ID: 1060883912

View in Genome Browser
Species Human (GRCh38)
Location 9:127137265-127137287
Sequence GAGTGGGCCACTAGTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060883912_1060883921 11 Left 1060883912 9:127137265-127137287 CCCTCCAGACTAGTGGCCCACTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060883921 9:127137299-127137321 GAGTCCTTGTCTGGATTGTTTGG No data
1060883912_1060883924 28 Left 1060883912 9:127137265-127137287 CCCTCCAGACTAGTGGCCCACTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060883924 9:127137316-127137338 GTTTGGTTTTTCTGAAGCCAGGG No data
1060883912_1060883923 27 Left 1060883912 9:127137265-127137287 CCCTCCAGACTAGTGGCCCACTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060883923 9:127137315-127137337 TGTTTGGTTTTTCTGAAGCCAGG No data
1060883912_1060883925 29 Left 1060883912 9:127137265-127137287 CCCTCCAGACTAGTGGCCCACTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060883925 9:127137317-127137339 TTTGGTTTTTCTGAAGCCAGGGG No data
1060883912_1060883919 2 Left 1060883912 9:127137265-127137287 CCCTCCAGACTAGTGGCCCACTC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060883919 9:127137290-127137312 GGCCAGTTGGAGTCCTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060883912 Original CRISPR GAGTGGGCCACTAGTCTGGA GGG (reversed) Intronic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
902449069 1:16485200-16485222 GAGTGTCCCACTAGTGGGGATGG + Intergenic
905267211 1:36762854-36762876 GGGTGGGCCACCAGGCTGGGTGG + Intergenic
906327042 1:44853195-44853217 CAGTGAGCCAATAGCCTGGAAGG + Intronic
914375577 1:147070888-147070910 AAGTGGGCCCCTAATCTGGTGGG - Intergenic
1063003892 10:1950598-1950620 GAGTGGGTCAAGAGTTTGGAAGG + Intergenic
1070636663 10:78134139-78134161 GAGAGGGCCACTGCTGTGGATGG + Intergenic
1070789021 10:79178745-79178767 GAGAGGGCCACTGGTCTCCAAGG + Intronic
1073177388 10:101564850-101564872 GAGCGGGCGGCTAGTGTGGAGGG - Intergenic
1079137956 11:17786954-17786976 GTGACGGCCACTAGGCTGGATGG + Intergenic
1081057196 11:38424692-38424714 GAGAGGACCACTAGTGTGGGTGG + Intergenic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1084590346 11:70086521-70086543 CAGTGAGCCACTGGTATGGATGG - Intronic
1085086958 11:73674859-73674881 GTATAGGCTACTAGTCTGGAAGG + Intergenic
1090446549 11:126769441-126769463 GAGTGGGCCCCTCTTCTTGATGG - Intronic
1095637965 12:44454324-44454346 GAATGGGCCATGAGGCTGGAAGG - Intergenic
1102952859 12:117041878-117041900 GTGTGGCCCACTGGTCAGGAGGG - Intronic
1108235782 13:48403576-48403598 GAGTGGGGCAATAATCAGGAAGG + Intronic
1109721681 13:66283456-66283478 GCTTGGGCCACTGCTCTGGAGGG - Intergenic
1111029116 13:82572940-82572962 GTGTGGGTCACTAGTCTGGGTGG - Intergenic
1126709764 15:51443216-51443238 GACTGGGTCCCTAGTCTGCAAGG + Intergenic
1130900456 15:88203055-88203077 GAGTGGGCCAAGTGTCTGCAGGG + Intronic
1134899846 16:17927589-17927611 GATTTGGCCATCAGTCTGGAGGG + Intergenic
1142871426 17:2823585-2823607 GAGTGGCACACTTTTCTGGAGGG - Intronic
1143619780 17:8074161-8074183 GAGTGGGCACAGAGTCTGGAAGG - Intronic
1148762605 17:50014772-50014794 GCTTGGGCCACTACTCTGTAAGG - Intergenic
1148829005 17:50417132-50417154 CAGTGGCCCACGACTCTGGAGGG + Intergenic
1149511661 17:57247181-57247203 GAGATGGACACTAGACTGGAAGG + Intergenic
1157125446 18:44951831-44951853 GAGTTGGCCATCAGTCTGGGTGG - Exonic
1158696704 18:59710045-59710067 GAGTGAGCCACTGGGCTGGCTGG - Intergenic
1159560270 18:69985728-69985750 GCTTGGGCCACCACTCTGGAGGG - Intergenic
1163779389 19:19238426-19238448 GAGGGGGCCACCTGCCTGGAGGG + Intronic
1164569926 19:29366393-29366415 GAGTGGGGAACTGTTCTGGAAGG + Intergenic
925490846 2:4391054-4391076 GCTTGGGCCACAACTCTGGAGGG - Intergenic
927653124 2:24924226-24924248 GAGTTGGCCACTGGTGTGGGAGG + Intergenic
