ID: 1060887978

View in Genome Browser
Species Human (GRCh38)
Location 9:127168919-127168941
Sequence GCGTGTGCTTGTGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1979
Summary {0: 1, 1: 0, 2: 16, 3: 171, 4: 1791}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060887978_1060887981 14 Left 1060887978 9:127168919-127168941 CCCCAGCACACACAAGCACACGC 0: 1
1: 0
2: 16
3: 171
4: 1791
Right 1060887981 9:127168956-127168978 TTGACCTCACAGCCCCGCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060887978 Original CRISPR GCGTGTGCTTGTGTGTGCTG GGG (reversed) Intronic
900089079 1:911528-911550 GCATGTGCTTGCGGGGGCTGGGG + Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215602 1:1479961-1479983 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
900293804 1:1938618-1938640 GTGTGTGTTTGTGTGTGTCGTGG - Intronic
900293911 1:1939210-1939232 GCATATGTGTGTGTGTGCTGGGG + Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900901094 1:5516540-5516562 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
901163364 1:7197623-7197645 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
901520247 1:9778219-9778241 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
902217378 1:14943034-14943056 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
902239906 1:15081574-15081596 GTGTGTGAGTGTGTGTGTTGGGG + Intronic
902332803 1:15738777-15738799 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
902489584 1:16771477-16771499 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
902709948 1:18231945-18231967 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
902741529 1:18441941-18441963 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
902823602 1:18957486-18957508 GCGTGTGGGTGTGGGTGGTGGGG - Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903007784 1:20309939-20309961 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903325149 1:22564953-22564975 GTGTGTGCTTGTGTGTAGGGTGG - Intronic
903589792 1:24446090-24446112 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
904118370 1:28178639-28178661 GTGTCTGCCTGTGTGTGATGGGG - Intronic
904172415 1:28600576-28600598 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
904346774 1:29877746-29877768 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
904409535 1:30317118-30317140 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
904605025 1:31693307-31693329 CCATATGCTTGTGTGTGGTGGGG - Intronic
904858276 1:33516290-33516312 GTGTGTGTTTGTGTGTGATCAGG + Exonic
904957543 1:34297568-34297590 GTGTGTTTGTGTGTGTGCTGGGG - Intergenic
905164294 1:36068100-36068122 GTGTGTGAGTGTGTGTGATGGGG - Exonic
905233669 1:36530745-36530767 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
905410639 1:37765665-37765687 GTGTGTGTGTGTGTGTGATGAGG - Intergenic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
905738167 1:40345462-40345484 AATTGTGCTTGTGTGTGGTGGGG - Intronic
905867843 1:41385929-41385951 GTGTGTGCGTGTGTGTGTGGTGG + Intergenic
906142997 1:43544814-43544836 GGCTGTCCTTGTGGGTGCTGGGG + Intronic
906542683 1:46599990-46600012 GGGTGTGTGTGTGTGTGTTGTGG - Intronic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
906929216 1:50152407-50152429 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
907068364 1:51510184-51510206 GCGTGTGTTTGTGTGTATTGGGG - Intronic
907257753 1:53192681-53192703 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
907311043 1:53539213-53539235 GTGTGTGTTGGTGTGTGTTGGGG - Intronic
907325216 1:53633525-53633547 GCGTGTGAATGTGTGTGACGGGG + Intronic
907460169 1:54601187-54601209 GTGTGTGAGTGTGTGTGTTGGGG + Intronic
907517397 1:55001228-55001250 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
907663478 1:56414559-56414581 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
908127289 1:61043825-61043847 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908153704 1:61330440-61330462 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
908512526 1:64860844-64860866 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
908571445 1:65415445-65415467 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908696308 1:66845838-66845860 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
908696310 1:66845840-66845862 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
908768927 1:67578356-67578378 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
908835956 1:68230597-68230619 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
909047638 1:70729190-70729212 GTGTGTGCTTGTGTGGGCCTGGG - Intergenic
909199534 1:72672614-72672636 GCGTGTGCGTGTGTATTGTGTGG - Intergenic
909302768 1:74034621-74034643 GTGTGTGTCTGTGTGTGCTTTGG - Intronic
909336033 1:74475109-74475131 GTGTGTGTGTGTGTGGGCTGAGG - Intronic
909355389 1:74702948-74702970 GTGTGTGTGTGTGTGTGCGGCGG + Intergenic
909507943 1:76416030-76416052 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
909745583 1:79093240-79093262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
910024128 1:82628591-82628613 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
910227105 1:84947301-84947323 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
910846041 1:91605674-91605696 GTGTGTGTGTGTGTGTACTGGGG - Intergenic
911178613 1:94841924-94841946 CTGTGTGATTCTGTGTGCTGGGG + Intronic
911218241 1:95218862-95218884 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
911253890 1:95611994-95612016 GTGTGTGTGTGTGTGTGATGTGG - Intergenic
911315764 1:96354855-96354877 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
911367138 1:96952213-96952235 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
911664511 1:100538631-100538653 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
912296960 1:108478993-108479015 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
912300027 1:108505314-108505336 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
912443798 1:109717947-109717969 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
912449227 1:109759167-109759189 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
912494230 1:110081114-110081136 ACATGTGTTTGTGTGTGTTGGGG + Intergenic
912933499 1:113983718-113983740 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
913225838 1:116697390-116697412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
913270243 1:117086265-117086287 GTGTGTGCGTGTGTGTGTTAAGG + Intronic
913518229 1:119623052-119623074 GCGTGCGCTTGTGCGTGAAGAGG + Exonic
914244554 1:145876040-145876062 GTGTGTGTTTGTGTGTGTTGGGG - Intronic
914686718 1:149986232-149986254 GTGTGTGTGTGTGTGTGATGGGG - Intronic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
914973158 1:152329952-152329974 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915305057 1:154972526-154972548 GTGTGTGTTTGTGTGTTTTGGGG - Intronic
915578925 1:156801669-156801691 GCTTCTGGTTTTGTGTGCTGGGG + Intergenic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
915833497 1:159153577-159153599 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
915929853 1:160053618-160053640 GTGTGTGTGTGTGTGTCCTGGGG + Intronic
915934440 1:160082490-160082512 GTGTGTGTTTGTGTGTCTTGGGG - Intronic
916088911 1:161291810-161291832 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
916197702 1:162240267-162240289 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
916210050 1:162353043-162353065 GGGTTTGCTTGTCTGTGGTGGGG - Intronic
916274521 1:162979131-162979153 GTGTGTGTGTGTGTGTGATGAGG - Intergenic
916292169 1:163178700-163178722 GTGTGTATGTGTGTGTGCTGGGG - Intronic
916322922 1:163524905-163524927 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
916499071 1:165370835-165370857 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
916743943 1:167669978-167670000 GCGTGTGCGTGTGTGTCCTGAGG - Intronic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917250816 1:173058672-173058694 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
917442524 1:175079968-175079990 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
918117268 1:181508159-181508181 GTGTGTGTGTGTGTGTGATGGGG + Intronic
918358120 1:183724960-183724982 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
918395703 1:184111208-184111230 GGGTGTGTGTGTGTGTGATGAGG - Intergenic
918422884 1:184381942-184381964 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
918439138 1:184548210-184548232 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
918674570 1:187266896-187266918 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
918894366 1:190320672-190320694 GAGTGTGTGTGTGTGTGTTGGGG - Intronic
919059355 1:192611290-192611312 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
919109048 1:193193813-193193835 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919421682 1:197377117-197377139 GCATGTGTTTGTATGTGTTGGGG - Intronic
919468419 1:197949791-197949813 GGGTGTGTTTGTGTGTGTGGTGG - Intergenic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
919915797 1:202138290-202138312 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
919924228 1:202184176-202184198 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
919981533 1:202645062-202645084 GTGTGTTCATGTGTGGGCTGGGG + Intronic
920047608 1:203143551-203143573 GTGTGTGTTTGTGTGTGCAGGGG + Intronic
920074810 1:203328138-203328160 GTGTGTGCTTCTGTGTCCTGGGG - Intergenic
920191231 1:204195127-204195149 GGGTGTGTGTGTGTGTGCTGGGG - Intronic
920349903 1:205331064-205331086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
920353112 1:205350857-205350879 GCATGTGTGTGTGTGTGCTGAGG + Intronic
920402232 1:205683159-205683181 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
920612801 1:207458055-207458077 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
920657286 1:207886396-207886418 GCTGGTGCCTGTGTCTGCTGAGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920669458 1:207991948-207991970 ACGTGTGTGTGTGTGTGTTGGGG - Intergenic
920829838 1:209454106-209454128 GGGTGTGTGTGTGTGTGGTGTGG - Intergenic
920932314 1:210400502-210400524 GGGCCTGCTGGTGTGTGCTGGGG + Exonic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921070438 1:211653812-211653834 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
921335790 1:214084500-214084522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
921348773 1:214214166-214214188 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
921384589 1:214555717-214555739 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
921945477 1:220883278-220883300 GTGTGTGTGTGTGTGTACTGGGG - Intronic
922420690 1:225459491-225459513 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
922456238 1:225775852-225775874 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
922746406 1:228046746-228046768 ATGTGTGCTTGTGTGTGGTGGGG + Intronic
922924687 1:229338534-229338556 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
923024399 1:230193453-230193475 GCGTGAGCCTCTGTGTGCTGGGG + Intronic
923024407 1:230193505-230193527 GCGTGCGCCTCTGTGTGCTGGGG + Intronic
923048026 1:230369616-230369638 CCGTGTCTGTGTGTGTGCTGGGG + Intronic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923502558 1:234578208-234578230 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
923518565 1:234718358-234718380 GTGTGTGTGTGTGTGTGCCGGGG + Intergenic
923530853 1:234811048-234811070 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
923869088 1:237971558-237971580 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
924026081 1:239834143-239834165 GTGTGTGTGTGTGTGTGATGTGG - Intronic
924215744 1:241820034-241820056 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
924291508 1:242541566-242541588 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
924490192 1:244528780-244528802 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1062794841 10:336904-336926 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794853 10:337015-337037 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794857 10:337056-337078 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062825651 10:566614-566636 GCCTGGGCTTCTGTGTGCTGGGG - Intronic
1062887090 10:1025005-1025027 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1062981151 10:1724195-1724217 GCATGTGCCTGTGTGTCCTCAGG + Intronic
1063033374 10:2258943-2258965 ATGTGTGCCTGTGTGTGTTGGGG - Intergenic
1063039244 10:2319986-2320008 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1063457260 10:6192695-6192717 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1063651668 10:7944119-7944141 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1063745474 10:8874978-8875000 GAGTGTGTGTGTGTGTGTTGTGG + Intergenic
1063794809 10:9501548-9501570 GTGTGTGTGTGTGTGTGCTTTGG + Intergenic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1064506075 10:16031609-16031631 GCGTGTGTGTGTATGTGATGGGG - Intergenic
1064570038 10:16683167-16683189 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1064584466 10:16825657-16825679 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1064858733 10:19801272-19801294 GGGTGTAGTGGTGTGTGCTGTGG + Intergenic
1064906158 10:20348037-20348059 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1065752601 10:28900978-28901000 GAATGTGTGTGTGTGTGCTGGGG + Intergenic
1065856019 10:29830948-29830970 GAGTTTGGTTGTTTGTGCTGGGG - Intergenic
1066048872 10:31617767-31617789 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1066444084 10:35465973-35465995 GTGTGTGTCTGTGTTTGCTGTGG + Intronic
1066478447 10:35771321-35771343 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1067001694 10:42620540-42620562 GGGTGTGGTGGTGTGCGCTGTGG - Intronic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067295629 10:44973792-44973814 GTGTGTGTTGGTGTATGCTGCGG + Intronic
1067390705 10:45860505-45860527 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1067414480 10:46093019-46093041 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067434545 10:46267561-46267583 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067581511 10:47449527-47449549 ACCTCTGCCTGTGTGTGCTGGGG + Intergenic
1067956888 10:50801392-50801414 GGGTGTGTGTGTGTGTGTTGGGG + Exonic
1068362857 10:56002212-56002234 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1068461721 10:57337764-57337786 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1068461758 10:57338534-57338556 ACGTGTGTGTGTGTGTGTTGTGG + Intergenic
1068603869 10:58984018-58984040 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1068877044 10:62008057-62008079 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1069304075 10:66946760-66946782 GTGTGTGCCTGGGTGTGGTGGGG - Intronic
1069580456 10:69562712-69562734 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1069684078 10:70306129-70306151 GCGTGTGTGTGTGTGGGGTGGGG - Intronic
1069709789 10:70480829-70480851 GTGAGTGCGTGTGTGTGCTCAGG + Intronic
1069778916 10:70942693-70942715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1069846359 10:71374519-71374541 GGGTGTGTGTGTGTGTGTTGTGG + Intergenic
1070137892 10:73710740-73710762 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1070528407 10:77314919-77314941 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070637334 10:78139777-78139799 GAGTGTGCTGCTGTGGGCTGTGG + Intergenic
1070676174 10:78413146-78413168 GCGTGCACATGTGTGTGTTGGGG + Intergenic
1070772972 10:79093131-79093153 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070805697 10:79269452-79269474 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070809072 10:79288509-79288531 GTGTGTGCGTATGTGTGTTGGGG - Intronic
1070809918 10:79292556-79292578 CAGTGTGCTTGGGTGTGGTGGGG + Intronic
1070820505 10:79351391-79351413 GGGTGGGCTTGGGTGGGCTGAGG + Intronic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1071192415 10:83116959-83116981 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1071290736 10:84187248-84187270 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1071403634 10:85305147-85305169 GCGTGTGTGTGTGCATGCTGGGG - Intergenic
1071498851 10:86189492-86189514 GCGTGTGTGTGTGTGTGTAGAGG - Intronic
1071956130 10:90761648-90761670 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072775179 10:98184059-98184081 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1072798728 10:98376837-98376859 GTGTGTGTTTGTGTGTGCTGTGG + Intergenic
1072816327 10:98512808-98512830 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1073046857 10:100644496-100644518 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1073050997 10:100667423-100667445 GTGTGTGCTGGTGGGGGCTGGGG + Intergenic
1073061959 10:100738496-100738518 GAGTGTGCTTGAGTGTTGTGAGG - Intronic
1073111210 10:101063985-101064007 GTGTGTGCTTGTTTGTGCATTGG + Intronic
1073131688 10:101193148-101193170 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1073152541 10:101321772-101321794 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
1073153906 10:101331365-101331387 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1073157338 10:101358029-101358051 GTGTGTGTTTGTGTGTTTTGGGG - Intronic
1073201077 10:101736361-101736383 GGGTGTGGTTGTGTGTGCTGTGG + Intergenic
1073207606 10:101776849-101776871 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1073403781 10:103278865-103278887 TCGTGTGTGTGTGTGTGTTGGGG - Intronic
