ID: 1060897342

View in Genome Browser
Species Human (GRCh38)
Location 9:127225875-127225897
Sequence GCCTAGGGGCGCCGGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060897342_1060897348 -8 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897348 9:127225890-127225912 CCCTAGGCTGCTCTTCCCCCGGG No data
1060897342_1060897350 -7 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897350 9:127225891-127225913 CCTAGGCTGCTCTTCCCCCGGGG No data
1060897342_1060897346 -9 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897346 9:127225889-127225911 CCCCTAGGCTGCTCTTCCCCCGG No data
1060897342_1060897352 4 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897352 9:127225902-127225924 CTTCCCCCGGGGCCTCTCACGGG No data
1060897342_1060897351 3 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897351 9:127225901-127225923 TCTTCCCCCGGGGCCTCTCACGG No data
1060897342_1060897359 20 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897359 9:127225918-127225940 TCACGGGACTACAGCCGCCCGGG No data
1060897342_1060897358 19 Left 1060897342 9:127225875-127225897 CCGGGCCGCCGGCGCCCCTAGGC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1060897358 9:127225917-127225939 CTCACGGGACTACAGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060897342 Original CRISPR GCCTAGGGGCGCCGGCGGCC CGG (reversed) Intronic
900053291 1:610706-610728 GCCCACGTGCGCCGGCCGCCAGG - Intergenic
900072054 1:778872-778894 GCTTATGTGCGGCGGCGGCCGGG - Intergenic
900095963 1:940244-940266 GGGGAGGGGCGCCGGCCGCCGGG + Intronic
900123761 1:1060435-1060457 GCCGAGGGGGGCCGGGGGCAGGG + Intergenic
900205191 1:1428361-1428383 GCCCAGGGGTGGCGGCAGCCGGG + Intergenic
900269120 1:1778238-1778260 GCCTGGGGTCGCCCGCTGCCTGG - Intronic
900540298 1:3199382-3199404 GGCAAGGGGCTCCGGAGGCCCGG - Intronic
901045348 1:6392914-6392936 GCCCACGGGCGCCGGTCGCCGGG + Intronic
902250893 1:15153728-15153750 GCCTGGGAGCGCCGGCGTGCGGG - Intronic
902350237 1:15848423-15848445 GCCCCGGGGCGCCGGCTGCGTGG - Intronic
903398280 1:23019565-23019587 CCCTACGGCCGTCGGCGGCCCGG + Exonic
903939869 1:26922115-26922137 ACTGAGGGGCGCCGGGGGCCCGG - Intronic
905789832 1:40784060-40784082 GGCTGGGGGCGCCGGGGCCCGGG - Exonic
907051097 1:51330395-51330417 GCCCGGGGGCGCGGGCGGCGCGG - Intronic
907444569 1:54499523-54499545 GCCGAGCGGCGGCGGCTGCCGGG + Intergenic
912270101 1:108200141-108200163 TCCCAGAGGCGCAGGCGGCCTGG + Exonic
912652152 1:111449125-111449147 CCCTAGTGCCCCCGGCGGCCCGG - Exonic
912685180 1:111756276-111756298 ACCGACGGGCGGCGGCGGCCAGG + Intronic
920002196 1:202807836-202807858 GCCGCGGGGCTCGGGCGGCCGGG - Intronic
922266987 1:223992827-223992849 GCTTATGTGCGGCGGCGGCCGGG - Intergenic
922753408 1:228081686-228081708 GCAAAGGGGCGCAGGAGGCCTGG + Intergenic
923007918 1:230067081-230067103 GCCGCGCGGCGCCGCCGGCCCGG + Intronic
923526112 1:234774058-234774080 GCCAAGGGGTGTAGGCGGCCTGG - Intergenic
1062932868 10:1364011-1364033 ACCTGGGGGCGCGGGCGGCGAGG - Intronic
1065727358 10:28678271-28678293 CCCTGGGGGCTCGGGCGGCCGGG + Intronic
1066464216 10:35639479-35639501 GCCGGGGGGCGGCGGCGGCGGGG - Exonic
1067809861 10:49418122-49418144 GCCTGGGGGCACTGGTGGCCAGG - Intergenic
1073048603 10:100654186-100654208 GGCTGGGGGCGGCAGCGGCCCGG - Intergenic
1076373782 10:129970652-129970674 GGCGATGGGTGCCGGCGGCCGGG + Intergenic
1076454169 10:130578012-130578034 GCCCAGGGGCCCCGGGGGCTGGG - Intergenic