929081126 2:38123421-38123443 CTGTGGGCCTCTATTCTGGAGGG + Intergenic
934854070 2:97718206-97718228 GGGAGGGCCACGAGTCTGCAGGG + Intronic
936586486 2:113762915-113762937 GCATGGGCCACTAATCTGGCAGG - Intergenic
948975964 2:241464150-241464172 GAGGGGGACCCTGGTCTGGAGGG - Intronic
949053787 2:241912996-241913018 GTGTGGGCCCTGAGTCTGGAAGG + Intergenic
1173253284 20:41375717-41375739 GAGGGGTACACCAGTCTGGAGGG + Intergenic
1173635068 20:44548282-44548304 GAGTGGTTTTCTAGTCTGGAGGG + Intronic
1174029600 20:47611835-47611857 GAGTGAGACCCTGGTCTGGAGGG - Intronic
1175565896 20:59976805-59976827 GAATGAGCCACAAGTCTGCAGGG + Intronic
1175903124 20:62367639-62367661 GAGTGGGCCCCTGGGCTGGGAGG - Intergenic
1175977507 20:62718519-62718541 GGGTGGGCCACAGGGCTGGAGGG - Intronic
1181493034 22:23272738-23272760 GGGTGGGCCCCAATTCTGGAGGG - Intronic
1182356778 22:29725783-29725805 GAGAGGGCCCCTAGCCTGGATGG + Intronic
1184866465 22:47204391-47204413 CAGTGGGCCACTATTGTGAAGGG - Intergenic
950849050 3:16044350-16044372 GAGTGGGCCAGTCTTCTTGACGG + Intergenic
960955093 3:123026374-123026396 GAGTGGGCCGAGAGTCTGGATGG - Intronic
962318450 3:134373092-134373114 GAGTGGGGGATGAGTCTGGAGGG + Intronic
963693531 3:148535644-148535666 GTATGGACCACTTGTCTGGATGG - Intergenic
968705481 4:2075565-2075587 GCGTGGGCCACCAGCCTGGCAGG + Intronic
969870724 4:10102963-10102985 GAGTGGGCCACCATTCTAGAAGG + Intronic
971048056 4:22828502-22828524 GAGGTGGCCACTCTTCTGGAAGG - Intergenic
975756293 4:77574671-77574693 GGGTTGGCCACTAGTCTTGGAGG + Intronic
986956327 5:13155027-13155049 GAGTGGGCTACTAGTAGGTAGGG + Intergenic
993606353 5:89994950-89994972 AACTGGGCCACTAGTTTAGAAGG + Intergenic
999273834 5:150315029-150315051 GTGAGGGCTACTTGTCTGGAAGG - Intronic
1002040065 5:176506857-176506879 GATTGGGCCACTCCTCTGAAGGG - Exonic
1002882178 6:1262965-1262987 GACGGGGCCACTAGACTGGTAGG - Intergenic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003326329 6:5094082-5094104 GAATGAGCCACTATTGTGGATGG + Intergenic
1003875760 6:10434849-10434871 GAGTGGGGCCCTAGTCTGATAGG - Intergenic
1004198220 6:13524735-13524757 GAGTGCGACACTAGACTGCATGG - Intergenic
1014022773 6:116610138-116610160 GAGTGGGCTAATAATCTGAAAGG - Intergenic
1014269606 6:119321967-119321989 GAGTGGGCCACTGTTATGGAGGG - Intronic
1016485257 6:144530336-144530358 GTGTGGGGCTCTAGTCTGAAAGG - Intronic
1029427147 7:100502979-100503001 GAGTGGACCACTACTCTACAGGG - Intergenic
1031063778 7:117081970-117081992 GGGTGGGCCATTAATCAGGAAGG + Intronic
1031883470 7:127221841-127221863 GAGTGGACTTCTAGGCTGGAAGG - Intronic
1035342872 7:158175541-158175563 AAGTGGCCCACTCGTGTGGAGGG + Intronic
1048539844 8:135332816-135332838 GGGTGGGCCAGAAGTATGGAGGG + Intergenic
1050918004 9:11161925-11161947 GCTTGGGCCACTTTTCTGGAGGG + Intergenic
1051511714 9:17885971-17885993 GAGTGGGGCTCTAGTCTGATAGG + Intergenic
1053877303 9:42557907-42557929 GGGTGGGCCACCAGTCTTCAGGG - Intergenic
1054234390 9:62543815-62543837 GGGTGGGCCACCAGTCTTCAGGG + Intergenic
1057331648 9:94120697-94120719 GGTAGGGCCACTACTCTGGAGGG + Intergenic
1058436970 9:104971852-104971874 GTGTGCGTCAGTAGTCTGGAAGG + Intergenic
1059319926 9:113461605-113461627 GAGTGGGGCAGGAGTCAGGAGGG + Intronic
1060883912 9:127137265-127137287 GAGTGGGCCACTAGTCTGGAGGG - Intronic
1062465405 9:136678584-136678606 GTGGGGGGCACTAGTCTGCATGG - Intronic
1187191878 X:17043372-17043394 GAATGGCCCACTGGTCTGTAGGG + Intronic
1187820725 X:23285159-23285181 GTGAGAACCACTAGTCTGGAGGG + Intergenic
1189656645 X:43251483-43251505 GCTTGGGCCACTATTCTGAAAGG - Intergenic
1192249713 X:69401583-69401605 GAGTGGTTTACTGGTCTGGAAGG - Intergenic
1195001870 X:100650038-100650060 GACTGGGCCACTTAACTGGATGG + Intronic
1195035090 X:100965143-100965165 GTGTGGGCCACCACTCTGGAAGG + Intergenic