1073578561 10:104643728-104643750 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1073747345 10:106484332-106484354 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1073802718 10:107060115-107060137 GTGTGTGTGTGTGTGTGATGAGG - Intronic
1074163838 10:110857789-110857811 ACGTGTGCGTGTGTGTGTTCAGG - Intergenic
1074180849 10:111061488-111061510 GCCTGTGGGTGTGTCTGCTGAGG + Intergenic
1074454614 10:113586460-113586482 GCGTGTGTGTGTGTGTGGGGGGG + Intronic
1074465520 10:113678626-113678648 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1074465546 10:113678802-113678824 GCGTGTGTGTGTGTGTTGTGGGG + Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1074869152 10:117563559-117563581 GGGTGTGCTTGTGTGTCCATGGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075516711 10:123114646-123114668 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1075649991 10:124121515-124121537 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075893294 10:125972889-125972911 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1075895524 10:125991261-125991283 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1075956306 10:126526019-126526041 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1076330474 10:129660771-129660793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1076530985 10:131144049-131144071 GCGTGTGCGTGTGTCTTCAGTGG - Intronic
1076546352 10:131248274-131248296 GTGTGTGTGTGTGTGTCCTGTGG - Intronic
1076595313 10:131621436-131621458 GTGTAGGCTTGTGTGTGTTGTGG + Intergenic
1076805926 10:132858716-132858738 GCGTGTGCCTGTGGCTGGTGGGG + Intronic
1077020516 11:415307-415329 GTGTGTGCGTGTGTGTTGTGGGG + Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077314872 11:1914594-1914616 GTGTGTGTGTGTGTGTTCTGGGG + Intergenic
1077314944 11:1915151-1915173 GTGTGTGTGTGTGTGTTCTGGGG + Intergenic
1077314972 11:1915446-1915468 GCGTGTGTGTGTATGTGTTGTGG + Intergenic
1077477909 11:2799386-2799408 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1077538964 11:3137800-3137822 CAGTGTGTTTGTGTGTGATGAGG - Intronic
1077755088 11:5019705-5019727 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1077772032 11:5229715-5229737 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1077953740 11:6990737-6990759 GCGTGTGTGTGTGTGTTTTGGGG - Intergenic
1078011764 11:7577713-7577735 GTGTGTGCCTGTGTGTGGTAGGG + Intronic
1078120247 11:8500335-8500357 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1078448506 11:11422990-11423012 GTGTGTGCTTGTGTGAACAGTGG - Intronic
1078498852 11:11848996-11849018 ATGTGTGCTTGTGTGTGGTTGGG - Intronic
1078650088 11:13182461-13182483 GCGTGCGTGTGTGTGTGTTGTGG + Intergenic
1078778022 11:14411494-14411516 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079128350 11:17734270-17734292 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1079282757 11:19102614-19102636 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1079394100 11:20046591-20046613 GTGTGTGTGTGTGTGTGATGGGG - Intronic
1079732681 11:23955140-23955162 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1079899589 11:26165389-26165411 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080156579 11:29118465-29118487 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080318541 11:30978775-30978797 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1080567109 11:33520680-33520702 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080641446 11:34160771-34160793 GCGTGTGAGTGTGTGTGCGTTGG + Intronic
1080709348 11:34731862-34731884 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1081049695 11:38322965-38322987 GCGTGTGTGTGTGTGTGTGGTGG + Intergenic
1081373937 11:42337491-42337513 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081504985 11:43706704-43706726 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1081632704 11:44700695-44700717 GTGTGTGTGTGTGTATGCTGGGG + Intergenic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081681416 11:45008018-45008040 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081977647 11:47245868-47245890 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1082276149 11:50223611-50223633 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1082783529 11:57304085-57304107 GCGTGTGTTTGTGTCAGGTGTGG - Intronic
1083735122 11:64675813-64675835 GTGTGAGCTGGTGTGAGCTGGGG - Intronic
1083795737 11:65015559-65015581 GCGTGTGTGTGTGTGTGGCGGGG + Intronic
1083882989 11:65557647-65557669 CCGTGAGCGTGTCTGTGCTGTGG + Exonic
1084215408 11:67644727-67644749 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1084302812 11:68262317-68262339 GGGGCTGCTTGTGTTTGCTGTGG + Exonic
1084409084 11:68995914-68995936 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084646309 11:70460663-70460685 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084679495 11:70658204-70658226 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1085123374 11:73981675-73981697 GGGTGGGCTTGTGTGTCTTGGGG - Intronic
1085297963 11:75441552-75441574 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1085448277 11:76615545-76615567 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085507305 11:77067653-77067675 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1085527197 11:77171211-77171233 GCGTGTGTATGTGCATGCTGAGG + Intronic
1085683144 11:78596803-78596825 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1086146595 11:83559246-83559268 GGGTTTGCTTGGGTGTGCAGGGG + Intronic
1086189977 11:84067551-84067573 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1086551315 11:88056019-88056041 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1087183397 11:95160834-95160856 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1087327530 11:96741988-96742010 GAGTGGGTGTGTGTGTGCTGAGG - Intergenic
1087642112 11:100766227-100766249 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1087781456 11:102305124-102305146 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1087966686 11:104423471-104423493 GTGTATGCTTCTGTGTGATGAGG - Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088200721 11:107330639-107330661 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088234283 11:107705826-107705848 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1088543632 11:110938292-110938314 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1088727223 11:112649993-112650015 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
1088865009 11:113839246-113839268 GCCTGTGCCTGTGTATGCTATGG - Intronic
1088902306 11:114127488-114127510 GCATGTGTGTGTGTGTACTGGGG - Intronic
1088990586 11:114950142-114950164 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1089340063 11:117751099-117751121 GTGTGTGTTTGTGTGTGCGCAGG + Intronic
1089456851 11:118630880-118630902 GTGTGTTCCTGTGTGTCCTGGGG + Intronic
1089460154 11:118648315-118648337 GTGTGTGTGTTTGTGTGCTGGGG + Intronic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1089807976 11:121108555-121108577 GTGTGTGTGTGTGTGTACTGGGG - Intronic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090646673 11:128772023-128772045 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1090807896 11:130213751-130213773 GCGCGTGTGTGTGTGTGTTGGGG + Intergenic
1090907864 11:131093216-131093238 GTGTGTGTGTGTGTGTGGTGCGG + Intergenic
1091023928 11:132125289-132125311 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1091040003 11:132268569-132268591 GTGTGTGTCTGTGTGTGGTGTGG + Intronic
1091072313 11:132579401-132579423 GTGTGTGTGTGTGTGTGATGAGG + Intronic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1091116710 11:133019923-133019945 GCATGTGCATGTGTGCACTGGGG - Intronic
1091129885 11:133136859-133136881 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1091215943 11:133901963-133901985 TGGTGTGCATGTGTGTGATGCGG - Intergenic
1091332970 11:134744883-134744905 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1091372446 11:135072404-135072426 CTGGGGGCTTGTGTGTGCTGAGG - Intergenic
1091437615 12:485054-485076 GAGGGTGCTTCTGGGTGCTGGGG - Intronic
1091486763 12:896881-896903 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1091535360 12:1402610-1402632 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1091616883 12:2056221-2056243 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1091710923 12:2739782-2739804 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091782635 12:3223551-3223573 ACGTGTGCGTGTCTGTGCTTTGG + Intronic
1091799511 12:3316087-3316109 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1092049135 12:5455529-5455551 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1092082887 12:5732755-5732777 CCTTGTGATTGTGTGTGGTGGGG - Intronic
1092105913 12:5921679-5921701 GCGTGTGGTTCTGTGTGTGGAGG - Intronic
1092165188 12:6338005-6338027 GTGTGTGCTTGTGTGTGGGGAGG - Intronic
1092204717 12:6607667-6607689 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1092351551 12:7760018-7760040 GTGTGTGTGTGTGTGTGATGTGG - Intergenic
1092482070 12:8868458-8868480 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092989338 12:13880058-13880080 GTGTGTGCTTTTCTGTGCAGGGG - Intronic
1093112997 12:15175371-15175393 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1093379492 12:18475369-18475391 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1093519245 12:20028908-20028930 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1093787292 12:23207360-23207382 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1093788419 12:23218525-23218547 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1093830443 12:23749963-23749985 GAGTGTGTGTGTGTGTGCTAGGG + Intronic
1094005005 12:25740046-25740068 GTGTGTGCGAGTGTGTGGTGAGG - Intergenic
1094078818 12:26509988-26510010 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1094098755 12:26737998-26738020 GCGTGTGTGTGTGTGTTGTGGGG - Intronic
1094123862 12:27002039-27002061 GTGTGTGCGTGTGTGTTGTGGGG - Intronic
1094211639 12:27899580-27899602 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1094218808 12:27971788-27971810 GTGTGTGCGTGTGTGTGTTTTGG - Intronic
1094282109 12:28751796-28751818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1095082698 12:38025768-38025790 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1095640691 12:44482180-44482202 GAGAGAGCTTCTGTGTGCTGAGG - Intergenic
1095827742 12:46547836-46547858 GCATGTGCTTGTGTGTGAGGAGG + Intergenic
1095909041 12:47407045-47407067 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1096303543 12:50453221-50453243 ACGTGTGTTTGTGTGTGGCGGGG + Intronic
1096451589 12:51747115-51747137 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1096513361 12:52143943-52143965 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1096592305 12:52668513-52668535 GCGTGTGTGTGTGTGTTGTGGGG - Intergenic
1096750635 12:53756736-53756758 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
1096793358 12:54058973-54058995 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097008033 12:55932615-55932637 ATGTGGGCTTGTCTGTGCTGAGG - Intronic
1097008045 12:55932688-55932710 GCGTGTGTGTGTGTGTGTAGAGG - Intronic
1097493798 12:60302180-60302202 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1097555188 12:61127785-61127807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1097636077 12:62123720-62123742 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1097931644 12:65193758-65193780 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1098359152 12:69638348-69638370 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1098579775 12:72085617-72085639 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1098761413 12:74429923-74429945 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1098981561 12:76962129-76962151 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1099063203 12:77938948-77938970 GTGTGTGTGTGTGTGTTCTGTGG + Intronic
1099198226 12:79645031-79645053 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1099301945 12:80907081-80907103 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1099433615 12:82618518-82618540 GAGAGTGATTTTGTGTGCTGGGG + Intergenic
1099653917 12:85465275-85465297 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1099767613 12:87008570-87008592 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1099775924 12:87130212-87130234 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1099884315 12:88508567-88508589 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1099941612 12:89195647-89195669 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1100221147 12:92505745-92505767 GCGCGTGCGTGTGTGTTTTGGGG + Intergenic
1100235301 12:92654685-92654707 GAGTGTGTTTGTGTGTTGTGGGG - Intergenic
1100418622 12:94406475-94406497 GAGTGTGTGTGTGTGTGGTGGGG + Intronic
1100936001 12:99666880-99666902 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101717273 12:107321472-107321494 GTGTGTGTTTGTGTGTGTTGGGG + Intronic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1101915897 12:108895819-108895841 GTGTGTGCTTCTGTGTGTAGGGG + Intronic
1101966307 12:109284571-109284593 GCGTGTGTGTGTGCGCGCTGTGG + Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102237871 12:111305916-111305938 GCATGTGTTAGTGTGTGCTGTGG + Intronic
1102660977 12:114528242-114528264 GCGTGTGTTTGTGTGTGTGTGGG + Intergenic
1103055371 12:117816023-117816045 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103134667 12:118497414-118497436 GCATGTTCTTGTGGGTGCAGTGG - Intergenic
1103165782 12:118769315-118769337 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103210044 12:119159001-119159023 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1103306793 12:119971447-119971469 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1103360786 12:120352375-120352397 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103452834 12:121041540-121041562 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103576758 12:121883220-121883242 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1103908984 12:124341663-124341685 GCCTGGGGTTGTGCGTGCTGTGG - Intronic
1103971718 12:124676692-124676714 GTGTGTGCGTGTGTGTGCGCGGG + Intergenic
1104045570 12:125160286-125160308 CCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104112288 12:125715412-125715434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104346891 12:128008118-128008140 GTGTGTGTGTGTGTATGCTGTGG - Intergenic
1104478042 12:129086214-129086236 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1104513154 12:129399879-129399901 GCGTGTGTGTGTGTGTGGGGGGG + Intronic
1104610738 12:130225667-130225689 GAGTGGGTGTGTGTGTGCTGGGG - Intergenic
1104661837 12:130616920-130616942 GGGACTGCTTGTGTGGGCTGTGG + Intronic
1104814246 12:131636917-131636939 GCGTGTGTGTGTGTGTGTAGGGG - Intergenic
1104980531 12:132571419-132571441 GCGTGTGCTGGTGTGTGTGCTGG - Exonic
1105577805 13:21669894-21669916 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1105613240 13:21987505-21987527 GTGTGTGTTTGTGTGTGTTATGG - Intergenic
1105937456 13:25115414-25115436 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937461 13:25115466-25115488 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937466 13:25115508-25115530 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105977489 13:25485284-25485306 GCGTGTGTGTGTGTATGTTGGGG + Intronic
1106059054 13:26268252-26268274 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1106132120 13:26949192-26949214 GTGTGTGTTCCTGTGTGCTGGGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106219984 13:27738287-27738309 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1106305658 13:28506876-28506898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1106350972 13:28930383-28930405 GGGTCGGCTTGTGTGTGGTGGGG + Intronic
1106408045 13:29490991-29491013 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1106468306 13:30032517-30032539 GCATGTGTTTGTGTGTGCATGGG + Intergenic
1106546943 13:30738929-30738951 GAGTGTGTGTGTGTGTGTTGGGG - Intronic
1106584121 13:31042682-31042704 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1106812885 13:33377612-33377634 GTGTGTGTGTGTGTGTCCTGGGG - Intergenic
1106841561 13:33690178-33690200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1107030821 13:35852009-35852031 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1108065698 13:46575528-46575550 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1108244269 13:48499107-48499129 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1108458495 13:50641640-50641662 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1108537459 13:51399726-51399748 GTGTGTGCGTGTGTGTAGTGGGG + Intronic
1108614546 13:52118814-52118836 GTGTTTGTGTGTGTGTGCTGGGG - Intronic
1108626351 13:52232578-52232600 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1108646628 13:52436214-52436236 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1108659719 13:52573906-52573928 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1108739148 13:53317278-53317300 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1109087363 13:57992046-57992068 GGTTGTGTTTGTGTGTGGTGAGG - Intergenic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1109539339 13:63752270-63752292 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1109544505 13:63827564-63827586 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1109595469 13:64548377-64548399 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1110012503 13:70355465-70355487 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1110427985 13:75391027-75391049 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1110671241 13:78181355-78181377 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1110798683 13:79669994-79670016 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1110839457 13:80125240-80125262 GTGTGTGTTTGTGTGTGGCGGGG - Intergenic
