171987652 20:31671572-31671594 AAACAGAAGTCCAAGGAGTCTGG - Intronic
1172425296 20:34851762-34851784 AAAGAGGGACCCAAGGAGGAAGG - Intronic
1172672761 20:36645714-36645736 AAAAACAAGCTCAAGGAGAAGGG - Intronic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1174823999 20:53752677-53752699 AAAGAGGAGCCCAAGGAAGGTGG + Intergenic
1178377008 21:32075194-32075216 AAAGAGCTGCCCAAGGAGAAGGG - Intergenic
1179156384 21:38854644-38854666 AAAGAGAACACCAAGCAGGATGG + Intergenic
1180669256 22:17540612-17540634 AAACAGCAGCCCATGGAGAATGG + Exonic
1182208837 22:28656210-28656232 CAGGAGAGGCCCAAGGAGCCTGG + Intronic
1182225322 22:28793320-28793342 TCAGAGAATCCCAAGCAGCAAGG - Intergenic
1182268496 22:29137712-29137734 GAAGAGAAGCCCAAGGCACGTGG - Intronic
1182704806 22:32270445-32270467 AAAGAGAATCCCAAGGGGGAGGG + Intergenic
1183020905 22:35024942-35024964 AAAGAGAAGACAAAGCAGGAAGG + Intergenic
1183101822 22:35588835-35588857 AAAAAGAAGCCACAGGACCATGG + Intergenic
1183119818 22:35721735-35721757 AAAGGGAAGTCCCAGGAGCTTGG - Intronic
1185014257 22:48334126-48334148 GAAGAGAAGCCAATGGTGCATGG - Intergenic
1185161962 22:49235543-49235565 AAAGGGGAGCCCAGGGAGCCAGG - Intergenic
949306583 3:2648616-2648638 AAAGGGAGGCCCCAGGAGAAGGG - Intronic
949687747 3:6597060-6597082 AAATAGAAGCCAAAAGAGCATGG - Intergenic
950343665 3:12272202-12272224 ACAGAGAAGTCCAAGAAGAAAGG - Intergenic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
952356601 3:32590727-32590749 AAAGAAAAGCCAAAGAAGCTGGG + Intergenic
952385881 3:32841258-32841280 AAAAACAAACCCAAGGAGCCAGG + Intronic
952541090 3:34369168-34369190 ACAGAGAATGCCAAGGAGTAGGG + Intergenic
953380125 3:42464065-42464087 AGAGAGAGGACCAAGGAGAATGG - Intergenic
953411470 3:42692746-42692768 AAAGAGAAGCCGGAGTAGGAGGG - Exonic
953520189 3:43635024-43635046 AAGGAGAAGTCCATGGAGCTGGG + Intronic
953616873 3:44498771-44498793 AAGGAGATAGCCAAGGAGCAGGG + Intergenic
954896896 3:53983074-53983096 AAAGAGAAGCCCAAGGCTGAAGG - Intergenic
954941698 3:54378784-54378806 AAAGGGCTGCCCAAGGACCAAGG - Intronic
955104421 3:55883307-55883329 TAAGAGAAGCCAAAGAAGAATGG + Intronic
955933769 3:64082890-64082912 AAATAGGATCCCAAGGAGCAGGG - Intergenic
956931875 3:74052876-74052898 AAAAAGAATCCCTAGAAGCAGGG + Intergenic
957883195 3:86248653-86248675 CAAGTGAAGCTCAAGGAGAAAGG + Intergenic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960903518 3:122575526-122575548 AAACAGAACCTCAAGAAGCAAGG - Intergenic
961808930 3:129510259-129510281 AAAGAAATGCCCAAGGTGGAAGG - Intronic
962056146 3:131873823-131873845 AAAGAGGAAGCCAAGGAGCCAGG - Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
964222680 3:154365041-154365063 AAAGAAATGCCACAGGAGCAGGG - Intronic
965098770 3:164270829-164270851 AAAGAGATGCCAAAGCAGCAGGG + Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
965723031 3:171682862-171682884 AAAGAAAAGCCAAAGGATCATGG - Intronic
966116526 3:176469900-176469922 AAAGAGCAGGCCAGGGAGCCAGG + Intergenic
966125645 3:176573125-176573147 AAACAGAAGCTCAAGGACCCAGG + Intergenic
967234740 3:187373239-187373261 ATAGAGAAGGGCAAGGAGAATGG + Intergenic
967692316 3:192490166-192490188 AAAGAGAAACACAAGAAACAAGG - Intronic