1077544870 11:3164968-3164990 GCCTGGGGGCGCCCCGGGCCAGG - Intronic
1078771919 11:14359089-14359111 GGCCAGGGGCGGCAGCGGCCGGG + Exonic
1079056001 11:17207505-17207527 GGGGAGGGGGGCCGGCGGCCGGG + Intronic
1081700036 11:45146984-45147006 GGCTGGGGGCGGGGGCGGCCGGG + Intronic
1082283684 11:50298357-50298379 GCTTACAGGCGACGGCGGCCAGG + Intergenic
1083661286 11:64252685-64252707 GCCTGGGGGCCCCAGGGGCCGGG + Intronic
1083753629 11:64777844-64777866 GCCCAGGGGCGCCTCCGCCCGGG + Intronic
1083887575 11:65580438-65580460 GCCCAGGAGCCCCGGAGGCCCGG + Exonic
1083895921 11:65619681-65619703 GCCGAGGGGCACCGGGGGCCGGG + Intronic
1084371969 11:68750828-68750850 GGCTAGGGGAGGGGGCGGCCTGG + Intronic
1084575672 11:69986432-69986454 GGCTGGGGGCGCCGCCGGGCAGG + Intergenic
1085011054 11:73142094-73142116 GGCTTGGGGCCCGGGCGGCCCGG + Exonic
1085143428 11:74170884-74170906 GCCCAGCGGCGCCGGTTGCCGGG - Exonic
1085485614 11:76860790-76860812 GCCCAGCGGCGCCGGTGGGCGGG + Intergenic
1089207049 11:116772823-116772845 GCCTGGCGGGGCCGGCGGCAAGG - Exonic
1091273134 11:134331931-134331953 GCCAATGAGCGCCGGCGGGCCGG + Exonic
1091286592 11:134411866-134411888 GTCTAGGGGCGCCGGGGCCGGGG - Intronic
1091916180 12:4272973-4272995 GTCTAGGGCCGCCGCAGGCCGGG - Intergenic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1092727670 12:11500689-11500711 GCCTAGGAGGGCCGGCAGCGGGG - Intronic
1092843061 12:12561915-12561937 GCGTGGGGGCGACCGCGGCCGGG - Intronic
1096459526 12:51814543-51814565 GCCGGGAGGCGCTGGCGGCCTGG - Intergenic
1096466149 12:51848577-51848599 GCCTGGGGGCGCGTCCGGCCCGG + Intergenic
1096839261 12:54370628-54370650 GTCTAGGGGCGCCGGGGAGCTGG - Exonic
1097872156 12:64610581-64610603 TCCCCGGGGCGCAGGCGGCCAGG - Exonic
1101365191 12:104064435-104064457 GGCCGCGGGCGCCGGCGGCCAGG - Exonic
1102933943 12:116881578-116881600 CCCTAGCGGCGCCGGCAGCTAGG + Intergenic
1103412950 12:120725749-120725771 GCCGAGGTGCGCTCGCGGCCAGG - Exonic
1104376287 12:128267425-128267447 GCACAGCGGCGCCGCCGGCCCGG - Exonic
1105071355 12:133235951-133235973 GCTGAGGGGCGCCGGCCCCCGGG - Exonic
1106187843 13:27424719-27424741 GCTTGGAGGCGCCGGCGCCCTGG + Exonic
1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG + Intergenic
1112752563 13:102597228-102597250 GCGCGGGGGCGCGGGCGGCCGGG + Intronic
1113917781 13:113884436-113884458 GCGCGGGGGCGCCGGCAGCCGGG + Intergenic
1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG + Intergenic
1114088857 14:19267207-19267229 TCCTAGTGGTGCCGGCGCCCAGG - Intergenic
1115566623 14:34630162-34630184 GCCGGAGGGAGCCGGCGGCCAGG + Exonic
1118796869 14:69152354-69152376 GCCGAGGAGCGCCGGAGGCAAGG - Intronic
1119743256 14:77027562-77027584 CCCGACGGGCGGCGGCGGCCCGG + Exonic
1120167850 14:81220238-81220260 GCCTGGGGCCGCCGCGGGCCGGG - Intronic
1121767736 14:96502276-96502298 TCCTAAGGCCGCCTGCGGCCCGG - Intronic
1122082279 14:99274263-99274285 GCCCAGCGCCGCCGGCGGTCCGG + Intergenic
1122374099 14:101247217-101247239 GCCTTGGGGTGCCGGGGGCTGGG - Intergenic
1122470798 14:101964700-101964722 GCCCGGGGGCGGCGGCGGCGAGG + Exonic
1122550218 14:102545262-102545284 GCCCAGAGGAGGCGGCGGCCCGG - Intergenic
1124612067 15:31215748-31215770 GGCTCGGGGCGGCGGGGGCCCGG - Intergenic
1125794613 15:42395045-42395067 GCCGAGGGGCCCAGGCTGCCTGG - Intronic
1127417491 15:58771553-58771575 GGCTGGGGGCGGCGGCCGCCAGG + Exonic