1111531773 13:89545879-89545901 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1111656964 13:91166002-91166024 GACTGTGCGTGTGTGTGTTGGGG + Intergenic
1111768005 13:92559352-92559374 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1112163992 13:96898118-96898140 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1112503156 13:99957365-99957387 GCGTGAGCGTGTGTGTGGGGGGG + Intergenic
1112562141 13:100524395-100524417 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1112688526 13:101861713-101861735 GCGTGTGTGTATGTGTGCTGTGG - Intronic
1113020638 13:105882375-105882397 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1113036914 13:106060880-106060902 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1113379505 13:109788585-109788607 GTGTATGATTGTGTGTGTTGGGG + Intergenic
1113413276 13:110108742-110108764 GCATGAGGTTGTGTGGGCTGTGG + Intergenic
1113667888 13:112153600-112153622 GAGAGTGCGGGTGTGTGCTGTGG + Intergenic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113901399 13:113800325-113800347 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1113957079 13:114104816-114104838 GGGTGAGCATGTGTGGGCTGGGG - Intronic
1113964011 13:114142034-114142056 GTGTGTGCTTGTGTGTGTGAGGG - Intergenic
1114185701 14:20400296-20400318 GCGTGTGTGTGTGTGTGCAGTGG + Intronic
1114219339 14:20682943-20682965 GCGTGTGTTTGTGTGTAGGGTGG - Intergenic
1114626699 14:24135101-24135123 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1114724301 14:24918447-24918469 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1114927231 14:27419307-27419329 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1115125425 14:29987318-29987340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1115369203 14:32593007-32593029 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115473701 14:33794391-33794413 GTGTGAGTGTGTGTGTGCTGGGG - Intronic
1115497859 14:34024866-34024888 GAGTGTGGGTGTGTGTGTTGGGG - Intronic
1115841895 14:37481556-37481578 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115901631 14:38157613-38157635 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1116373230 14:44162770-44162792 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1116776669 14:49189191-49189213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1116860862 14:49994615-49994637 GTGTGCGTGTGTGTGTGCTGGGG + Intronic
1117164844 14:53022984-53023006 GCATGAGCTTGTGTGTGGTGTGG + Intergenic
1117267673 14:54107018-54107040 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
1117754130 14:58956578-58956600 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1117903437 14:60559797-60559819 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1117971713 14:61257630-61257652 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
1118043044 14:61938022-61938044 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1118106455 14:62665650-62665672 GGGTGTGTGTGTGTGTGTTGCGG - Intergenic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118222558 14:63868734-63868756 GTGTGTATGTGTGTGTGCTGGGG + Intronic
1118223700 14:63879062-63879084 GGGTGTGCTGGTATGTGCTAAGG + Intronic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1119105503 14:71919593-71919615 GCCTGCACATGTGTGTGCTGGGG + Intergenic
1119262801 14:73247664-73247686 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262836 14:73247918-73247940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262860 14:73248103-73248125 GTGTGCGCGTGTGTGTGTTGTGG + Intronic
1119262872 14:73248181-73248203 GTGTGTGTCTGTGTGTGTTGTGG + Intronic
1119262884 14:73248257-73248279 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119717062 14:76866958-76866980 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1119744200 14:77032883-77032905 GCGGGTGTGTGTGTGTGTTGCGG + Intergenic
1119756339 14:77122633-77122655 TAGTGTGCTTGGGTGTGTTGGGG - Intronic
1119871971 14:78025821-78025843 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1119996712 14:79261627-79261649 GTGTGTGTGTGTGTGTGATGGGG + Intronic
1120015706 14:79470980-79471002 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1120410548 14:84149486-84149508 GTGTGTGCTTGTGTGTGGGTAGG + Intergenic
1120476059 14:84988833-84988855 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1120584600 14:86296502-86296524 GCGTGTCTCTGTGTGTGGTGGGG - Intergenic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120690897 14:87591134-87591156 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1121115206 14:91338455-91338477 GCCTGAGCCTGTGTGTCCTGGGG - Intronic
1121374605 14:93396791-93396813 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1121563331 14:94890451-94890473 GTGTGTACGTGTGTGTGGTGTGG + Intergenic
1121608374 14:95258070-95258092 GTGTGTGCTTGTGTGGGGTGTGG + Intronic
1121608464 14:95259082-95259104 TTGTGTGTTTATGTGTGCTGTGG + Intronic
1121660751 14:95633242-95633264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121746197 14:96295722-96295744 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1121843389 14:97153011-97153033 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121843678 14:97155240-97155262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121860861 14:97316750-97316772 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1122082854 14:99278543-99278565 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1122153926 14:99739138-99739160 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1122209912 14:100167311-100167333 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1122283075 14:100635757-100635779 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1122868128 14:104619040-104619062 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1122889926 14:104727522-104727544 TCGTCTGCCTGTCTGTGCTGGGG + Intronic
1122919069 14:104872395-104872417 GGGTGTGCGTGGGTGTGCCGTGG + Intronic
1123064023 14:105607084-105607106 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1123073337 14:105652727-105652749 GGGAGTGCGTGTGTGTGCTGGGG + Intergenic
1123093262 14:105751494-105751516 GGGAGTGTGTGTGTGTGCTGGGG + Intergenic
1123175663 14:106416416-106416438 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1123207235 14:106725324-106725346 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123212256 14:106772318-106772340 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123707951 15:22964269-22964291 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1124193987 15:27604477-27604499 GCTTTTGCTAGTGTGGGCTGTGG + Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124377626 15:29138709-29138731 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1124497221 15:30193798-30193820 GTGTGTTCATGTGTGGGCTGGGG + Intergenic
1124746353 15:32344849-32344871 GTGTGTTCATGTGTGGGCTGGGG - Intergenic
1124827742 15:33115499-33115521 GTGTGTGCGTGTGTGTGTGGGGG - Intronic
1125419329 15:39488321-39488343 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1125521588 15:40350837-40350859 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1125735876 15:41925488-41925510 GCATGTACTAGTGTGTGTTGTGG + Intronic
1125756162 15:42066449-42066471 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1126166641 15:45659214-45659236 GTGTGTGTGTGTGTGTTCTGGGG + Intronic
1126167209 15:45663625-45663647 AGGTGTGGTGGTGTGTGCTGTGG + Intronic
1126282405 15:46970027-46970049 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1126328206 15:47504706-47504728 GTGTGTGTTTGTGTGTGTGGTGG - Intronic
1126646451 15:50879684-50879706 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1126972607 15:54134058-54134080 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1127122499 15:55783877-55783899 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1127294961 15:57601284-57601306 GTGTGTGTGTGTGTGTGATGTGG + Intronic
1127340131 15:58032785-58032807 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127848779 15:62895255-62895277 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128372482 15:67050506-67050528 GCTTGTGTTTGTGTGTGCACGGG - Intergenic
1128552691 15:68608526-68608548 GCGTGCGTGTGTGTGTGTTGGGG + Intronic
1128650517 15:69409219-69409241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128759440 15:70205712-70205734 GAGTGTGATTCTCTGTGCTGAGG + Intergenic
1128896450 15:71377863-71377885 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129086478 15:73098078-73098100 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1129170582 15:73805099-73805121 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1129772468 15:78211521-78211543 AAGTGTGCTTATGTGAGCTGAGG - Intronic
1130757436 15:86779916-86779938 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130852102 15:87804817-87804839 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1130861217 15:87892079-87892101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130879026 15:88039114-88039136 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1131053104 15:89360808-89360830 ATGTGTGCGTGTGTGTGTTGTGG - Intergenic
1131313004 15:91307722-91307744 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1131587814 15:93715395-93715417 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1131988573 15:98069164-98069186 GTGTGTGTTTGTGTGTGGCGGGG - Intergenic
1131998246 15:98154271-98154293 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1132162437 15:99555767-99555789 GAGTTTGCTGGTGTGTGCAGTGG + Intergenic
1132272076 15:100535444-100535466 GTGTGTGCTTGTGTCTGTTTTGG - Intronic
1132316196 15:100892119-100892141 GTGTGTGCTTGTGTGTTCCCAGG - Intronic
1132405491 15:101539799-101539821 GCGTGTGTCTGTGTCTGCAGAGG + Intergenic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132654710 16:1036941-1036963 GACTCTCCTTGTGTGTGCTGTGG + Intergenic
1132938519 16:2494997-2495019 GTGTGTGTGTGTGTGTGATGGGG - Intronic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1133445285 16:5854559-5854581 ATGTGTGCTTGTGTGTGGGGGGG - Intergenic
1133619994 16:7517171-7517193 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1133743913 16:8673422-8673444 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1134115418 16:11544186-11544208 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1134306410 16:13037083-13037105 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1134389832 16:13809090-13809112 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134807648 16:17139408-17139430 ATATGTGCTTGTGTGTGCTGGGG + Intronic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135486107 16:22866390-22866412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1135534048 16:23279081-23279103 GTGTGTGTGTGTGTGTGATGGGG + Intronic
1135705902 16:24674689-24674711 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1135739193 16:24958756-24958778 GCATGTGTCTGTGTGTGTTGTGG - Intronic
1135826952 16:25737359-25737381 GTGTGTGTTTGTGTGTGGGGGGG - Intronic
1135918153 16:26624512-26624534 GTGTCTGTGTGTGTGTGCTGGGG - Intergenic
1136482990 16:30554462-30554484 GTGTGTGTGTGTGTGTGATGGGG - Exonic
1136600933 16:31287939-31287961 GCGTGTACTTGTGTGGGGTGGGG - Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136938142 16:34495260-34495282 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1136961672 16:34853297-34853319 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1137365224 16:47854083-47854105 GTGTGTGCGTTTGTGTGCTGGGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137492393 16:48943992-48944014 GAGGGTGCTTGTGTGGGGTGAGG + Intergenic
1137720316 16:50623850-50623872 GCGTGTGTGTGTGTGTGTAGGGG + Intronic
1137849515 16:51725241-51725263 GTGTGTGTGTGTGTGTGCAGTGG - Intergenic
1137868896 16:51930399-51930421 GCGTGTGTGTGTGTGTGATGAGG - Intergenic
1138059394 16:53874212-53874234 GCTTGTGCATGTGTTAGCTGTGG + Intronic
1138116163 16:54362373-54362395 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1138349161 16:56337345-56337367 GCGTGGGGTTGGGGGTGCTGGGG + Intronic
1138522948 16:57582121-57582143 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1138535027 16:57655319-57655341 GTGTGTGTGTGTGTGTGCTAGGG + Intronic
1138696499 16:58818325-58818347 GCGTGTGTTTGTGTGTGTATGGG + Intergenic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1138936101 16:61725900-61725922 GCGTGTGTGTGTGTGTGGTGTGG + Intronic
1138937468 16:61746552-61746574 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1139060142 16:63240667-63240689 GTGTGTGTTTGTGTGTGTGGGGG - Intergenic
1139250648 16:65492230-65492252 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1139401880 16:66688523-66688545 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1139429215 16:66902095-66902117 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1139956481 16:70695668-70695690 GCGTGTGGTGCTGTGAGCTGCGG - Intronic
1140194876 16:72847725-72847747 GCGTCTGCTTGTTTTTGCTCTGG - Intronic
1140331600 16:74062816-74062838 GTGTGTGCTTGTGTGTGTTAAGG + Intergenic
1140477916 16:75248261-75248283 GCGGGTGCATGTGTGCGTTGGGG - Intronic
1140785205 16:78334787-78334809 GCGTGTGTGTGTGTGTGGAGGGG - Intronic
1140981875 16:80118175-80118197 GTGTGTGTTTTTGTGTGCTTGGG + Intergenic
1141160572 16:81626844-81626866 GAGTGTGTGTGTGTGTCCTGTGG + Intronic
1141307605 16:82881180-82881202 GCATGTGCTTGGGTGTGTAGAGG + Intronic
1141389432 16:83652312-83652334 TCTTGTCCTTGTTTGTGCTGTGG + Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141567511 16:84913057-84913079 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
1141631393 16:85289975-85289997 GCGTGTCCTTGCGGGTGATGGGG + Intergenic
1141644711 16:85361314-85361336 GTGTGTGTTTGTGTGTGGGGGGG - Intergenic
1141686352 16:85572244-85572266 GTGTGTGGTTGTGTGTGGTGTGG - Intergenic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141787101 16:86208871-86208893 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142034019 16:87852670-87852692 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1142034025 16:87852737-87852759 GCGTGTGTGTGTGTGTTTTGGGG + Intronic
1142172609 16:88630759-88630781 GCGTGTGTGTGTGTGTGGGGGGG - Intronic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142291108 16:89193933-89193955 GTGCGTGCCTGTGTGTACTGGGG - Intronic
1142363625 16:89638662-89638684 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142363631 16:89638687-89638709 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142363670 16:89638848-89638870 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142442043 16:90104925-90104947 GCGCGGTCTTGTGTGTGCAGAGG + Intergenic
1142483584 17:233143-233165 ACGTGTGCGTGTGTGTGCAGAGG + Intronic
1142518392 17:488993-489015 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142518397 17:489031-489053 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142673295 17:1497465-1497487 GCGTGTGTGTGTGTGTGTTAGGG - Intronic
1142753026 17:1999677-1999699 GCCTGTGCGTGTGTGTGTGGGGG - Intronic
1142754391 17:2007333-2007355 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1143001170 17:3796177-3796199 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1143015421 17:3888918-3888940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1143019068 17:3907311-3907333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1143378847 17:6483320-6483342 GCCTGGGCCTGGGTGTGCTGGGG - Intronic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1143483021 17:7238199-7238221 GCGTGTGCCTGTGTGTGTCTGGG - Intronic
1143521416 17:7446357-7446379 GTGTGTGTGTGTGTGTGATGCGG + Intronic
1143564618 17:7714149-7714171 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1143590537 17:7884067-7884089 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1143997452 17:11019599-11019621 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1144958731 17:19032969-19032991 GTGTGCGCTTGTGTGTACTGGGG - Intronic
1144976428 17:19141555-19141577 GTGTGCGCTTGTGTGTGCTGGGG + Intronic
1145770733 17:27491335-27491357 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1146241759 17:31235789-31235811 TTGTGTGTATGTGTGTGCTGAGG + Intronic
1146386087 17:32374668-32374690 GTGTGTGCTTGTGTATGTGGGGG + Exonic
1146613277 17:34327735-34327757 GTGTGTGCGTGTGTGTGGGGGGG + Intergenic
1146624196 17:34423642-34423664 ACGTGTGCATGTGTCTGTTGTGG + Intergenic
1146665281 17:34698128-34698150 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1146692149 17:34883881-34883903 GCATGTGTCTGTGTGTGCCGGGG - Intergenic
1146828507 17:36046047-36046069 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1146967677 17:37046726-37046748 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147163372 17:38580273-38580295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147167573 17:38601617-38601639 GCGTGTGTGTGTATGTGTTGAGG - Intronic
1147296576 17:39488092-39488114 GGGTGTGTTGGTGTGTGCCGTGG + Intronic
1147339558 17:39745553-39745575 GTGTGTGTGTGTTTGTGCTGGGG + Intronic