968052041 3:195661570-195661592 GAAGGGCAGCCCAAGGGGCAAGG - Intergenic
968059289 3:195714795-195714817 AAACATAATCCCAAGGAACAAGG + Intergenic
968103771 3:195986768-195986790 GAAGGGCAGCCCAAGGGGCAAGG + Intergenic
968302073 3:197624361-197624383 GAAGGGCAGCCCAAGGGGCAAGG + Intergenic
969205245 4:5639032-5639054 CAAGGGAGGCCCCAGGAGCAAGG + Intronic
969670375 4:8586890-8586912 GAAGAGGAGCCCAAGGCTCAGGG + Intronic
970207979 4:13675250-13675272 TAAGAAAAGCCCAAGGCACAGGG + Intergenic
971237690 4:24857493-24857515 AAAGTGAGGCCCAAGGACCAGGG - Intronic
972189345 4:36571152-36571174 ATAGAGAGGCCCAAGGAGAGGGG + Intergenic
972248125 4:37267986-37268008 CAAGACAAGCCACAGGAGCAGGG - Intronic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
973855465 4:55006556-55006578 TAAGAGAACTCCAAGGACCAAGG - Intergenic
974617208 4:64305700-64305722 TAAGTGAAACCCATGGAGCAGGG - Intronic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976187192 4:82453701-82453723 AAAGAGAAGCACAAAGAACTTGG - Intronic
977164956 4:93683155-93683177 AAGGAGAAGCCCAGGGAGAGAGG - Intronic
977855835 4:101890912-101890934 AAAGAGAAGTCAAAGGAGGTAGG - Intronic
978010451 4:103675790-103675812 CAAGAAAAGGCCAAAGAGCAAGG + Intronic
978577673 4:110202542-110202564 AAAGAAAAGGCCAGGGAGTAGGG + Intergenic
978946220 4:114501113-114501135 AAAGTTAAGCCCCAGGAGTAAGG - Intergenic
979359561 4:119745692-119745714 AAAGAGAGGGCCATGCAGCAAGG - Intergenic
979947302 4:126849075-126849097 TAAGAGAAGTCAAAGGAGAAGGG + Intergenic
979968896 4:127110376-127110398 AAAGAGGAGTCCAAATAGCAAGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
982508743 4:156253196-156253218 GAAGAGAAGCACAAGGATAATGG + Intergenic
983490091 4:168378867-168378889 AAAGAGCAGGCCAAGGAACCTGG - Intronic
983516550 4:168663297-168663319 AGTCAGAAGGCCAAGGAGCAAGG + Intronic
984011853 4:174381054-174381076 AAAGAAACACCCAAGCAGCAGGG - Intergenic
985856896 5:2435312-2435334 AAAGCAAAGGCCCAGGAGCATGG - Intergenic
986309706 5:6543145-6543167 ATGGAGCAGCCCAAGGACCAAGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
986605684 5:9520849-9520871 CAAGAGAAGCCTAAGGAGACAGG + Intronic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
989241703 5:39209760-39209782 AAAGAGATGCGCCAGGATCAGGG - Intronic
989454595 5:41628383-41628405 ATAGAGAAGCCCAAGAATAAGGG + Intergenic
990542005 5:56782291-56782313 ACAGTGCAGCCCACGGAGCAGGG - Intergenic
991010685 5:61879983-61880005 GAAGAGGAGCCTAAGGAGAAAGG - Intergenic
991103080 5:62815090-62815112 AAAGAGGAGCCCCAGGAGTCTGG + Intergenic
991407245 5:66312116-66312138 ACAGAGAAGCCCAGTTAGCATGG + Intergenic
992063979 5:73086664-73086686 GAAGAGAAGCACAAGATGCAAGG - Intronic
992132977 5:73713264-73713286 AGAGAGAAGACCTAGGAGAATGG - Intronic
992882314 5:81122685-81122707 AATGAAAAGCCCAAGAAGAATGG + Intronic
993397991 5:87414139-87414161 AAAGAGAAGATCAAAGGGCATGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995493763 5:112720537-112720559 AAACAGAGGCCCAAGGAAGATGG + Intronic
995528122 5:113066981-113067003 AAAGAGAGACCCAAGGAGAAAGG - Intronic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
996468199 5:123827548-123827570 AAACAGAAACCCAAAGTGCACGG + Intergenic
