ID: 1060881612

View in Genome Browser
Species Human (GRCh38)
Location 9:127122010-127122032
Sequence TCTGCCGTGCCGGGAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060881606_1060881612 18 Left 1060881606 9:127121969-127121991 CCTCTAAGCACACACCTACACAC No data
Right 1060881612 9:127122010-127122032 TCTGCCGTGCCGGGAGCTGCCGG No data
1060881605_1060881612 19 Left 1060881605 9:127121968-127121990 CCCTCTAAGCACACACCTACACA No data
Right 1060881612 9:127122010-127122032 TCTGCCGTGCCGGGAGCTGCCGG No data
1060881607_1060881612 4 Left 1060881607 9:127121983-127122005 CCTACACACACGCACACTCCCAG No data
Right 1060881612 9:127122010-127122032 TCTGCCGTGCCGGGAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060881612 Original CRISPR TCTGCCGTGCCGGGAGCTGC CGG Intronic