1147341543 17:39755559-39755581 GTGTGTGTTTGTGTGTGTTGAGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147395604 17:40140313-40140335 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147395607 17:40140349-40140371 GGGTGTGTGTGTGTGTGTTGGGG - Exonic
1147395610 17:40140369-40140391 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147568581 17:41552793-41552815 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1147995434 17:44357741-44357763 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1148104337 17:45111386-45111408 GTGTGTGTGTGTGTGTGTTGTGG + Exonic
1148142250 17:45337244-45337266 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148325138 17:46779048-46779070 GTGTGTGTGTGTGTGTGATGGGG - Intronic
1148478394 17:47944219-47944241 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148560056 17:48601004-48601026 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1148647736 17:49228959-49228981 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1148679451 17:49465419-49465441 GCGTGCGCGTGTGTGTACTGAGG + Intronic
1148754120 17:49963611-49963633 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1148771806 17:50071701-50071723 GCGTTTGCTTGTTTCTGCTTGGG + Intronic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149431573 17:56598329-56598351 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1149593844 17:57851670-57851692 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150292577 17:63990208-63990230 GCGTGTGTGTGTGTGTGGAGTGG - Intergenic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1150439488 17:65179665-65179687 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1151174321 17:72274655-72274677 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1151318331 17:73337509-73337531 GTGTGTGTGTGTGTGTGGTGAGG + Exonic
1151364182 17:73606390-73606412 GCAGGTGCTTATGGGTGCTGGGG + Intronic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1151436571 17:74101204-74101226 GCCTGTGCGTGTGTGTGTTCTGG - Intergenic
1151506406 17:74530546-74530568 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151593518 17:75062695-75062717 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151888653 17:76939058-76939080 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152191936 17:78893439-78893461 GCGTGGGGCTGTGTGTGCAGGGG + Intronic
1152258747 17:79255237-79255259 GTGTGTGTGTGTGTGTACTGGGG + Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152526854 17:80893216-80893238 GCCTGTGCCTGTGTGTGCGCCGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859893 17:82690264-82690286 GAGTGTGTTTGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153294789 18:3535096-3535118 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1153463616 18:5364476-5364498 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1153622846 18:6996295-6996317 GCGTGTGTTTATGTGTGCGCTGG - Intronic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1154211566 18:12383514-12383536 GTGTGTGAGTGTGTGTGTTGTGG + Intergenic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1155075574 18:22351183-22351205 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155661137 18:28249501-28249523 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155760783 18:29563097-29563119 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1155812663 18:30258027-30258049 GGCTGTGCTTGTGTGAGCTCAGG - Intergenic
1156170378 18:34476406-34476428 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1156590053 18:38477149-38477171 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1156719253 18:40049667-40049689 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1156789773 18:40956674-40956696 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156801031 18:41114200-41114222 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156824996 18:41420046-41420068 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1156917255 18:42476402-42476424 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156966862 18:43105144-43105166 GTGTGTGTTTGTGTGTGGTATGG + Intronic
1157420896 18:47546777-47546799 TCATGTGCTGGGGTGTGCTGGGG + Intergenic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157588780 18:48822501-48822523 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1157597098 18:48870624-48870646 GTGTGTGGGTGTGTGTGATGTGG + Intergenic
1157614627 18:48979153-48979175 GTGTGTGGGTGTGTGTGATGTGG - Intergenic
1157650672 18:49327021-49327043 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1157791437 18:50535168-50535190 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158262424 18:55622887-55622909 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1158694639 18:59692951-59692973 GTGTGTGTGTGTGTGTGCTTTGG - Intronic
1158819318 18:61140982-61141004 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1158939523 18:62394015-62394037 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
1159690040 18:71476500-71476522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1159831702 18:73285190-73285212 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1160089109 18:75809248-75809270 GCGTGTGTGTGTGTGTGATGTGG + Intergenic
1160135767 18:76270219-76270241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1160235666 18:77084426-77084448 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1160350215 18:78172209-78172231 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1160429123 18:78799421-78799443 GCGTGTGCTTGCATGTGTAGTGG - Intergenic
1161094424 19:2381362-2381384 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1161251673 19:3284181-3284203 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1161280860 19:3444796-3444818 GCGTGTGTGTGTGTGTGCAGGGG - Intronic
1161887488 19:7007955-7007977 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1161901055 19:7119839-7119861 GTGTGTGCGTGTGTGTGTTTGGG - Intronic
1161931956 19:7346652-7346674 GCGTATCCTTGTGTGTCCTCTGG + Intergenic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162098993 19:8328382-8328404 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1162173016 19:8806091-8806113 TTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1162309954 19:9900366-9900388 GCGTGTGCTTGTGTCCACCGTGG - Intronic
1162453572 19:10769034-10769056 GCTCCTGCCTGTGTGTGCTGGGG + Intronic
1162894857 19:13759164-13759186 GCGCCTTCTTGAGTGTGCTGCGG - Exonic
1163006158 19:14397833-14397855 GCTTGTCAGTGTGTGTGCTGGGG - Intronic
1163061587 19:14765607-14765629 GCGTGTCAGTGTGTGTGCTGGGG + Intronic
1163202004 19:15776362-15776384 GCTTGTGGTGGTGGGTGCTGGGG - Intergenic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1163241966 19:16069990-16070012 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1163669629 19:18619968-18619990 GTGTGTGTGTGTGTGTGATGGGG - Intronic
1164024394 19:21338079-21338101 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1164380324 19:27730999-27731021 GTGTGTGTTTGTGTGTGGGGGGG - Intergenic
1164564045 19:29313305-29313327 TTGTGTGCTTGTGTGTTTTGTGG + Intergenic
1164713563 19:30375873-30375895 GTGTGTGCGTGTGTGTGTTAGGG + Intronic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1165137936 19:33682153-33682175 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165354972 19:35299038-35299060 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1165511614 19:36269535-36269557 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165512713 19:36274557-36274579 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513264 19:36277100-36277122 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513819 19:36279653-36279675 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514368 19:36282187-36282209 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514922 19:36284726-36284748 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165515474 19:36287257-36287279 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516024 19:36289795-36289817 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516575 19:36292330-36292352 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517127 19:36294858-36294880 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517679 19:36297381-36297403 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518232 19:36299916-36299938 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518783 19:36302451-36302473 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519331 19:36304981-36305003 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519880 19:36307496-36307518 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165593088 19:36987834-36987856 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1165624184 19:37271097-37271119 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165624730 19:37273625-37273647 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165625272 19:37276163-37276185 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165625801 19:37278687-37278709 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165626345 19:37281215-37281237 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165626885 19:37283740-37283762 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165627427 19:37286264-37286286 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165627963 19:37288788-37288810 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165628504 19:37291314-37291336 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165629044 19:37293837-37293859 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165629587 19:37296365-37296387 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165630129 19:37298892-37298914 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165630672 19:37301430-37301452 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165922247 19:39306726-39306748 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1166232416 19:41432746-41432768 GCGTGTGCGTGTGTGTAGGGAGG + Intronic
1166499962 19:43333051-43333073 GTGTGTGTGTGTGTGTCCTGTGG + Intergenic
1166536196 19:43576471-43576493 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1166711812 19:44942402-44942424 GAGTGTGGCTGTGTGTCCTGTGG + Intronic
1167014285 19:46830191-46830213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167033512 19:46979001-46979023 ACGTGTGTGTGTGTGTGGTGGGG + Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167112902 19:47472190-47472212 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167244577 19:48365485-48365507 GAATGAGGTTGTGTGTGCTGAGG - Intronic
1167415428 19:49368344-49368366 AGGTGTGGTGGTGTGTGCTGTGG + Intronic
1167574658 19:50312306-50312328 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1167805106 19:51777445-51777467 GTGTGTGTTTGTGTGTGGGGTGG + Intronic
1167997070 19:53414430-53414452 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1168006852 19:53497111-53497133 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1168304649 19:55428971-55428993 GTGTGTGCTTGTGTATGCATGGG + Exonic
1168308316 19:55448319-55448341 GTGTGTGTTTGTGTGGTCTGTGG - Intergenic
1168317010 19:55488898-55488920 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1168452453 19:56477128-56477150 GCGGGTGCTTGCGTGGGCGGTGG - Intronic
925059230 2:878332-878354 GAGTGTGCGTGTGTGTGTAGGGG - Intergenic
925160157 2:1677922-1677944 GAGTGTGTGTGTGTGTGCAGCGG + Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925556168 2:5133433-5133455 GTGTGTGTGTGTGTGTGATGTGG - Intergenic
925571215 2:5314740-5314762 TCGTGTGCATATGTGTGGTGGGG + Intergenic
925711561 2:6746197-6746219 GCATGTGTGTGTGTGTGGTGGGG + Intergenic
925937576 2:8780526-8780548 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
926139359 2:10359244-10359266 GTGTGTGCCTATGTTTGCTGCGG + Intronic
926533236 2:14078580-14078602 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
926948527 2:18215943-18215965 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
927364034 2:22273315-22273337 GTGTGTGCTTGTGAGTGCAAAGG + Intergenic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927684934 2:25163974-25163996 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
927780595 2:25936355-25936377 GCGTGTGTGTGTGTCTGCTTAGG + Intronic
927800259 2:26092305-26092327 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928171982 2:29010039-29010061 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928269664 2:29844854-29844876 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
928276770 2:29908275-29908297 GTGTGTGTGTGTGTGTGCTCTGG - Intronic
928281079 2:29946946-29946968 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
928326440 2:30323079-30323101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
928586344 2:32762311-32762333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928611211 2:32993992-32994014 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928683496 2:33726537-33726559 GTGTGTACTTGTGTGTGTTTGGG - Intergenic
928689193 2:33781600-33781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
928729631 2:34216178-34216200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
929313499 2:40451732-40451754 GTGTGTGTGTGTGTGTGATGTGG - Intronic
929414044 2:41729520-41729542 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
929528046 2:42724631-42724653 GTGTGTGTGTGTGTGTGATGGGG - Intronic
929543443 2:42840450-42840472 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
929568676 2:43006337-43006359 TCCTGTGCTTGTGTGGGGTGAGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929774511 2:44920371-44920393 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929774517 2:44920411-44920433 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
929878557 2:45817093-45817115 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
930003464 2:46877707-46877729 GTGTGTGGGTGTGTGTGGTGTGG - Intergenic
930003539 2:46878829-46878851 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
930004923 2:46889041-46889063 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
930154429 2:48091752-48091774 GTGTGTGTCTGTGTGTGGTGAGG - Intergenic
930491542 2:52079277-52079299 GCGTGTGTGTGTGTGTGTTATGG - Intergenic
930500473 2:52210431-52210453 GTGTGAGATTGTGTGTGGTGAGG - Intergenic
930920176 2:56743694-56743716 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931355906 2:61537748-61537770 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
931516574 2:63053728-63053750 GCGTGTGCGTGTGTGTGTGCAGG + Intronic
931688530 2:64815520-64815542 TCATGTGCTTGTCTGTGTTGGGG + Intergenic
931877264 2:66527624-66527646 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
931969443 2:67569359-67569381 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931978875 2:67673057-67673079 GTGTGTGTGTGTGTGCGCTGTGG - Intergenic
932085083 2:68750666-68750688 GCGTCTGTGTGTGTGTGTTGTGG + Intronic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932111729 2:69008083-69008105 GCGTGAGTATGTGTGTGTTGTGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932242622 2:70169242-70169264 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
932274280 2:70440223-70440245 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
932469212 2:71942978-71943000 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
932497233 2:72152000-72152022 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
932563978 2:72894171-72894193 ACGTGTGCTCATGTGTGCGGTGG - Intergenic
932766871 2:74476040-74476062 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
933150687 2:78911316-78911338 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
933179131 2:79210452-79210474 GTGTGTTTGTGTGTGTGCTGTGG - Intronic
933278059 2:80303742-80303764 GGGTGGTCTTGTGTCTGCTGGGG - Exonic
933308556 2:80632273-80632295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
933346440 2:81092209-81092231 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
933704949 2:85282826-85282848 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
933733424 2:85475968-85475990 GTGTGTGTTTGTTTGAGCTGGGG - Intergenic
933897357 2:86823995-86824017 GTGTGTGTGTGTGTATGCTGGGG + Intronic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934661782 2:96146900-96146922 GCTGGAGCTTGTGTGTGCTGGGG + Intergenic
934856723 2:97734438-97734460 GCAGGTGCTTGTGGGGGCTGAGG + Intronic
935346407 2:102112338-102112360 GAGTGTGAGTGTGTGTGTTGTGG + Intronic
935390566 2:102548086-102548108 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935430165 2:102967378-102967400 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
935467873 2:103420851-103420873 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935788864 2:106572326-106572348 ACTTGTGCTTCTGTCTGCTGAGG - Intergenic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
936465570 2:112745794-112745816 GTGTGTATTTGTGTGTGCTGGGG + Intronic
936675949 2:114714127-114714149 GAGTGTGTCTGTGTGTGTTGGGG + Intronic
936899803 2:117469936-117469958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
937000869 2:118466488-118466510 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937260834 2:120586079-120586101 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
937501973 2:122489097-122489119 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
937634346 2:124139259-124139281 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
937645740 2:124264359-124264381 GTGTGTGCCTGTGTGTGTGGGGG - Intronic