997213982 5:132095404-132095426 ACAGAGAAGCACAGGGAGCCAGG + Intergenic
997336826 5:133114520-133114542 TAAGAGAAGTACAAGGAGCTAGG + Intergenic
997736638 5:136217165-136217187 GAAGGGAGGACCAAGGAGCAGGG - Intronic
997902602 5:137781055-137781077 AGAGAGAAGACCAAGGGCCAGGG - Intergenic
998038647 5:138937114-138937136 ATGGAGGAGCCCAGGGAGCAAGG - Intergenic
998210700 5:140195044-140195066 AAAGAAAAACCCCAGTAGCAGGG - Intronic
999078230 5:148817730-148817752 GAAGAGGAGGTCAAGGAGCAGGG - Intergenic
999551552 5:152692923-152692945 ATAGGGAGGCCCAAGGAGAAGGG + Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1002569473 5:180131982-180132004 TGAGAGGAGGCCAAGGAGCAGGG - Intronic
1003485118 6:6568929-6568951 ACAAGGAGGCCCAAGGAGCAAGG + Intergenic
1004376212 6:15092901-15092923 AATGAAAAGCCAAAGGAACAGGG - Intergenic
1004578364 6:16922481-16922503 AACCAGAAGCCCATGGATCATGG - Intergenic
1005668178 6:28078944-28078966 AAATTGAAGCCCACGCAGCAGGG - Intergenic
1005689349 6:28287224-28287246 CAAGAGAAGGGCAAGGAACATGG - Intronic
1006612140 6:35300523-35300545 TGAGAAAAGCCCAAGGAGTAGGG + Intronic
1007418047 6:41703440-41703462 GAGGAGCAGCCCCAGGAGCAGGG - Intronic
1008056149 6:46947910-46947932 AATCAAAGGCCCAAGGAGCAAGG - Intronic
1009377979 6:62994808-62994830 AAAGAGAAGCCAAATGTTCATGG - Intergenic
1009548908 6:65060512-65060534 AGAGAGAAGACCAAGAAGGAAGG - Intronic
1010332800 6:74644662-74644684 AAAGAGAAGCCCAACAATAATGG - Intergenic
1010932521 6:81819656-81819678 AAACAGAAGCCCAAGGATGAAGG - Intergenic
1011548324 6:88504594-88504616 AAAGAGAAGCTGACAGAGCAGGG - Intergenic
1011819657 6:91236407-91236429 AAAGACAACTCCAGGGAGCATGG - Intergenic
1012930520 6:105311354-105311376 TAAGAGAAGCCCAGTGAGTAAGG - Intronic
1013280739 6:108634570-108634592 AAAGAGAAGCCAAGGCAGAAGGG - Intronic
1014422914 6:121267329-121267351 AAAGCGAAGCCCAAGGGGTCAGG + Intronic
1015640729 6:135328598-135328620 AATAGGAAGCCCAAGGAGAAGGG - Intronic
1017192478 6:151668903-151668925 AGAGAGAAGAGCAAGGAGAATGG + Intronic
1017812228 6:157991487-157991509 AAAGAAGAGCCTAAGGAGCCAGG - Intronic
1018593537 6:165453826-165453848 CTAGAGAAGCCCTGGGAGCAAGG + Intronic
1018693516 6:166370010-166370032 AGGGAGCAGCCCCAGGAGCATGG + Intronic
1019105626 6:169664834-169664856 AAAGGGGAGCACAAGAAGCACGG + Intronic
1019606589 7:1913268-1913290 AAGGAGAGGGGCAAGGAGCAGGG + Intronic
1019633476 7:2062941-2062963 AAAGAGAAGCCACAGAAGCGTGG + Intronic
1019709753 7:2512808-2512830 AAAGAGAAGCCTGAGGATCTAGG - Intronic
1022094306 7:27129591-27129613 AAATAGAAGGCCAAGGAGGAGGG + Intronic
1022144185 7:27521064-27521086 AAATAGAAGCCCCAGCAGGATGG + Intergenic
1022964920 7:35463874-35463896 AAAGAGAAGCATCAGAAGCAGGG - Intergenic
1023163537 7:37321419-37321441 AAAGAAAAGCCCTAGGAGGCCGG + Intronic
1023489115 7:40719121-40719143 AAAGATGAGCCCAGGGAGAATGG - Intronic
1023614862 7:42009664-42009686 AATGGGAAGCCCCAGGAGAACGG + Intronic
1024239346 7:47422162-47422184 AAAGAAAAGAGCAAGGAGTAAGG + Intronic
1024698293 7:51879119-51879141 ACAGAGGAGCCCAGGAAGCAAGG + Intergenic
1026061807 7:67033235-67033257 AAAGAGAAGCCAGAGGGACAGGG - Intronic
1026716536 7:72794213-72794235 AAAGAGAAGCCAGAGGGACAGGG + Intronic
