ID: 1060891521

View in Genome Browser
Species Human (GRCh38)
Location 9:127192286-127192308
Sequence GAGGCAAGTTGCCGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060891512_1060891521 22 Left 1060891512 9:127192241-127192263 CCATGATGACTGTGCAGCAAGTG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1060891521 9:127192286-127192308 GAGGCAAGTTGCCGTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060891521 Original CRISPR GAGGCAAGTTGCCGTGTGGC AGG Intronic
No off target data available for this crispr