938093865 2:128449317-128449339 GCCCATGCTTGTGTGTGCCGGGG - Intergenic
938200904 2:129372588-129372610 GCGTCTGTGTGTGTGTGGTGGGG + Intergenic
938243347 2:129759533-129759555 GCATGTGCTTGTGTGTGGTATGG - Intergenic
938278343 2:130047892-130047914 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938329316 2:130438697-130438719 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938437033 2:131289494-131289516 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
938682500 2:133705679-133705701 GTGTGGGCTCGTGAGTGCTGAGG + Intergenic
938719938 2:134057976-134057998 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
938784472 2:134612538-134612560 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
938917786 2:135960758-135960780 AAGTGTGGTTGTGTGTGCAGTGG - Intronic
938950770 2:136252333-136252355 GTGTGTGTGTGTGTGGGCTGGGG + Intergenic
939012938 2:136868095-136868117 GCGCGTGTGTGTGTGTGGTGTGG - Intronic
939156863 2:138536341-138536363 GCGTGTGTGTGTGTGTGGGGGGG - Intronic
939159294 2:138567417-138567439 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
939185782 2:138858831-138858853 GCGTGTGTCTTTGTGTGTTGGGG + Intergenic
939312995 2:140509057-140509079 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
939392402 2:141585453-141585475 GTGTGTGTGTGTGTGTGATGGGG + Intronic
939704263 2:145432463-145432485 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
940051326 2:149468128-149468150 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
940064681 2:149614154-149614176 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
941026863 2:160465839-160465861 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
941298591 2:163772532-163772554 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
941574405 2:167212908-167212930 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
941677646 2:168361286-168361308 TTGTGTGTTTGTGTGTGGTGGGG + Intergenic
942173557 2:173309753-173309775 GGGTGTGTGTGTGTGGGCTGGGG + Intergenic
942264728 2:174211176-174211198 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
942874466 2:180777620-180777642 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
943537530 2:189171125-189171147 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
943550757 2:189337103-189337125 GTGTATGCTTGTGTGCACTGGGG - Intergenic
943585104 2:189729700-189729722 GTGTGTGTGTGTGTGTGGTGCGG + Intronic
943957161 2:194207373-194207395 GTGTGTGAGTGTGTGTGGTGGGG + Intergenic
944246248 2:197533238-197533260 GGGAGTGCTTGAGTGTGTTGGGG + Intronic
944322356 2:198362318-198362340 CTGTGTGTTTGTGTGTTCTGGGG + Intronic
944348232 2:198694707-198694729 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
945230250 2:207580945-207580967 GCTTGTCCTTGCCTGTGCTGTGG - Intronic
945515402 2:210758218-210758240 GCATGTGTTTGTATGTGTTGAGG + Intergenic
945712124 2:213310315-213310337 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
945877360 2:215292458-215292480 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
945948003 2:216013141-216013163 CTGTGTGCTTGTGTGAGTTGGGG - Intronic
946076027 2:217074381-217074403 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
946310845 2:218881736-218881758 GCATGTGCGTAAGTGTGCTGGGG + Intronic
946312799 2:218892298-218892320 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
946372021 2:219286618-219286640 GCGGGGGCGTGTGTGTGGTGGGG + Exonic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
946925927 2:224626819-224626841 GTGTGTGTCTGTGTGTGTTGGGG - Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947017535 2:225638176-225638198 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947395638 2:229684194-229684216 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
947612420 2:231532269-231532291 GTGTGCGCGTGTGTGTGGTGTGG - Intergenic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
948226302 2:236311720-236311742 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948351217 2:237342767-237342789 GTCTGTCCTTGTGTGGGCTGAGG - Intronic
948563834 2:238871098-238871120 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
948563954 2:238871676-238871698 TCGTGTGTGTGTGTGTGTTGGGG - Intronic
948569450 2:238908503-238908525 TCGTGTGGGTGTGTGTGGTGTGG - Intronic
948682344 2:239644114-239644136 GTGTGTGATCGTGTGTGGTGTGG + Intergenic
949029556 2:241786153-241786175 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
949059477 2:241948790-241948812 GTGTGTGATTGTGTGTGATGGGG + Intergenic
1169399837 20:5270512-5270534 ATGTGTGCTTGTGCGTGCTAGGG + Intergenic
1169802786 20:9528322-9528344 GCGTGTGTGTGTTTGTGTTGGGG + Intronic
1169867436 20:10217335-10217357 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1170133203 20:13044990-13045012 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1170784053 20:19452408-19452430 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1170830643 20:19837165-19837187 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1171062671 20:21981583-21981605 GTGTGTGTTTGTGTCTGTTGGGG + Intergenic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1171179082 20:23078563-23078585 GTGTGTGGGTGTGTGTGTTGGGG + Intergenic
1171368369 20:24642858-24642880 GGGTGTGCTTGTGGCTTCTGGGG + Intronic
1171975827 20:31594013-31594035 GGGTGTGGTTGTGTGTCCTTGGG + Intergenic
1172040846 20:32044396-32044418 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1172135397 20:32683241-32683263 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1172195322 20:33087713-33087735 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1172215087 20:33230040-33230062 GCATGTGTGTGTGTGTGGTGGGG - Intergenic
1172272255 20:33661290-33661312 GCGTGTGTGTGTGTGTGGTAGGG - Intronic
1172579409 20:36035002-36035024 ATGTGTGTGTGTGTGTGCTGGGG - Intergenic
1172594769 20:36143165-36143187 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1172620370 20:36314338-36314360 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1172876210 20:38165667-38165689 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1172904112 20:38356166-38356188 GGGTGTGTTTGTGTGGGGTGTGG - Intronic
1172904159 20:38356403-38356425 GTGTGCGCGTGTGTGTGGTGTGG - Intronic
1172936997 20:38627537-38627559 GTGTGTGTTGGTGTGTGTTGGGG + Intronic
1173005354 20:39135840-39135862 GCGTGTGTGTGTGTGTTTTGGGG + Intergenic
1173057966 20:39634820-39634842 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1173221132 20:41134112-41134134 GCGTGTGCTTGTGTGGGTGCTGG + Intergenic
1173315474 20:41939225-41939247 GTGTGTACTTGTGTAAGCTGTGG - Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173613585 20:44388496-44388518 CCATGTGCTGGTGTGTGATGGGG + Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173676528 20:44840586-44840608 GAGGGTGTTTGTGTGTGGTGGGG - Intergenic
1173753145 20:45492409-45492431 GTGTGTGTGTGTGTGTGCGGTGG + Intergenic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1174136832 20:48385597-48385619 GCATGTGGGTGTGTGTGGTGTGG + Intergenic
1174541804 20:51295777-51295799 GCGTGTGCGTGTGTGTGTCAAGG - Intergenic
1174561489 20:51433771-51433793 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1174788254 20:53453535-53453557 TCGTGTGATTGTGTGTGGAGTGG + Intronic
1174829520 20:53799784-53799806 GAGTGTGTGTGTGTGTGTTGGGG - Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175485933 20:59346268-59346290 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1175498897 20:59435436-59435458 CCGGGTGCATGTGTTTGCTGAGG + Intergenic
1175539953 20:59742159-59742181 GCGTGTGAATTTGTGCGCTGGGG + Intronic
1175571612 20:60027048-60027070 GCGTGTATGTGTGTGTGTTGAGG + Intronic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175599201 20:60259009-60259031 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175814385 20:61875933-61875955 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1176252267 20:64131207-64131229 GCGTGTGCGTGTGTGAGTAGAGG + Intergenic
1176252271 20:64131245-64131267 GCGTGTGCGTGTGTGAGTAGAGG + Intergenic
1176366741 21:6037686-6037708 GCTTGTGCCTGAGTGCGCTGGGG - Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1176600378 21:8788045-8788067 GTGTGTGTTTGTGTGTGTTACGG + Intergenic
1177002302 21:15629284-15629306 GTGTGTGTGTGTGTGTGATGAGG + Intergenic
1177470228 21:21551653-21551675 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1178224694 21:30701790-30701812 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1178439404 21:32586205-32586227 GAGTGTGTGTGTGTGTCCTGAGG + Intronic
1178439406 21:32586235-32586257 GTGTGTGTGTGTGTGTCCTGAGG + Intronic
1178589261 21:33895457-33895479 ACGTGTGCGTGTGTGTGCATGGG + Exonic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1178716008 21:34964975-34964997 GAGTGTGCTTGTGTGTGGTAGGG - Intronic
1178746381 21:35254555-35254577 GTGTGTGCTTGTGTGTGTGTAGG + Intronic
1178750475 21:35297694-35297716 TCGTGTGTGTGTGTGTGGTGAGG - Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178911973 21:36682083-36682105 GTGTGTGGGTGTGTGTGATGTGG + Intergenic
1179129604 21:38622926-38622948 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1179150895 21:38806817-38806839 GTGTTTGCTTGTGTGTGTTTGGG + Intronic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179409411 21:41150880-41150902 ATGTGTGCTTGTGTGTGTGGAGG + Intergenic
1179468448 21:41594262-41594284 GTGTGTGCTGCTGAGTGCTGGGG + Intergenic
1179537323 21:42060982-42061004 GCCTGTGCTGGTGTGGGCGGAGG + Intergenic
1179544196 21:42103645-42103667 GCCTGGCCTGGTGTGTGCTGGGG - Exonic
1179583651 21:42361246-42361268 GTGTGTGCTGCTGTGTGCAGGGG + Intergenic
1179620980 21:42615986-42616008 GTATGTGTTTCTGTGTGCTGTGG - Intergenic
1179623923 21:42637226-42637248 GTGTGCCCGTGTGTGTGCTGTGG - Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179756777 21:43500858-43500880 GCTTGTGCCTGAGTGCGCTGGGG + Intergenic
1179975932 21:44866249-44866271 GCGTGTGTGTGTGTGTGTTATGG - Intronic
1180889276 22:19274002-19274024 GGGTGTGTGTGTGTGTGTTGTGG - Intronic
1181099091 22:20527057-20527079 GCTTGTGCTTCTGTCTCCTGAGG + Intronic
1181596732 22:23920125-23920147 GTGTGCGCGTGTGTGTGATGGGG + Intergenic
1181610870 22:24011072-24011094 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1182012661 22:27013741-27013763 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1182149932 22:28020774-28020796 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1182381617 22:29894520-29894542 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182501938 22:30754378-30754400 TGGTGTCCTTGTGTGTCCTGGGG + Intronic
1182723488 22:32423590-32423612 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182826769 22:33272315-33272337 GTGTGTGCTTGTGTGTACACAGG + Intronic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183186670 22:36295406-36295428 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
1183265341 22:36821519-36821541 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1184096093 22:42317362-42317384 GCGTGTTTATGTGTGTGGTGGGG + Intronic
1184264730 22:43341076-43341098 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184334290 22:43844347-43844369 GGGGGAGCTCGTGTGTGCTGAGG + Intronic
1184397177 22:44249216-44249238 GTGTGTGCGTGTGTGTGATTTGG - Exonic
1184400220 22:44269583-44269605 GCGTGTGTGTGTGTATGGTGTGG - Intronic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1184523533 22:45009015-45009037 GCGTGCGCGTGTGTGTGTTGGGG - Intronic
1184796259 22:46735072-46735094 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184946872 22:47809938-47809960 GTGTATGTATGTGTGTGCTGTGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185189378 22:49424688-49424710 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
949141858 3:643629-643651 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949265202 3:2148954-2148976 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
949382075 3:3457695-3457717 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949528326 3:4928393-4928415 GTGTGTGCGTGTGTGTTGTGGGG + Intergenic
949751698 3:7359238-7359260 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
949905669 3:8856354-8856376 GTGTGTGCGTGTGTGTGGGGGGG + Intronic
949980858 3:9500936-9500958 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
950472747 3:13196774-13196796 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
950724119 3:14905342-14905364 GCGTCTGTGTGTGTGTGTTGTGG + Intronic
951014988 3:17721471-17721493 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
951118125 3:18889682-18889704 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
951425391 3:22538587-22538609 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
951437915 3:22686559-22686581 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
951465542 3:22997167-22997189 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
951685376 3:25338092-25338114 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
952643356 3:35625206-35625228 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
952694689 3:36250831-36250853 GGGTCTGCTTCTGTTTGCTGGGG - Intergenic
952954709 3:38549743-38549765 GTGTGTGCTTGTGTGAGTGGGGG + Exonic
952981052 3:38736389-38736411 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
953031510 3:39182994-39183016 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
953065642 3:39467209-39467231 GGGTGAGCTGGTGTGTGGTGTGG + Intronic
953370575 3:42384783-42384805 GTGTGTGTGTGTGTGTGATGAGG + Intergenic
953412878 3:42700008-42700030 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953412895 3:42700174-42700196 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953631291 3:44620362-44620384 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
953748864 3:45594774-45594796 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
954248692 3:49351972-49351994 GAGTGTGTCTGTGTGTGTTGGGG + Intergenic
954276583 3:49545903-49545925 GTGTGTGTTTGTGTGTGTAGTGG - Intergenic
954590345 3:51777370-51777392 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
954594227 3:51811636-51811658 GTGTGTGCATGTGTGAGGTGTGG - Intergenic
955059921 3:55485482-55485504 GTGTGTGTTTGTGTGTGTAGGGG - Intronic
955327422 3:58020079-58020101 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
955475643 3:59333402-59333424 GTGTGTGCTTGTGGCTTCTGAGG + Intergenic
955534378 3:59907605-59907627 GTGTGTGCATGTGTGCACTGGGG + Intronic
955826997 3:62958064-62958086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
955880631 3:63540926-63540948 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
955919472 3:63940280-63940302 GTGTGTGTGTGTGTGTGATGGGG - Intronic
956167716 3:66408946-66408968 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
956183627 3:66542102-66542124 TTGTGTGTTTGTGTGTGATGAGG + Intergenic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956739784 3:72266815-72266837 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
956933797 3:74076640-74076662 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957747946 3:84368947-84368969 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
957800686 3:85076323-85076345 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
958010148 3:87866840-87866862 GTGTGTGCGTGTGTGTGTTCAGG + Intergenic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
958544034 3:95517505-95517527 GCGTGTGTGTGTGTGTGTTTAGG + Intergenic
959359973 3:105376071-105376093 GTGTGAGTTTGTGTGTGTTGGGG + Intronic
959513169 3:107236429-107236451 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
959679149 3:109072930-109072952 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
959778281 3:110197705-110197727 ACGTGTGTTTGTGTTTGCTGTGG - Intergenic
959783275 3:110262304-110262326 GAGTGTGTGTGTGTGTGTTGGGG - Intergenic
960034299 3:113087042-113087064 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
960084019 3:113571481-113571503 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
960133467 3:114082199-114082221 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
960187769 3:114664600-114664622 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960266329 3:115624878-115624900 GCGTATGCTTGACTGTGGTGGGG + Intronic
960340161 3:116465129-116465151 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960458586 3:117904106-117904128 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
960521987 3:118665542-118665564 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
960692660 3:120363177-120363199 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
960717112 3:120586766-120586788 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
961080310 3:124021319-124021341 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
961207553 3:125097564-125097586 GTGTGTGTGTGTGTGTTCTGAGG + Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961385913 3:126523549-126523571 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
961507815 3:127382923-127382945 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961792779 3:129388508-129388530 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
961793734 3:129394551-129394573 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793750 3:129394686-129394708 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
961810039 3:129516612-129516634 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
962190081 3:133300969-133300991 GTGTGTGTGTGTGTGTACTGGGG - Intronic
