ID: 1060886799

View in Genome Browser
Species Human (GRCh38)
Location 9:127160356-127160378
Sequence TGGGCTGGCCTCAACACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060886799_1060886810 26 Left 1060886799 9:127160356-127160378 CCCCTTGTGTTGAGGCCAGCCCA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1060886810 9:127160405-127160427 GAGGTGAGAGCTGCCCACTCTGG No data
1060886799_1060886809 7 Left 1060886799 9:127160356-127160378 CCCCTTGTGTTGAGGCCAGCCCA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1060886809 9:127160386-127160408 AGGGCTTCTGGAGCAGAACGAGG No data
1060886799_1060886806 -5 Left 1060886799 9:127160356-127160378 CCCCTTGTGTTGAGGCCAGCCCA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1060886806 9:127160374-127160396 GCCCAGCTGCGGAGGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060886799 Original CRISPR TGGGCTGGCCTCAACACAAG GGG (reversed) Intronic
901157848 1:7152516-7152538 AGAGATGGCCTCAACACAGGAGG - Intronic
904599397 1:31665388-31665410 TGGGCTGGGGCCCACACAAGAGG + Intronic
906043023 1:42804185-42804207 TGAGCTGGTCTCAGCACAGGAGG - Intergenic
913048093 1:115090086-115090108 TGGGCTGCCCTCAACCCAGCCGG + Intergenic
916889991 1:169105743-169105765 TGGGCTGGCCTGCAAAGAAGAGG + Exonic
919905605 1:202076235-202076257 TGGGCTGGGCTGAAGATAAGAGG + Intergenic
922219959 1:223550861-223550883 TGGGCTGGCAGCACCACAGGTGG - Intronic
1064509709 10:16076723-16076745 CAGGCTTGCCTCAATACAAGAGG + Intergenic
1066697257 10:38090534-38090556 TGTGCTGGCCGCAACAGAATGGG + Intergenic
1066940713 10:41877996-41878018 TGGAATGGAATCAACACAAGTGG + Intergenic
1066944924 10:41904773-41904795 TGGACTGGAATCAACACGAGTGG + Intergenic
1067564418 10:47326417-47326439 TGGCCTGGCCTCAACACTCCTGG - Intergenic
1067700017 10:48564655-48564677 TGGCCTGGCCCCAGCACATGAGG - Intronic
1069628126 10:69880672-69880694 TGGGCTGACCACATCACATGCGG - Intronic
1073301121 10:102471429-102471451 TGGGCTGGACTTCACTCAAGGGG + Intronic
1077555826 11:3225592-3225614 TGGGCTGGCCTCCAAACTGGAGG - Intergenic
1078776522 11:14398916-14398938 GGGGCAGTCCTCAACAAAAGGGG - Intergenic
1084359239 11:68658945-68658967 TGAGCTGGCCTCCACACAGAAGG + Intergenic
1086423801 11:86664527-86664549 TGGGGTGCCCGGAACACAAGAGG - Intronic
1090903411 11:131052534-131052556 TGGGTTGGACTAAACACAAAAGG + Intergenic
1094368342 12:29707653-29707675 TGGGTTGGCCTCTGCACATGTGG + Intronic
1096537823 12:52286669-52286691 TGGGCTGGCATCACAACAGGAGG - Intronic
1097508550 12:60507182-60507204 TGGGCTGGGCTCAGAACCAGTGG + Intergenic
1100692833 12:97057149-97057171 TAGGCTGGCCTACACTCAAGGGG - Intergenic
1101549199 12:105746436-105746458 TTGGCTGGAGTCCACACAAGTGG - Intergenic
1102999145 12:117371941-117371963 TGGGGTGACCTCAAGGCAAGGGG + Intronic
1103726355 12:122999226-122999248 TGGGCTGCCCTCACCCCAGGAGG + Intronic
1106116972 13:26826265-26826287 TGGCCTGGCCCCACCACCAGTGG + Intergenic
1110472588 13:75876564-75876586 TGGGCTTGTCTCACCACTAGGGG + Intronic
1111843208 13:93474583-93474605 TGGGCTGAACTCAACACACTGGG - Intronic
1118400377 14:65374000-65374022 TGGGCAGGCCTGAAAACAGGAGG - Intergenic
1118810068 14:69266795-69266817 TGGGCTGGCCTCAGTGCATGGGG - Intronic
1120697363 14:87659313-87659335 TGGGCTGGGCTTAAAACCAGTGG + Intergenic
1121584341 14:95052528-95052550 AGGGGTGTCTTCAACACAAGGGG - Intergenic
1121848669 14:97198414-97198436 TGGGCTGGCCTGAACCGAGGTGG - Intergenic