1027050112 7:75016505-75016527 CCAGAGAAGCCCAATGTGCAGGG + Intronic
1027629502 7:80585039-80585061 TAGAAGAAGCCCAAGGAACAAGG + Intronic
1029049884 7:97674697-97674719 ACAGGGAAGCCCAAGGAGAATGG - Intergenic
1029382923 7:100225163-100225185 CCAGAGAAGCCCAATGTGCAGGG - Intronic
1030488075 7:110196489-110196511 AAAGAAAAGCCCAAGGAGGGTGG + Intergenic
1030875951 7:114813484-114813506 CAAGAGAAGGCAAAGGAGCAAGG + Intergenic
1031588042 7:123556509-123556531 AAAGAGAAAGCCAAAGAGTAGGG + Intronic
1032319643 7:130874368-130874390 AAAGTGAGGGACAAGGAGCAAGG + Intergenic
1032362082 7:131265410-131265432 AGAAAGAGGCCGAAGGAGCAAGG - Intronic
1033143670 7:138851880-138851902 AAAAAGTGGCCCAAGAAGCAGGG + Intronic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033550496 7:142442778-142442800 AGAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033660225 7:143397572-143397594 AACGAGAATCCCAAGCAGCAAGG + Exonic
1033742091 7:144283630-144283652 GAAGAGCATCCCAAGGAGCTTGG + Intergenic
1033751811 7:144365984-144366006 GAAGAGCATCCCAAGGAGCTTGG - Intronic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034699553 7:153084249-153084271 AAAGAGAATCCCCAGGTGCCGGG + Intergenic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037202615 8:16276242-16276264 AAAAGGAAGGGCAAGGAGCAGGG + Intronic
1037223292 8:16552679-16552701 AAAGAGAAACCCAATGAGATAGG + Intronic
1037561910 8:20082991-20083013 AAGGAGAAGCCAAAGAAACAGGG + Intergenic
1037810272 8:22082585-22082607 AGAGGGAAGCCCTGGGAGCAAGG + Intergenic
1041267738 8:56081599-56081621 ATGGAGAAGCCCATGTAGCAAGG + Intergenic
1043220689 8:77659318-77659340 AAAAAGAAACCCCAGGAGCATGG + Intergenic
1043992516 8:86773512-86773534 CATGAGAAGCCCAAAGTGCAGGG - Intergenic
1046587250 8:116162647-116162669 GAAGAGAAGCCAATGGGGCAAGG - Intergenic
1047034509 8:120922382-120922404 ATAAAGAAGCCCAAGGAGACAGG + Intergenic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1047875829 8:129136748-129136770 GAAGGGAAGCCCTTGGAGCATGG + Intergenic
1048137216 8:131758121-131758143 AAAGAGATGAGGAAGGAGCATGG - Intergenic
1048172490 8:132121122-132121144 AGAGACAAACCCAGGGAGCAAGG + Exonic
1048239388 8:132726126-132726148 AAAGAGAAGTCCTGGGAGCTAGG + Intronic
1048437361 8:134431056-134431078 AAAGAAAAACATAAGGAGCATGG + Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048752707 8:137697968-137697990 GAAGAGAAGCCCAAGGGCAAGGG + Intergenic
1048809340 8:138271000-138271022 AATGAGATGCCCCAGCAGCAAGG + Intronic
1049033883 8:140059691-140059713 AAATAGATGGCCAATGAGCATGG - Intronic
1049782294 8:144434559-144434581 AAAGTCAAACCCAAGGAGGAGGG - Intronic
1050060197 9:1700487-1700509 AAAGAAAAGATCAAGGAGCATGG - Intergenic
1050222612 9:3411336-3411358 AAAGAGGAGAGAAAGGAGCAAGG - Intronic
1052000624 9:23275157-23275179 AAAGAGAAGATCAAAGATCACGG + Intergenic
1053421378 9:37981789-37981811 ATAGAGAGGCCCAAGGAGAGGGG + Intronic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1054252355 9:62731334-62731356 AAGGAGAAGACCAAAGAGCAGGG + Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1055167521 9:73215300-73215322 AAAGAGAAGACCAAGTAATAAGG - Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055428437 9:76219133-76219155 AAAGAGAAGCCCCTGGAGAGAGG - Intronic