962202073 3:133409242-133409264 GTGTGTGTGTGTGTGTACTGTGG + Intronic
962216910 3:133530524-133530546 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
962282140 3:134060068-134060090 GCCTGTGTTTGTGGGTGTTGTGG - Intergenic
962318328 3:134372526-134372548 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
962366785 3:134792113-134792135 GCGTGTGTGTGTGTGTGCAGGGG + Intronic
962577397 3:136767458-136767480 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
962590243 3:136882573-136882595 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
962677116 3:137765330-137765352 GCGTGTGCGTGTGCTGGCTGGGG - Exonic
962690386 3:137890944-137890966 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
962710406 3:138081261-138081283 GCGTGTGTCTGTGTGTAATGGGG - Intronic
962847214 3:139283152-139283174 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
962867866 3:139462554-139462576 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
963023851 3:140899479-140899501 GCTAGGGCTTGTGTGTGCTGAGG - Intergenic
963084526 3:141424648-141424670 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
963116495 3:141734693-141734715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
963322873 3:143828560-143828582 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
964033659 3:152169062-152169084 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964619913 3:158710973-158710995 GTGTGTGCTTGTGTGCACTGGGG - Intronic
964626535 3:158765305-158765327 GCGTGTGTGTGTGTGTGCGAGGG - Intronic
964663784 3:159150579-159150601 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
964809337 3:160646485-160646507 GTGTGTGGGTGTGTGTGTTGGGG - Intergenic
964881523 3:161428524-161428546 GCGTGTGTGTGTGTGTGTAGTGG + Intergenic
965109530 3:164402571-164402593 GTGTGTGTCTGTGTGTGTTGGGG + Intergenic
965370476 3:167855943-167855965 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
965543819 3:169895591-169895613 GTGTGTGTCTGTGTGTGCTGGGG + Intergenic
965765526 3:172126230-172126252 CTGTGTGCTTGTATGTGCTGAGG + Intronic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966129386 3:176620040-176620062 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
966220655 3:177547886-177547908 GCGCGCGCGTGTGTGTGTTGTGG + Intergenic
966470072 3:180279401-180279423 CTGTGTGTTTGTGTGTGTTGGGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
966912560 3:184567497-184567519 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
966928204 3:184659171-184659193 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
966982916 3:185153862-185153884 GTGTGTGGTTGTGTGTGGTTAGG + Intergenic
967089813 3:186125904-186125926 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
967089929 3:186126622-186126644 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
967415269 3:189210115-189210137 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967479786 3:189959896-189959918 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
967665851 3:192171046-192171068 TTGTGTGCCTGTGTTTGCTGTGG - Intronic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967762356 3:193240711-193240733 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
967993672 3:195150757-195150779 GTGTGTGCGTATGTGGGCTGTGG - Intronic
968015313 3:195326527-195326549 GTGTGTCCGTGTGTGTGTTGTGG - Intronic
968131667 3:196195971-196195993 GTGTGTGTGTCTGTGTGCTGGGG - Intergenic
968551302 4:1225093-1225115 GTGTGAGGCTGTGTGTGCTGTGG + Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968891048 4:3368689-3368711 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
968891053 4:3368708-3368730 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
968891059 4:3368728-3368750 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
968958354 4:3730423-3730445 GCGGGTGCTGGTGGGGGCTGGGG + Intergenic
968977455 4:3829455-3829477 GTGTGTGTTTGTAAGTGCTGTGG - Intergenic
969076167 4:4579382-4579404 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
969103023 4:4784310-4784332 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
969333459 4:6493210-6493232 GTGTGTGCTTGTGTGTGGGTGGG - Intronic
969402183 4:6962890-6962912 CCGTGTGTGTGTGTGTGCAGGGG - Intronic
969437257 4:7195180-7195202 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
969686655 4:8679139-8679161 GCTTGTGCTTTTGTGTCCTGTGG + Intergenic
969721929 4:8896783-8896805 GCATGCACTTGTGTGTGCAGAGG - Intergenic
969763529 4:9210209-9210231 GAGTGTGTTTGTGTGTGTGGGGG - Intergenic
969772421 4:9329465-9329487 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969773038 4:9334212-9334234 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969773653 4:9338957-9338979 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969774268 4:9343702-9343724 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969774883 4:9348447-9348469 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969775499 4:9353192-9353214 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969776113 4:9357937-9357959 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969776725 4:9362683-9362705 GAGTGTGTTTGTGTGTGGGGGGG - Intronic
969777342 4:9367428-9367450 GAGTGTGTTTGTGTGTGTGGGGG - Intergenic
970064473 4:12076162-12076184 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
970192599 4:13530057-13530079 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
970712962 4:18885739-18885761 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
971193739 4:24452250-24452272 GTGTGTGTTTGTGTGTGGGGGGG - Intergenic
971670714 4:29553206-29553228 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
971778382 4:30997903-30997925 GTGTGTGTTTGTGTGTGTGGAGG + Intronic
972091753 4:35295191-35295213 GTGTGTGTGTGTGTCTGCTGGGG + Intergenic
972499980 4:39668704-39668726 GTGTGTGTTTGTGTGTGTTTGGG - Intergenic
972562703 4:40242979-40243001 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
972729445 4:41779195-41779217 GCGTGTGTGTGTGTGTAATGTGG - Intergenic
972883611 4:43457204-43457226 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
973242791 4:47975282-47975304 GCAGGTCCCTGTGTGTGCTGGGG - Intronic
973567114 4:52199690-52199712 TGGTGTGGTTGTGTGTGGTGTGG + Intergenic
973726780 4:53784845-53784867 GTGTGTGTTTGTGTGTGTGGAGG - Intronic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974364977 4:60934884-60934906 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974503819 4:62740729-62740751 GTGTGTGTTTGTGTGTGCATGGG + Intergenic
974540868 4:63233003-63233025 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
974571145 4:63650295-63650317 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974589545 4:63926416-63926438 GTGTGTGTTTGTGTGTTCTGGGG + Intergenic
974598547 4:64045287-64045309 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974716356 4:65672405-65672427 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975783283 4:77862004-77862026 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
975930377 4:79514468-79514490 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
975986906 4:80208536-80208558 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
976108640 4:81646360-81646382 GTGTGTGTGTGTGTGTACTGGGG + Intronic
976657450 4:87504167-87504189 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
976955539 4:90893775-90893797 GCGTGTGTGTGTGTGTGTGGGGG + Intronic
977127663 4:93189768-93189790 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
977151209 4:93514416-93514438 GTGTGTGTGTGTGTGTACTGTGG - Intronic
977236310 4:94511594-94511616 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
977665583 4:99643735-99643757 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
977822514 4:101490812-101490834 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
977912293 4:102551380-102551402 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
978993516 4:115118969-115118991 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979291166 4:118980513-118980535 GCATGTGTGGGTGTGTGCTGGGG - Intronic
979366864 4:119835905-119835927 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
979416825 4:120451785-120451807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979615109 4:122733372-122733394 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
979755713 4:124338219-124338241 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980091731 4:128450019-128450041 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
980113597 4:128658319-128658341 GTGTGCGCGTGTGTGTGTTGGGG + Intergenic
980208051 4:129747896-129747918 GTCAGTGCTTGTGAGTGCTGAGG + Intergenic
980968257 4:139544822-139544844 GTGTGTGTTTGTGTGTGGAGGGG + Intronic
980975473 4:139606397-139606419 GCGTGTGATTCTGGGTGCAGTGG + Intronic
981017587 4:139989832-139989854 GTGTTTGTTTGTGTGTGGTGGGG - Intronic
981419691 4:144534941-144534963 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
981424484 4:144587577-144587599 GTGTGTGTGTGTGTGTACTGGGG + Intergenic
981920012 4:150077314-150077336 GTGTGTGCGTGTGTTTGGTGGGG + Intergenic
982037553 4:151361414-151361436 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982228805 4:153189490-153189512 GTGTGTACTTGTCTGTGATGTGG + Intronic
982291869 4:153789534-153789556 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982548357 4:156763106-156763128 GAGTGTGACTGTGTGTGCAGAGG - Exonic
982705120 4:158700551-158700573 GCGTGTGTGTGTGTGTGGTGGGG - Intronic
983111202 4:163751812-163751834 GTGTGTGTGTGTGTGTGATGAGG + Intronic
983327659 4:166278886-166278908 GGGTGTACTTCTGTGTGCTTTGG - Intergenic
983518239 4:168679108-168679130 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
983518326 4:168679497-168679519 GTGTGTGTTTGTGTGTGGTGGGG + Intronic
983662788 4:170147221-170147243 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
983723369 4:170887066-170887088 TCCTGTGCTGGTGTGTTCTGTGG - Intergenic
983818300 4:172160172-172160194 GCGTGTGCGTGTGTGGCCTTTGG + Intronic
983965303 4:173802189-173802211 GTGTGTGCCTGTGTGTGAGGTGG + Intergenic
984136642 4:175948977-175948999 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
984198652 4:176691463-176691485 GCCTGTGTGTGTGTGTGGTGGGG - Intronic
984400100 4:179252359-179252381 GTGTGTGTTTATGTGTGTTGGGG + Intergenic
984538713 4:181010443-181010465 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
984642909 4:182189729-182189751 GCGTGTGGGTGTGTGTGTTGGGG + Intronic
984660659 4:182371224-182371246 GTGTGTGTGTGTGTGTGATGGGG - Intronic
984749972 4:183262790-183262812 GCGTGTGTGTGTGTGTGTTAGGG + Intronic
984782403 4:183537874-183537896 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
984952497 4:185017877-185017899 GTGTGTGTTTGTGTGTGAAGGGG - Intergenic
985027065 4:185748503-185748525 GCTTTTGCTTCTGTGTGGTGGGG - Intronic
985070287 4:186160775-186160797 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985279428 4:188270702-188270724 GCTTGTCCTTGTGTGGGCTCTGG + Intergenic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985595996 5:788330-788352 GCATGTGCCTGTGTGTGCATGGG + Intergenic
985660431 5:1154350-1154372 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985842016 5:2313841-2313863 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
985959448 5:3288957-3288979 GTGTGTGCGTGTATGTACTGAGG - Intergenic
986055928 5:4136478-4136500 GCATGTGTTTGTGTATGTTGGGG + Intergenic
986109795 5:4702224-4702246 GTGTGTGTGTGTGTGTGCTCAGG + Intergenic
986169614 5:5304958-5304980 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986169619 5:5305008-5305030 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986169626 5:5305058-5305080 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986189597 5:5482771-5482793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
986199709 5:5569967-5569989 GCCTGTGCTTGTGGGCCCTGGGG + Intergenic
986271053 5:6231393-6231415 GTGTGTGTTTGTGTGTGGTTTGG - Intergenic
986306172 5:6518663-6518685 GAGTGTTCTTGTGTGAGCAGGGG + Intergenic
986518115 5:8584259-8584281 GCGTGTGTGTGTGTGTAATGAGG - Intergenic
986859859 5:11914226-11914248 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
986994534 5:13592061-13592083 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
987095553 5:14546260-14546282 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
987335642 5:16895749-16895771 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
987385439 5:17324814-17324836 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
987544345 5:19293197-19293219 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
987841673 5:23230669-23230691 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
988565232 5:32315404-32315426 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
988632987 5:32951181-32951203 GTCTGTCCTTGTGTGGGCTGAGG + Intergenic
988841431 5:35087442-35087464 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
988912199 5:35854547-35854569 GCATGTGCTGGTTTGTTCTGGGG - Intronic
988995990 5:36715367-36715389 GCATGTGTGTATGTGTGCTGGGG - Intergenic
989129866 5:38096581-38096603 GTGCATGCATGTGTGTGCTGGGG + Intergenic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
989456997 5:41655469-41655491 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
990016658 5:51071658-51071680 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
990254107 5:53947204-53947226 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
990733355 5:58833319-58833341 GTGTGTGTGTGTGTGTGATGGGG - Intronic
990944645 5:61237185-61237207 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
991459618 5:66844181-66844203 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
992672780 5:79076321-79076343 GCTTGTGTTTGTGTTTGCTAGGG + Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993134874 5:83947389-83947411 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
993233481 5:85270245-85270267 GTGTGTGTTTGTGTGTGTTTTGG - Intergenic
993605662 5:89987887-89987909 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
994136365 5:96291870-96291892 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
994260868 5:97657000-97657022 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
994312215 5:98286706-98286728 GTGTGTGTGTGTGTGTACTGTGG - Intergenic
994709081 5:103244138-103244160 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995083649 5:108083212-108083234 GTGTGTGTGTGTGTGTTCTGAGG - Intronic
995106471 5:108381805-108381827 GTGTGTGCGTGTGTGTGCGCAGG - Exonic
995306106 5:110652267-110652289 GCGTGCACTTTTGTGTGCTTGGG - Intronic
995389011 5:111618580-111618602 GCGTGTGTGTGTGTGTTTTGGGG - Intergenic
995540689 5:113183269-113183291 GTGTGTGTTTGTGTGTGGAGGGG + Intronic
996092912 5:119368459-119368481 GCGTGTGTGTGTTTGTGTTGGGG + Intronic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
996200936 5:120672264-120672286 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
996283183 5:121757070-121757092 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996519413 5:124410242-124410264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
996545104 5:124669644-124669666 GTGTGTGTTTGTGTGTGTTTGGG - Intronic
996581307 5:125035060-125035082 GCGTGTGTGTGTTTGTGTTGGGG + Intergenic
996851756 5:127960796-127960818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
997639737 5:135441426-135441448 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997652587 5:135533612-135533634 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997725586 5:136117499-136117521 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
997863374 5:137439713-137439735 GGTTGTGTTTGTGTGTGGTGGGG - Intronic
997869830 5:137497843-137497865 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
998094550 5:139389908-139389930 GTGTGTGCTTGTGTGGTGTGGGG + Exonic
998103307 5:139451886-139451908 GGGTGTGTGTGTTTGTGCTGTGG + Intronic
998245389 5:140497872-140497894 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
998385179 5:141753362-141753384 GTGTGTGTGTGTGTGTTCTGGGG + Intergenic
998394207 5:141807788-141807810 GCGTGTGTGTGTGTGTGTGGGGG - Intergenic
998502328 5:142644427-142644449 ACGTGTGTATGTGTGTGGTGGGG - Intronic
998508618 5:142692654-142692676 GTGTGTGTGTGTGTGTCCTGGGG - Intronic
998597033 5:143542495-143542517 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
998903617 5:146880209-146880231 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
999254704 5:150203847-150203869 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999298787 5:150477461-150477483 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
999652218 5:153778646-153778668 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
999672107 5:153966888-153966910 GGGTGTGGTTGGGTGTGGTGAGG - Intergenic
999745317 5:154587481-154587503 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
999842450 5:155443469-155443491 GTGTGTGTGTGTGTGTGCTAGGG + Intergenic
1000116030 5:158154175-158154197 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1000346144 5:160315314-160315336 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001007347 5:168064723-168064745 GCATGGGCTGATGTGTGCTGAGG + Intronic
1001010157 5:168090213-168090235 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1001022530 5:168195594-168195616 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1001071602 5:168590071-168590093 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1001091708 5:168746695-168746717 GGGTGTGGTGGTGTGTGGTGTGG + Intronic
