ID: 1060886963

View in Genome Browser
Species Human (GRCh38)
Location 9:127161218-127161240
Sequence GGGTTTGCCACAACCGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060886963_1060886973 17 Left 1060886963 9:127161218-127161240 CCATCCACGGTTGTGGCAAACCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1060886973 9:127161258-127161280 CCATGCTGCTGCTTCAAATAGGG No data
1060886963_1060886971 16 Left 1060886963 9:127161218-127161240 CCATCCACGGTTGTGGCAAACCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1060886971 9:127161257-127161279 CCCATGCTGCTGCTTCAAATAGG No data
1060886963_1060886974 29 Left 1060886963 9:127161218-127161240 CCATCCACGGTTGTGGCAAACCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1060886974 9:127161270-127161292 TTCAAATAGGGCCAGCCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060886963 Original CRISPR GGGTTTGCCACAACCGTGGA TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900634793 1:3657740-3657762 GGGTTGGGCACAGCCGGGGATGG + Intronic
905507870 1:38494482-38494504 GGGTGTGGCACACCTGTGGAGGG - Intergenic
907869680 1:58432015-58432037 GGGTTTGGAACAAATGTGGAAGG + Intronic
912085448 1:105996897-105996919 GGGTTGCCCACAGCCATGGAAGG - Intergenic
912512977 1:110201014-110201036 GGGTTTGCCAGAAACAGGGAAGG + Exonic
920048522 1:203149297-203149319 CGCTCTGCCACAACCCTGGATGG - Intronic
1070548557 10:77473026-77473048 GGGCAGGCCACAGCCGTGGAGGG - Intronic
1072739940 10:97903292-97903314 GGGTTTGTCACAGCTGGGGAAGG - Intronic
1077524631 11:3056951-3056973 GGGTCTGCCAGACCCGTGGCTGG - Intronic
1083724004 11:64619016-64619038 GGGTGGGCCACGACCTTGGAAGG - Intronic
1091218243 11:133916625-133916647 GGGTTTGCCACAGCAGTGAAAGG + Intronic
1094364910 12:29670033-29670055 TGGTTTGCAACAAACTTGGATGG - Intronic
1116273257 14:42799578-42799600 GGGTTTGACACAACAGGGGATGG - Intergenic
1117025554 14:51616423-51616445 GGGTTTGGAACAGCTGTGGAGGG + Intronic
1129946488 15:79543175-79543197 GGGTTTTCCCCAGCTGTGGAAGG + Intergenic
1133768444 16:8853992-8854014 GGAATTGCCAGAACCCTGGAGGG + Exonic
1135785036 16:25341008-25341030 TGGTTTGCATAAACCGTGGAGGG - Intergenic
1138264786 16:55652603-55652625 GTGTTTGCTACAAGGGTGGAGGG - Intergenic
1141629260 16:85277813-85277835 GGGTCTGCCACAGGCATGGATGG - Intergenic
1143660676 17:8322721-8322743 GGGTTTGCAACAGCTGTGGTTGG + Intergenic
1144450485 17:15373616-15373638 TGGTTTCACACAACCTTGGAAGG - Intergenic
1145058446 17:19717726-19717748 GGGTTTGCTACACCCATGGGCGG + Intronic
1147169917 17:38611966-38611988 GGGATTGCTATAACCTTGGAAGG - Intergenic
1151882751 17:76904928-76904950 TGGTTGGCCACCTCCGTGGAAGG + Intronic
1158232249 18:55270159-55270181 GGGTTTGCATCAACTGTGGAGGG + Intronic
1160533916 18:79581096-79581118 GTGTTGGCCACCACCGTGGAGGG + Intergenic
1167477927 19:49711703-49711725 GAGTTTGCCACATCCCTGCAAGG - Intronic
930518161 2:52433205-52433227 GGTTATGCCGCAAGCGTGGAAGG - Intergenic
932578826 2:72980162-72980184 GTGTTGCCCACAACGGTGGAAGG - Intronic
935657861 2:105440147-105440169 GGATGTGCCACAAATGTGGAAGG + Intergenic
945491328 2:210458699-210458721 GGGTTTGCCATCTCAGTGGATGG - Intronic
1170314700 20:15030182-15030204 GGGTTTTCTAGAACTGTGGAAGG + Intronic
952816748 3:37452987-37453009 GGGTTCCCCAAAACCGGGGAGGG - Intronic
964712577 3:159686870-159686892 GGGTCTGGCACATCCTTGGAGGG + Intronic
970011705 4:11466436-11466458 GGGGTTGTCACAACTGGGGAAGG - Intergenic
979203564 4:118008026-118008048 GAGTTTGGCACAACAGTGCATGG + Intergenic
983413929 4:167431891-167431913 GGACTTACCACAGCCGTGGATGG - Intergenic
985151890 4:186955605-186955627 GGGGTTGTCACAACTGAGGAGGG + Intergenic
986928907 5:12794653-12794675 GGGGTTGCCACAGCGTTGGAGGG + Intergenic
993090102 5:83415104-83415126 GGGTTTACAACAACTCTGGATGG - Intergenic
997421735 5:133774366-133774388 TGGGTTGCCACAACTGTAGAGGG + Intergenic
997894232 5:137701800-137701822 GGGTTGACCACAAACATGGAAGG - Intronic
1002065245 5:176648379-176648401 GGGTCTGCCCCTACCGGGGAAGG + Intronic
1007124520 6:39414436-39414458 GGGTTTGCAGCAGCCGTGGTAGG - Intronic
1011180638 6:84616119-84616141 GTGTTACCCACCACCGTGGAGGG + Intergenic
1014663104 6:124198357-124198379 GGGTTTCCCAGAACTGTGGCTGG - Intronic
1018109932 6:160525646-160525668 GTGATTGCCAGAGCCGTGGAAGG - Intergenic
1019313390 7:373657-373679 GGCTTTGAAACAACCGTGCAGGG + Intergenic
1020861502 7:13497559-13497581 TGGTTTGCCACAAACAAGGAAGG + Intergenic
1026864086 7:73811830-73811852 GGGTGTCCCACACCCGTTGATGG - Intronic
1029201167 7:98840213-98840235 GGGGCTGCCACCACTGTGGACGG - Intergenic
1037809267 8:22076959-22076981 GGGTTTGGAACTGCCGTGGAGGG + Intronic
1045286585 8:100796895-100796917 GGGATTTCCACCACCATGGATGG + Intergenic
1053254496 9:36604489-36604511 GGGTTTGACTCAACCCTGGTGGG + Intronic
1056701368 9:88913231-88913253 GGGTTTACCACAAGTGTGTAAGG + Intergenic
1060886963 9:127161218-127161240 GGGTTTGCCACAACCGTGGATGG - Intronic
1062292663 9:135803972-135803994 GGGTTTCCCACAAGCCTGGCTGG - Intergenic
1186173790 X:6904329-6904351 GGGTTTGTCACTGCTGTGGAGGG + Intergenic
1202049230 Y:20763505-20763527 GTGATTGCCACTACAGTGGATGG + Intronic