1055722008 9:79185425-79185447 ATAAAGAATCCCAAGGAACAGGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056828370 9:89892141-89892163 AAAGAGAAGCTCAGGGGACAGGG - Intergenic
1056890946 9:90491719-90491741 AAAGAGTAGGCCTATGAGCAGGG + Intergenic
1056898915 9:90580584-90580606 AAAGAGAGGCCCATGTGGCAAGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1058112889 9:101050917-101050939 AAAGAGAAGGCTAAGGAGACTGG - Intronic
1058646482 9:107135771-107135793 AAGGAGTAGACCAAAGAGCAAGG - Intergenic
1058879866 9:109276996-109277018 AAACAGAGGCCAGAGGAGCAAGG + Intronic
1059243345 9:112827404-112827426 AAAGATAAACCCAGGAAGCATGG + Intronic
1059809898 9:117844516-117844538 AAAGAGAAGCCCAATAACCTGGG + Intergenic
1060322996 9:122583324-122583346 CAAGAGAAGCCGAAGGAGACAGG + Intergenic
1060565969 9:124591994-124592016 AAAAAGAAACCCCAGTAGCAGGG + Intronic
1060855209 9:126909563-126909585 ATAGAGAAGACCACGCAGCAAGG - Intergenic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1060936682 9:127520037-127520059 AGAGAGAATCCCAAGGGTCAAGG - Intronic
1061894498 9:133640119-133640141 AGAGAGAAAGCCAAGGAGGATGG + Intronic
1062314543 9:135960355-135960377 AGAGAGAAGTCCCAGGAGTAGGG - Intronic
1062548091 9:137072711-137072733 ACAGAGAAGCCCACAGACCAAGG - Intergenic
1186456873 X:9716645-9716667 AAAAAAAATCCCAAGGAGGAGGG - Exonic
1187176850 X:16903718-16903740 AACGAAAAGCCCAGGAAGCAGGG + Intergenic
1189744285 X:44154199-44154221 AAAGAGAAGCCCAAGGGCAAAGG - Intronic
1190277312 X:48907222-48907244 AAATAGAAGCCCTAGGAGCTGGG + Intronic
1190568428 X:51755625-51755647 AAAGAGAAGAAAAAGGAACAAGG - Intergenic
1190873143 X:54441529-54441551 AAAGAGGAGCTCAGGGTGCATGG + Intronic
1190915115 X:54805833-54805855 GAAGAGAAGGGCAAGGAGGAGGG - Intergenic
1191690851 X:63936307-63936329 AGAGAAAATCCCAAGGAGAAGGG - Intergenic
1192339771 X:70254262-70254284 AAAGGGCAGCCCAAGAAGAAAGG + Intergenic
1192351185 X:70357721-70357743 AAACAGAAGACAATGGAGCAAGG - Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1193913929 X:87342235-87342257 AACTACAAGCCCAAGGAGTATGG + Intergenic
1194793219 X:98177305-98177327 ACAGAGAAGCCTGAGAAGCAAGG + Intergenic
1195140027 X:101950051-101950073 CAAGGGAAGTGCAAGGAGCAGGG + Intergenic
1195872666 X:109502070-109502092 AGAGAGAGGCCCAAGGTGCCTGG - Intergenic
1196047643 X:111273088-111273110 AAACTGAAGACCAATGAGCATGG - Intergenic
1196091787 X:111751957-111751979 AAAGAGAAGGGCAATGAGCAAGG - Intronic
1196600849 X:117600374-117600396 GAAGAGAAGGACAAGGACCAGGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1196770958 X:119292715-119292737 ATAGAGAAGCCCAAGAAGATAGG + Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1198223880 X:134627743-134627765 AAAGATAGGCCCCAGGACCAAGG - Intronic
1198556941 X:137805047-137805069 AAAGTGAACCCCATGGAGCATGG - Intergenic
1198707856 X:139468690-139468712 AAAGAGAAGACAAAGCACCAAGG + Intergenic
1199527575 X:148809604-148809626 AAAGAGAAGCCCCAGGGGATGGG + Intronic
1200367648 X:155684300-155684322 TCAGAGAAGGCCAAGGAGCTTGG + Intergenic
1200743169 Y:6877323-6877345 AAAGAGAAGCCCCAGACCCAGGG + Intergenic