1001118862 5:168962307-168962329 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1001300924 5:170533187-170533209 GAGTGTGTGTGTGTGTGTTGAGG + Intronic
1001347449 5:170918397-170918419 GTGTGTGTGTGTGTGTACTGTGG - Intronic
1001552853 5:172617173-172617195 GCGTGTGTGGGTGTGTGCAGGGG - Intergenic
1001685506 5:173591901-173591923 GCCTATGCTTTTATGTGCTGCGG + Intergenic
1001899951 5:175418515-175418537 GTGTGTGTGTGTGTGTGCTTTGG - Intergenic
1001936202 5:175707757-175707779 GCATGTGCTTGTGTCTCCTCAGG + Intergenic
1002095899 5:176830802-176830824 GTGTGTGCGTGTGTGTGCGCTGG + Intronic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002273202 5:178086439-178086461 GCGAGTGCTTGCCCGTGCTGGGG - Intergenic
1002394893 5:178945026-178945048 GCATGTGTGTGTGTGTGTTGAGG + Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002668018 5:180840805-180840827 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1002712936 5:181205751-181205773 GTGTGTGTGTGTGTGTGCGGTGG - Intergenic
1002775286 6:323246-323268 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003114690 6:3276111-3276133 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1003145030 6:3503106-3503128 GCCTGTGCTTCTGTCTGCTTTGG - Intergenic
1003146705 6:3516041-3516063 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1003313095 6:4986412-4986434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1003476066 6:6484221-6484243 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1003683970 6:8282545-8282567 GCGTGGGGTGGTGTGTGCCGGGG + Intergenic
1003821890 6:9907259-9907281 CTCTGTGCTGGTGTGTGCTGCGG - Intronic
1003840613 6:10115349-10115371 GTGTGTGTTTGTGTGTGTTGTGG - Intronic
1003874434 6:10423617-10423639 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004180108 6:13373737-13373759 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1004294014 6:14394006-14394028 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1004526556 6:16414134-16414156 GCGTGAGATTATCTGTGCTGTGG - Intronic
1004673700 6:17821571-17821593 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1004845737 6:19639725-19639747 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1005155398 6:22799855-22799877 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1005179002 6:23082232-23082254 GCGTGTGTGTGTGTGTGATTGGG + Intergenic
1005181894 6:23115650-23115672 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1005188200 6:23186551-23186573 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1006110076 6:31739107-31739129 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1006181453 6:32155602-32155624 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1006208667 6:32374268-32374290 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1006341638 6:33450511-33450533 GTGTGTGTGTGTGTGGGCTGGGG - Intronic
1006342327 6:33453405-33453427 GGGTGTGTGTGTGTGGGCTGGGG + Exonic
1006520267 6:34567254-34567276 GTGTGTGTATGTGTGTTCTGAGG - Intergenic
1006804178 6:36777761-36777783 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1006891890 6:37435765-37435787 ACGTGTGCTTGTGTGGTCTGAGG + Intronic
1006907407 6:37542130-37542152 GGGTGTGCCTGTGTGTATTGTGG + Intergenic
1006921967 6:37633178-37633200 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1006930043 6:37682038-37682060 GGGTGTGTGTGTGTGTGATGTGG - Intronic
1007325761 6:41058394-41058416 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007411272 6:41663341-41663363 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1007490351 6:42216396-42216418 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007609886 6:43142503-43142525 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1007707316 6:43798806-43798828 GCGTGTGTGTGTGTGTGCAGGGG + Intergenic
1007769540 6:44181485-44181507 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1007769556 6:44181819-44181841 GAGTGTGTGTGTGTGTGGTGTGG - Intronic
1007769578 6:44182280-44182302 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1007784490 6:44271892-44271914 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1008045973 6:46851654-46851676 GTGTGTATTTGTGTGTGTTGGGG + Intergenic
1008585380 6:52943752-52943774 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1008585559 6:52945158-52945180 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1008725601 6:54414589-54414611 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1009535334 6:64875225-64875247 TTGTGTGTGTGTGTGTGCTGAGG + Intronic
1009668462 6:66713219-66713241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1009752500 6:67890073-67890095 GTGTGTGGCTGTGTGTGGTGGGG - Intergenic
1009758226 6:67968840-67968862 GCTTGTGAATGTGTGTTCTGTGG - Intergenic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1010279321 6:74005678-74005700 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1010411172 6:75563345-75563367 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1011021626 6:82819936-82819958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1011160149 6:84380880-84380902 GTGTGTGCTTGTGTAGGCAGTGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011372948 6:86659099-86659121 GTATGTGTGTGTGTGTGCTGAGG - Intergenic
1011499987 6:87977423-87977445 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1012209865 6:96506413-96506435 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1012443992 6:99290096-99290118 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1012455007 6:99394055-99394077 GCGGGTGAGTGTGTGTGCGGAGG - Exonic
1012614985 6:101266576-101266598 GTGTGTGTTTGTGTGTGTGGGGG + Intergenic
1012635912 6:101541361-101541383 GTGTGTGGTTGTGTGCGCTGGGG - Intronic
1012687395 6:102268952-102268974 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013745441 6:113339918-113339940 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1014192999 6:118519496-118519518 CCGTGTGCGTGTGTGTGGCGGGG + Intronic
1014237349 6:118973247-118973269 GCGTCTGTATGTGTGTGTTGTGG + Intronic
1014911927 6:127104859-127104881 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1015190344 6:130465272-130465294 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016025754 6:139285253-139285275 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1016269336 6:142270446-142270468 GTGTGTGTGTGTGTGTGATGAGG + Intergenic
1016293485 6:142549481-142549503 GGGTGTGTGTGTGTGTGTTGTGG + Intergenic
1016551759 6:145288960-145288982 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1016688143 6:146904476-146904498 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1016778488 6:147932622-147932644 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1016892795 6:149023134-149023156 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1016942317 6:149492983-149493005 GCCTGTGCCTGCCTGTGCTGGGG + Intergenic
1017304105 6:152896720-152896742 GCGTGTGCGTCTGTGTGGTGCGG - Intergenic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1017562389 6:155642807-155642829 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1017878596 6:158544201-158544223 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1017900556 6:158715594-158715616 GTGTGTGTGTGTGTGTGATGCGG - Intronic
1017907330 6:158765712-158765734 GTGTGTGCTTGTGTGTGGGGTGG - Intergenic
1018090820 6:160346202-160346224 GTGTGTGAGTGTGTGTGGTGGGG + Intergenic
1018240973 6:161774377-161774399 GTGTGTGTGTGTGTGTGCTCAGG - Intronic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1018378837 6:163239675-163239697 GAGTGTGCGTGTGTGTGTAGGGG - Intronic
1018461312 6:164001836-164001858 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1018541795 6:164888708-164888730 GTGTGTGTTTGTGTGTGTAGGGG - Intergenic
1018723337 6:166590617-166590639 GCACGTGCGTGTGTGTGTTGTGG - Intronic
1018776516 6:167022255-167022277 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1018918569 6:168154637-168154659 GCGTGTGAGTGTGTGTGCACAGG + Intergenic
1018935333 6:168270476-168270498 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1019135840 6:169907150-169907172 GCATGTGCCTGTGTGTACAGGGG - Intergenic
1019399572 7:844546-844568 ACTTGTGGTTGTGTCTGCTGTGG + Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019487276 7:1295161-1295183 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019487287 7:1295225-1295247 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019487353 7:1295535-1295557 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019527783 7:1488492-1488514 GTGGGTGCGTGTGTGTCCTGAGG - Intronic
1019551904 7:1607280-1607302 GCGTGTGTGTGTGTGTGACGGGG - Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1019719072 7:2557145-2557167 ACGTGTGTGTGTGTGTGCAGGGG - Intergenic
1019755132 7:2763187-2763209 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1019898150 7:3999121-3999143 GCGTGTGTGTGTGTGTGTTTGGG - Intronic
1020209516 7:6148195-6148217 GGGTATGGTGGTGTGTGCTGTGG + Intronic
1020877673 7:13718505-13718527 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1020953908 7:14715517-14715539 ATGTGTGCCTGTGTGTGTTGGGG - Intronic
1020968522 7:14903237-14903259 GTGTGTGTGTGTGTGTGTTGAGG + Exonic
1021085187 7:16414346-16414368 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1021157997 7:17235795-17235817 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1021293028 7:18869170-18869192 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021905159 7:25326257-25326279 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1021991231 7:26143239-26143261 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1022201821 7:28124377-28124399 GCCTGTGATACTGTGTGCTGTGG + Intronic
1022248070 7:28580424-28580446 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022410606 7:30135965-30135987 GCATGTGTGTGTGTGTGTTGGGG - Intronic
1022518721 7:30992140-30992162 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1022559601 7:31335405-31335427 TAGTGTGGTTGTGTGTGATGGGG - Intergenic
1022977721 7:35574521-35574543 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1023082058 7:36535180-36535202 CTGTGTGCCTGTGTGTGTTGTGG + Intronic
1023463613 7:40428542-40428564 GTGTGTGTGTGTGTGTCCTGTGG + Intronic
1023737807 7:43250114-43250136 GCGTGTGTGTGTGTGTGTTTTGG - Intronic
1024111388 7:46150300-46150322 GCCTGTGCTTGCTGGTGCTGGGG + Intergenic
1024316695 7:48026577-48026599 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1024317871 7:48037773-48037795 GCGCGTGCGTGTGTGTGAGGTGG + Intronic
1024362095 7:48478909-48478931 GCATGTGTTTGTGTGTGTTGAGG + Intronic
1024524843 7:50339241-50339263 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1024602676 7:50998334-50998356 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1024689281 7:51781600-51781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1025069169 7:55883987-55884009 GCATGTGTTTGTGTGTGGCGGGG - Intergenic
1025069197 7:55884251-55884273 GCGTGTGTGTGAGTGTGTTGGGG - Intergenic
1026012268 7:66645845-66645867 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1026053817 7:66967925-66967947 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1026447268 7:70496021-70496043 ACGTGTGCATGTGTGTGGGGGGG - Intronic
1026576621 7:71577412-71577434 GCGTGTGTTTGTGTGTGTCTGGG - Intronic
1027164712 7:75826136-75826158 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1027861795 7:83593318-83593340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1028033166 7:85944410-85944432 GGGTGTGTGTGTGTGTGGTGGGG - Intergenic
1028487930 7:91380289-91380311 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1028649120 7:93130687-93130709 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1028871038 7:95772121-95772143 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029119768 7:98259622-98259644 GTGTGTGTGTGTGTGTGATGGGG + Intronic
1029179303 7:98688432-98688454 GCTTGTGCTTGTGAATGTTGAGG - Intergenic
1029869850 7:103679160-103679182 TTGTGTGCTTGTATGTGTTGGGG - Intronic
1030071573 7:105702541-105702563 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1030275775 7:107720107-107720129 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1030350645 7:108481872-108481894 GGGTGTGTTTGTGTGTGTGGTGG + Intronic
1030375714 7:108751067-108751089 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1030742585 7:113127884-113127906 GCGTGTGTTTGTGTGTGTGGGGG - Intergenic
1030927274 7:115474492-115474514 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1031052769 7:116961578-116961600 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1031136303 7:117887985-117888007 GTGTGTGTGTGTGTGTGCGGGGG + Intergenic
1031155979 7:118112884-118112906 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1031271774 7:119658870-119658892 GTGTGTGTTTGTGTGTGTGGTGG - Intergenic
1031347503 7:120687020-120687042 GTGTGTGTTTGTGTGTGGAGGGG + Intronic
1031636812 7:124110648-124110670 GGGTATGGTGGTGTGTGCTGTGG + Intergenic
1031925602 7:127635323-127635345 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032072997 7:128821165-128821187 GCATGTGCTAGAGTATGCTGAGG - Intronic
1032089673 7:128904983-128905005 GAGTGTGTGTGTGTGTGTTGGGG + Intronic
1032438372 7:131921041-131921063 GTGTATGCTTGTGTGTCCTTTGG + Intergenic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1032566841 7:132955198-132955220 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1033397035 7:140985244-140985266 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1033491562 7:141848479-141848501 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1033571201 7:142630449-142630471 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1033618561 7:143041025-143041047 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1033639330 7:143246051-143246073 GCGTGTGTGTGTGTGTGTTGAGG - Intronic
1034013126 7:147552567-147552589 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1034374726 7:150631894-150631916 TTGTGTATTTGTGTGTGCTGTGG - Intronic
1034418922 7:150978887-150978909 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1034455185 7:151166483-151166505 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1034824626 7:154250403-154250425 GCGTGTGGGTGCGTGCGCTGGGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1034969186 7:155408661-155408683 GGGTGTGGGTGTGTGTGGTGTGG + Intergenic
1034984882 7:155504685-155504707 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1035217906 7:157383627-157383649 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035515567 8:229588-229610 GCGTTTCCTGGTATGTGCTGAGG + Intergenic
1035825886 8:2643805-2643827 GTGTGTGTTTGTGTGTGGGGGGG + Intergenic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036183124 8:6601746-6601768 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036382621 8:8247246-8247268 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1036426225 8:8646860-8646882 GTGTGTGCTAGTGTGTGTTTGGG - Intergenic
1036759492 8:11497465-11497487 GTGTGTGCTGGTGGTTGCTGGGG - Intronic
1037275857 8:17177768-17177790 GTGTGTGTTTGTGTGTGTGGGGG + Intronic
1037382059 8:18296322-18296344 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1037408286 8:18566914-18566936 GTGTGTGCTTGCCTGTTCTGGGG + Intronic
1037431841 8:18821680-18821702 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1037530544 8:19768501-19768523 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1037590125 8:20304911-20304933 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1037619876 8:20554445-20554467 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1038063563 8:23938387-23938409 GCGTGTGTGTGTGTGTGTAGAGG + Intergenic
1038063705 8:23939596-23939618 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1038097887 8:24336044-24336066 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1038155855 8:24989675-24989697 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1038557124 8:28530125-28530147 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1039224288 8:35371171-35371193 GTGTGTGTGTGTGTGTGCAGTGG - Intronic
1039456522 8:37711005-37711027 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1039550926 8:38442379-38442401 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1039557743 8:38488730-38488752 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1039575707 8:38622279-38622301 GTGTGTGTGTGTGTTTGCTGGGG - Intergenic
1039638582 8:39194032-39194054 GAGGGTGCTAGTGTGTACTGGGG + Intronic
1040534811 8:48299543-48299565 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041015881 8:53592876-53592898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041261515 8:56024621-56024643 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041392249 8:57357627-57357649 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1041565393 8:59271943-59271965 GTGTGTGTTTGTGTGTGGTGTGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1041864199 8:62550407-62550429 GTGTGCGCGTGTGTGTGGTGGGG + Intronic
1042188239 8:66158136-66158158 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1042334576 8:67616535-67616557 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1042456678 8:69013543-69013565 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042702644 8:71633447-71633469 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042722746 8:71843027-71843049 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1043146806 8:76668793-76668815 GTGTGTGTTTGTGTGTGGGGGGG + Intergenic