1122131977 14:99609523-99609545 TGGGCTGGCCCCACCCCAAAAGG - Intergenic
1124167838 15:27343988-27344010 TGGCATGGCTGCAACACAAGGGG - Intronic
1125482740 15:40091761-40091783 TGGGCTGCCCTCTTCACATGGGG - Exonic
1128458833 15:67850751-67850773 TGGGCTGGCCTCTTACCAAGTGG + Intergenic
1129670447 15:77605028-77605050 TGTGCTTGCCTGCACACAAGGGG + Intergenic
1130102335 15:80903514-80903536 TGGTCTGGCCAGAACAGAAGAGG + Intronic
1130605816 15:85315750-85315772 AGGTCTGGCCTGAACACAAGGGG + Intergenic
1135293718 16:21261770-21261792 TGGGCTGTCCTCTAAAGAAGTGG - Intronic
1137712141 16:50573828-50573850 TGGGCTGGCCTCAGCCACAGGGG + Intronic
1137772044 16:51024266-51024288 TGGGCTGGCACAAAGACAAGGGG + Intergenic
1138621807 16:58217426-58217448 TGAGCCTGCCTCAACTCAAGGGG - Intergenic
1143779216 17:9220713-9220735 GGGTCAGGCCTCAACAAAAGAGG - Intronic
1145343057 17:21971077-21971099 TGGAATGGAATCAACACAAGTGG + Intergenic
1145343545 17:21974234-21974256 TGGAATGGAATCAACACAAGTGG + Intergenic
1145343868 17:21976230-21976252 TGGAATGGAATCAACACAAGTGG + Intergenic
1145344054 17:21977496-21977518 TGGAATGGAATCAACACAAGTGG + Intergenic
1147961450 17:44170295-44170317 AGGGCTGACCTCAGCACAGGAGG - Intergenic
1148091110 17:45022952-45022974 TGAGCTAGACTCAGCACAAGCGG + Intergenic
1148438222 17:47698324-47698346 GGGGCTGGCCTCCAAACAGGGGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151686400 17:75649500-75649522 TGGGGTGGGCTCAGCAGAAGTGG - Intronic
1152265108 17:79289549-79289571 TGGGCTGTCACCAACACAAAAGG - Intronic
1152695188 17:81740754-81740776 TGGCCTGGCCTGGACCCAAGTGG - Intergenic
1155191777 18:23437018-23437040 TGGGCTGGCCCCAGCCAAAGTGG - Intronic
1156377168 18:36525085-36525107 AGGTCTGGCCTAAACTCAAGGGG - Intronic
1160298271 18:77657039-77657061 TGCGCTGTGCACAACACAAGTGG - Intergenic
1160419720 18:78735671-78735693 TGGGCTGGCACCAGCACACGTGG + Intergenic
1160889286 19:1368860-1368882 TGGGCTGGTCTGAACGCAGGTGG - Intronic
1160889299 19:1368903-1368925 TGGGCTGGTCTGAACGCAGGTGG - Intronic
1161581817 19:5085375-5085397 TGGGCTGGTCACAACACCCGTGG - Intronic
1163785309 19:19272111-19272133 TGGGCAGCCCTCAACCCAGGTGG + Intronic
925648426 2:6062444-6062466 TGGTCTAGGCTCAAAACAAGAGG - Intergenic
928662820 2:33520753-33520775 TGGGATGGACTCAGAACAAGTGG - Intronic
929239631 2:39640353-39640375 TGGCCTGCTCTCAACAGAAGGGG + Intergenic
932971224 2:76545262-76545284 AGGGCTGGTCTCAATACAAATGG + Intergenic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
937275527 2:120681614-120681636 TGGGCTGGGCTTATCCCAAGGGG + Intergenic
941502155 2:166292876-166292898 TGGGATGGCCTGAAGAGAAGAGG - Intronic
1171086609 20:22243700-22243722 TGGGCTGCCCTTAAGACAAGTGG + Intergenic
1171925599 20:31186171-31186193 TGGAATGGAATCAACACAAGTGG + Intergenic
1172312827 20:33931570-33931592 TTGGCTGGCTTCAAGACTAGAGG + Intergenic
1177332503 21:19681559-19681581 TGGGCTGGTCCCCAGACAAGAGG + Intergenic
1177418798 21:20828295-20828317 TGTGCTGGACCCAACACAAATGG - Intergenic
1178100687 21:29265791-29265813 TGGCCTGGCCTTGACACATGGGG - Intronic
1179443368 21:41411571-41411593 TGGGTTGGCCTCCAGCCAAGAGG - Intergenic
1179955529 21:44736179-44736201 TGGGGTGGCCCTAACCCAAGAGG - Intergenic
1181430418 22:22878067-22878089 TGGGCTGGGCTCAACCCACCGGG + Intronic
1182477268 22:30583037-30583059 TGGGCCGGCCTCCACACAGCTGG - Intronic