1043744015 8:83851036-83851058 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
1044080943 8:87882953-87882975 GGGAGTGCCTGTGTGTGTTGAGG - Intergenic
1044115312 8:88327801-88327823 GCGTGTGTGTGTGTGTGTCGCGG - Intronic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1044466666 8:92514446-92514468 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1044757482 8:95480111-95480133 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1045052184 8:98337403-98337425 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1045192561 8:99897137-99897159 GCATGTTCCTGGGTGTGCTGCGG - Intergenic
1045254938 8:100511446-100511468 GTGTGTGTGTGTGTGTCCTGTGG + Intronic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1045739139 8:105334144-105334166 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1046717984 8:117587903-117587925 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1046739614 8:117814247-117814269 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1046932053 8:119851488-119851510 TGGTATGCTTTTGTGTGCTGGGG + Intronic
1047118788 8:121876575-121876597 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1047136431 8:122083928-122083950 GCATGTGTCTGTGTGTGGTGTGG + Intergenic
1047148987 8:122239823-122239845 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1047158620 8:122350937-122350959 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1047523602 8:125614583-125614605 GCGTGTGAGTGTGTGTGCGAAGG + Intergenic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1047852730 8:128876387-128876409 GTATGTGTTTGTGTGTGTTGTGG - Intergenic
1048060830 8:130917775-130917797 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048292973 8:133194465-133194487 GGGTGTGTGTGTGTGTGGTGGGG + Intronic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1048501762 8:134983006-134983028 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1048531845 8:135257001-135257023 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1048571787 8:135662872-135662894 GTGTGTGTGTGTGTGTGGTGCGG - Intergenic
1048720942 8:137323802-137323824 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1048995470 8:139791316-139791338 GCGTGTGTGTGTCTGTGCAGGGG - Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049039611 8:140102468-140102490 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1049055526 8:140233618-140233640 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1049191872 8:141292751-141292773 GTGTATGCCTGTGTGTGTTGTGG - Intronic
1049291950 8:141808111-141808133 ATGTGTGTTTGTGTGTGTTGGGG + Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049468979 8:142766928-142766950 GCGTGGGCTCCTGTGTCCTGAGG - Intronic
1049615187 8:143572826-143572848 GCGTGAGCTTGCGGGGGCTGGGG + Exonic
1049721663 8:144118940-144118962 GTGTGTGTGTGTGTGTGCGGCGG - Intergenic
1049754961 8:144306921-144306943 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1049757478 8:144317157-144317179 GGGTGTGTGTGTGTGTGATGTGG - Intronic
1049908670 9:244271-244293 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1049908672 9:244273-244295 GCGTGTGTGTGTGTGTGTGGTGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050146178 9:2570064-2570086 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1050206029 9:3197107-3197129 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051196140 9:14564611-14564633 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1051550030 9:18317389-18317411 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1051779934 9:20679155-20679177 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052105785 9:24513157-24513179 GAGTGGGATTGTGTGTGTTGTGG - Intergenic
1052337135 9:27331470-27331492 GTGTGTGTGTGTGTGTACTGGGG + Intronic
1052394934 9:27927523-27927545 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1052554855 9:30000599-30000621 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1052663951 9:31470661-31470683 GTGCGTGCTTGTGTGTGCAGTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1052883520 9:33621611-33621633 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1052953264 9:34231159-34231181 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1053174685 9:35913404-35913426 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174686 9:35913512-35913534 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174687 9:35913566-35913588 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174689 9:35913718-35913740 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174690 9:35913768-35913790 GTGTGTGTTTTTGTATGCTGTGG + Intergenic
1053174691 9:35913868-35913890 GTGTGTGTTTTTGTATGCTGTGG + Intergenic
1053174692 9:35913918-35913940 GTGTGTGTTTTTGTATGCTGTGG + Intergenic
1053174693 9:35914022-35914044 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174694 9:35914182-35914204 GTGTGTGTTTTTGTTTGCTGTGG + Intergenic
1053174696 9:35914236-35914258 GTGTGTGTTTTTGTATGCTGTGG + Intergenic
1053174697 9:35914338-35914360 GTGTGTGTTTTTGTATGCTGTGG + Intergenic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1053507378 9:38654795-38654817 GGCTGTGCTTGTGTCTTCTGGGG + Intergenic
1053576832 9:39362744-39362766 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1053651416 9:40173658-40173680 GTGTGTATTTGTGTGTGTTGGGG - Intergenic
1053841345 9:42190669-42190691 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1053901810 9:42803011-42803033 GTGTGTATTTGTGTGTGTTGGGG - Intergenic
1054098402 9:60921435-60921457 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1054119803 9:61197065-61197087 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1054533164 9:66202545-66202567 GTGTGTATTTGTGTGTGTTGGGG + Intergenic
1054712878 9:68529195-68529217 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1055128923 9:72752443-72752465 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1055134723 9:72814930-72814952 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1055435649 9:76289464-76289486 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1055575998 9:77660762-77660784 GTGTGTGTGTGTGTGTGCGGTGG - Intergenic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1055601255 9:77921294-77921316 GGGTGTGACTGTCTGTGCTGAGG - Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1056178668 9:84060826-84060848 GCGTGTGAATGTGTGAGCTCAGG + Intergenic
1056331163 9:85522470-85522492 GCGTGTGTGTGTGTGTCCAGAGG - Intergenic
1056541010 9:87571432-87571454 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1056541014 9:87571494-87571516 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1056710209 9:88986457-88986479 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1056755224 9:89377540-89377562 CCGTATGCTTGAGGGTGCTGTGG + Exonic
1056859360 9:90165492-90165514 GCGTGTGTGTGTGTGTGGTGTGG + Intergenic
1057074882 9:92133415-92133437 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1057489080 9:95508079-95508101 GTGTGTGTTTGTGTGTGGCGGGG + Intronic
1057714855 9:97484465-97484487 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1057819310 9:98318897-98318919 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1057930976 9:99192737-99192759 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1057950819 9:99367957-99367979 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1058299272 9:103349742-103349764 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1058327164 9:103713145-103713167 GTATGTGCGTGTGTGAGCTGGGG - Intergenic
1058375194 9:104314811-104314833 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1058902696 9:109456146-109456168 AGGTGTGCGTGTGTGTGTTGGGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059280946 9:113133559-113133581 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1059342061 9:113602873-113602895 TGCTGTGTTTGTGTGTGCTGGGG - Intergenic
1059415065 9:114157071-114157093 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1059516542 9:114901039-114901061 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1059537454 9:115094865-115094887 GTGTGTGCGTTTATGTGCTGGGG + Intronic
1059626892 9:116076878-116076900 GTTTGTTCTTGTCTGTGCTGGGG + Intergenic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1059710396 9:116862791-116862813 GTGTGTATTTGTGTGTGTTGGGG - Intronic
1060084805 9:120688126-120688148 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1060203435 9:121666863-121666885 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1060392872 9:123292794-123292816 ATGTGTGTTTGTGTGTGTTGTGG - Intergenic
1060811127 9:126612047-126612069 GTGTGTGTTTGTGTGTGGTGGGG - Intergenic
1060816310 9:126637314-126637336 GTGTGTCCCTGTGTGTGCTGTGG + Intronic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061083525 9:128386155-128386177 GGGTGTGCCTGTGTGTGTGGAGG - Intronic
1061150291 9:128824294-128824316 GTGTGTGCGTGTGTGTACTAAGG + Intronic
1061227428 9:129288859-129288881 GTGTGTGTGTGTGTGTGATGAGG + Intergenic
1061241764 9:129378603-129378625 GCGAGTGTGTGTGTGTGTTGGGG + Intergenic
1061247447 9:129407989-129408011 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1061433138 9:130543829-130543851 GTGTGTGTGTGTGTGTGATGCGG + Intergenic
1061498791 9:130990617-130990639 GCGTGTGTGTGCGTGTGTTGTGG - Intergenic
1061526124 9:131164221-131164243 ACGTGTGCATGTGTGAGCTAGGG + Intronic
1061638169 9:131928741-131928763 GCGTGTGCTAAAGTGTTCTGGGG + Intronic
1061904806 9:133691165-133691187 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1062130144 9:134888217-134888239 GCAGGAGCTTGTGTCTGCTGAGG + Intergenic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062265869 9:135686201-135686223 GCCTCTGCTTGTGTGCACTGTGG - Intergenic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062616427 9:137398621-137398643 GCGGGTGCCTGTGTGTCTTGGGG - Intronic
1062616449 9:137398721-137398743 GCGGGTGCCTGTGTGTCTTGGGG - Intronic
1062616478 9:137398846-137398868 GCGGGTGCCTGTGTGTCTTGGGG - Intronic
1203655965 Un_KI270752v1:25062-25084 TCGTGTGTGTGTGTGTGTTGGGG - Intergenic
1185650318 X:1642759-1642781 CTGTGTGTTTGTGTGTGATGTGG + Intronic
1185816546 X:3161485-3161507 GAGTATGCTTGTGTGTGGTGAGG - Intergenic
1185994740 X:4933230-4933252 GAGTATGTTTCTGTGTGCTGTGG + Intergenic
1186084169 X:5968491-5968513 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1186229529 X:7438549-7438571 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1186368260 X:8918892-8918914 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1186539176 X:10382706-10382728 GTGTGTGTGTGTGTGTGATGGGG + Intergenic
1186750255 X:12614376-12614398 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1186826214 X:13342511-13342533 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1187231640 X:17429200-17429222 GCATCTGCCTGTGTGTACTGGGG + Intronic
1187270731 X:17776883-17776905 GCGTGTGGTGGGGTGAGCTGTGG - Intergenic
1187291550 X:17959073-17959095 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187398433 X:18938164-18938186 GCTTCTGCTTTTGTGTTCTGAGG + Intronic
1187792616 X:22967570-22967592 GTGTGTGTGTGTGTGTGATGGGG - Intergenic
1187907355 X:24079775-24079797 GTGTGTGCTTGTTTTTGCAGAGG + Intergenic
1187940502 X:24376172-24376194 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1188003319 X:25001907-25001929 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188581860 X:31723619-31723641 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1188825491 X:34827948-34827970 GTGTGTGTGTGTGTGCGCTGAGG - Intergenic
1188852756 X:35151394-35151416 CAGGGTGCTAGTGTGTGCTGGGG - Intergenic
1189090279 X:38074901-38074923 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1189132495 X:38514753-38514775 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1189204686 X:39227575-39227597 GCGTGTGTGTGTGTGTGGTGGGG - Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1189273385 X:39767504-39767526 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1189645272 X:43121554-43121576 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1190199324 X:48346595-48346617 GTGTGTGTGTGTGTGTGGTGTGG + Exonic
1190222354 X:48520593-48520615 GTGTGTGTGTGTGTGTGTTGAGG - Exonic
1190339120 X:49282477-49282499 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1190655031 X:52604090-52604112 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1190666092 X:52697074-52697096 GTGTGTGTGTGTGTGTGGTGTGG + Exonic
1190673326 X:52761336-52761358 GTGTGTGTGTGTGTGTGGTGTGG - Exonic
1190708995 X:53051866-53051888 GGGTGTGCTTGTGAGTGTTAAGG + Intronic
1190709403 X:53055598-53055620 GTGGGTGCTTGTGGGTGGTGTGG + Intronic
1191054459 X:56227870-56227892 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1191058582 X:56270343-56270365 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191108446 X:56787295-56787317 GTGTGTGCGTGTGTCTGCTTGGG - Intergenic
1191717129 X:64201444-64201466 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191999171 X:67129602-67129624 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1192141856 X:68652852-68652874 GGGTGTGTGTGTGTGTGGTGTGG - Intronic
1192141953 X:68653607-68653629 GGGTGTGTGTGTGTGTGGTGGGG - Intronic
1192157805 X:68759339-68759361 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192238004 X:69308146-69308168 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1193080367 X:77400397-77400419 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1193150799 X:78122435-78122457 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1193653396 X:84167788-84167810 GTATGTGTGTGTGTGTGCTGGGG + Intronic
1194086495 X:89534334-89534356 GTGTGTGTTTGTGTTTGTTGGGG - Intergenic
1194139406 X:90191412-90191434 GTGTGTGTCTGTGTGTGGTGAGG + Intergenic
1194277691 X:91907366-91907388 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1194553644 X:95331561-95331583 TAGTGTCCTTGTGTGTGTTGGGG + Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194785013 X:98072567-98072589 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1194912749 X:99667005-99667027 GTGTGTGTTTGTGTGGGCGGGGG + Intergenic
1194985784 X:100488253-100488275 GCGTGTGTGTGTGTGTGGGGGGG - Intergenic
1194988686 X:100520771-100520793 GCGTTTGTGTGTGTGTGTTGTGG + Intergenic
1195045974 X:101054895-101054917 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1195133421 X:101877693-101877715 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1195273728 X:103257808-103257830 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1195398121 X:104433047-104433069 GTGTGTGCTTGTGTGTTCTTGGG + Intergenic
1195603839 X:106779373-106779395 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1195660727 X:107375246-107375268 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1195745654 X:108115137-108115159 GTGTGTGTGTGTGTGTACTGAGG + Intronic
1196060444 X:111402805-111402827 GTGTGTGTGTGTGTGTGCGGAGG + Intronic
1196322874 X:114363414-114363436 GTGTGTGTCTGTGTGTGTTGTGG + Intergenic
1196618013 X:117789835-117789857 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1196831400 X:119778598-119778620 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1197116748 X:122842743-122842765 GTGTGTGTTTGTGTGTGTGGAGG + Intergenic
1197279494 X:124518385-124518407 GCGTGTGTGTGTGTTTGTTGGGG + Intronic
1197329820 X:125139819-125139841 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1197630079 X:128848338-128848360 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1197717156 X:129717979-129718001 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1198080829 X:133237670-133237692 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1198130225 X:133686764-133686786 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1198217544 X:134569792-134569814 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1198285221 X:135183138-135183160 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1198512476 X:137366462-137366484 GCGGCTGCTGGAGTGTGCTGGGG - Intergenic
1198531553 X:137553384-137553406 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1199030865 X:142998176-142998198 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1199334483 X:146602125-146602147 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1199498119 X:148476768-148476790 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1199574334 X:149298838-149298860 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1199880614 X:151971897-151971919 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1200058471 X:153473581-153473603 GTGTGTGCGTGTGTGTGTTTTGG + Intronic
1200092809 X:153643741-153643763 ACGTGTGCTTGTGCGTGTCGGGG + Intronic
1200121484 X:153793147-153793169 GTGTGTGCCTGTGTGTGCGTTGG - Intronic
1200167339 X:154045930-154045952 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1200208011 X:154331940-154331962 CCGTGCGCTTATGTGTCCTGTGG - Intergenic
1200408887 Y:2842335-2842357 GCGTTTGCTTGTTTGTTATGTGG + Intronic
1200439157 Y:3190213-3190235 GTGTGTGTTTGTGTTTGTTGGGG - Intergenic
1200585646 Y:5002581-5002603 GCGTGTGTGTGTGTGTGTCGCGG + Intronic
1200595033 Y:5129434-5129456 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1201490877 Y:14540108-14540130 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1201531722 Y:14997207-14997229 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1201728247 Y:17178696-17178718 GTGTGTGCCTGTGTGTATTGGGG - Intergenic