951460164 3:22942995-22943017 TGGTCTGGCCTCATCACACAGGG - Intergenic
953419349 3:42742508-42742530 CAGGCTGGACTCAACACCAGGGG - Intronic
954176449 3:48849055-48849077 TGGGCTGGCCTCTTCATCAGTGG - Intergenic
954682336 3:52352489-52352511 TGGGAAGGCCTGGACACAAGTGG + Intronic
956124748 3:66000685-66000707 GGGGCAGGACTCAGCACAAGGGG + Intronic
956722231 3:72128282-72128304 TGGGCTACCCTCAACCCACGAGG + Intergenic
960504247 3:118473477-118473499 TGGGCTGGCCTGAAATCAGGTGG - Intergenic
972928368 4:44040324-44040346 TGGGCTGGACTCAAAGCCAGAGG + Intergenic
973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG + Intronic
973359720 4:49154420-49154442 TGGAATGGAATCAACACAAGTGG - Intergenic
973400355 4:49633512-49633534 TGGAATGGAATCAACACAAGTGG + Intergenic
973401361 4:49639856-49639878 TGGGATGGAATCAACCCAAGTGG + Intergenic
976835475 4:89368362-89368384 TAGGCTGGCTTCAACATATGTGG - Intergenic
980761389 4:137238671-137238693 TGGGTTGGCCTCAAGCCAGGAGG + Intergenic
986801117 5:11261282-11261304 TGGTCTTGCCCCAAGACAAGGGG + Intronic
989911485 5:49659627-49659649 TGGGATGGAATCAACACGAGTGG - Intergenic
993501761 5:88674250-88674272 TGGGCTTCCTGCAACACAAGCGG + Intergenic
997519268 5:134512234-134512256 TGGGCTGGCCTCAAGGGAAGCGG - Intergenic
998007904 5:138669409-138669431 TGGGATGGTCTCAACTCAGGAGG + Intronic
998291275 5:140916826-140916848 TGGGCTGGGCTCAGAACCAGAGG - Intronic
999696553 5:154192122-154192144 TTGGCTGGCCTCGACGAAAGAGG + Intronic
1001114684 5:168929837-168929859 TGGGCCGGCCTCCACAGCAGAGG + Intronic
1006012284 6:31053229-31053251 AGGCCTGACCTCACCACAAGTGG + Intergenic
1007349524 6:41258762-41258784 TTGGTTGGCCTCCAAACAAGAGG - Intergenic
1007593837 6:43039381-43039403 TGAGCTGGCAGCAACACAGGAGG - Intronic
1008731873 6:54492284-54492306 TGGGCAAGCCTCACCACAATGGG - Intergenic
1011564274 6:88658119-88658141 TTGGCTGGCCTCCAGACAGGAGG - Intronic
1014809628 6:125870848-125870870 TGTGTTGACCTCAACCCAAGTGG - Intronic
1015578895 6:134702207-134702229 TGTGCTGGGCTCAAAGCAAGTGG - Intergenic
1024562275 7:50654428-50654450 TGGTCTGGCCTTAACAGACGAGG + Intronic
1028868134 7:95736817-95736839 TGGGCTGGGCTCAAAGCCAGAGG - Intergenic
1029598602 7:101550754-101550776 TGGGCTGACATCAGCACACGTGG + Intronic
1032854337 7:135821940-135821962 TGGGCTAGCCTCCACACAAAAGG - Intergenic
1034023587 7:147671796-147671818 TGGGATGGCCCCAAAATAAGAGG + Intronic
1040485654 8:47869134-47869156 TGGGCTGGGCTCAGAACAAGTGG + Intronic
1041394713 8:57378673-57378695 TGGGGTGGTCACAACAGAAGAGG - Intergenic
1045215532 8:100145506-100145528 TGGGCTGGCGTCACCAGGAGCGG + Intronic
1049434520 8:142580190-142580212 TGGGCTGGCCACAGGGCAAGGGG - Intergenic
1052818347 9:33119323-33119345 TGGGCTGGCCACTTCACTAGGGG + Intronic
1056570230 9:87808328-87808350 AGGGCTGGCCTCTGCACTAGGGG + Intergenic
1056852436 9:90095793-90095815 TGGGCTGGCCTCAGCAAGGGTGG - Intergenic
1060886799 9:127160356-127160378 TGGGCTGGCCTCAACACAAGGGG - Intronic
1186657678 X:11632892-11632914 TGAGCTGGCTTCAGCACAAAGGG - Intronic
1189013523 X:37071429-37071451 TGGGCTGGCCTCAAGGCCAGTGG - Intergenic
1193185578 X:78508034-78508056 TTGGCTGGCCTCAAGTCAGGAGG - Intergenic
1194262728 X:91716904-91716926 TTGGTTGGCCTCCACCCAAGAGG - Intergenic
1194439967 X:93920307-93920329 TGGGGTGGCCTCACCATCAGGGG + Intergenic
1199303864 X:146244642-146244664 TGTGCTGGGCTCAAAACCAGTGG + Intergenic