1127753575 15:62068450-62068472 GCCCGGGGGCGCCTCCGGCCGGG - Exonic
1128321952 15:66700969-66700991 ACCGCGGGGCGCCGGCGGGCGGG - Intergenic
1128330354 15:66751555-66751577 GACTAGGGGCTCAGGAGGCCAGG - Intronic
1128841384 15:70853950-70853972 GACTCGGGGCGCCGGGGACCCGG - Exonic
1130908615 15:88256386-88256408 GCCTAGTGGCGCGGTCTGCCGGG + Exonic
1131144532 15:90002328-90002350 GCGTCGGGGCGCCGCGGGCCGGG + Intronic
1131517347 15:93088402-93088424 GCCTCGGCGCGCCGGCGTACGGG - Intronic
1132522319 16:397420-397442 GCCTCGGGGCGCGGGCTGCGGGG + Intronic
1132671037 16:1102465-1102487 GCCTGGGGGTGCCGGGGGCCAGG - Intergenic
1132700492 16:1220171-1220193 GCCTGGGGCCGCCGGCCGGCTGG - Exonic
1132729132 16:1352026-1352048 GCCTGGGGACGCGGACGGCCGGG - Intronic
1132759141 16:1500512-1500534 ACCTCGGGGCGCCCGAGGCCGGG - Intronic
1132934526 16:2473967-2473989 GGCTGGGGGCGCGGGGGGCCGGG + Exonic
1133006179 16:2883058-2883080 GCCTCGGGGGACCTGCGGCCTGG - Intergenic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1133156709 16:3880908-3880930 GCGTAGGGAAGCTGGCGGCCCGG + Intergenic
1138547076 16:57726288-57726310 GCCTGGGGGCCACGGCGGGCAGG + Intronic
1139418103 16:66830765-66830787 GCCTAAGGGCGCGGGCGGCGCGG - Intronic
1139528212 16:67529172-67529194 GCCCCGGGGCACCGGCCGCCAGG - Intronic
1139967244 16:70752604-70752626 GCCTAGGGGCCACGGCAGCCAGG + Intronic
1140478806 16:75251679-75251701 GCCAATGGGCGCGCGCGGCCGGG - Intronic
1142518910 17:491593-491615 GTCTAGGGCCACCGGCCGCCCGG + Intergenic
1142695145 17:1629192-1629214 GGCTGGGGGCGCTGGTGGCCCGG - Intergenic
1142810694 17:2394234-2394256 GCCGAGGGCCGCCGGGGCCCGGG + Intronic
1142860080 17:2755893-2755915 GCGGAGGGGCGCCGGCTGCCTGG + Intergenic
1143538729 17:7557377-7557399 GTCGAGGGGAGCCGGCAGCCTGG - Exonic
1144741940 17:17588703-17588725 GCCTAGGGGTGCGGGCACCCAGG - Intronic
1147110206 17:38256616-38256638 GCTCTGGGGAGCCGGCGGCCCGG - Intergenic
1147646552 17:42037859-42037881 GGCTGGGGGCGCCGGAGGCCGGG + Exonic
1148367480 17:47067308-47067330 GCCTAGGGGACGCGGCGGCCTGG + Intergenic
1148419302 17:47531803-47531825 GCTCTGGGGAGCCGGCGGCCCGG + Intronic
1148857053 17:50584583-50584605 GCCCAGGGGAGCCGGGGGCGGGG + Intronic
1149614757 17:57988316-57988338 GACTGGGGGCGGCGGCGGCCGGG - Intergenic
1150217149 17:63477104-63477126 GCCTCGGGCCGCCGGGGGCCGGG + Intergenic
1150259212 17:63774493-63774515 GCCTCGGGGCACCGGCGGCCGGG + Intronic
1152356380 17:79809695-79809717 CCCTGGAGGCGCGGGCGGCCTGG - Intergenic
1152396489 17:80036304-80036326 GGCTGGGGGCACCGGGGGCCGGG - Intergenic
1152552324 17:81035727-81035749 GCCCAGGGGTTGCGGCGGCCAGG + Intronic
1154213101 18:12396687-12396709 GCATGGGGGTGCGGGCGGCCAGG - Intergenic
1155164917 18:23224322-23224344 ACCCATGGGCACCGGCGGCCAGG + Intronic
1156465503 18:37345927-37345949 TCCTGGGGGCTCCGGGGGCCAGG - Intronic
1160597684 18:79988473-79988495 GCCCGGGGGCGGCGGGGGCCGGG - Exonic
1161118512 19:2512579-2512601 GCCTAGGAGCCCCGGCTGCCTGG + Exonic
1161215822 19:3094603-3094625 GCCGGGGGGCGGCGGCGGGCAGG + Exonic
1161512176 19:4677912-4677934 GCCTGGGGCCGCCAGCTGCCTGG + Intronic
1161802686 19:6424648-6424670 GCCGGCGGGCGGCGGCGGCCCGG + Exonic
1162079418 19:8209474-8209496 ACCTGGGGGTGCAGGCGGCCGGG - Exonic
1162572458 19:11481050-11481072 GGCTGGGGGCGGCGGCGGCGCGG - Intronic
1163248551 19:16112044-16112066 GGCTGGGGGCGCCGGAGGCCCGG + Intronic
1164800094 19:31068972-31068994 GCCTAGGGGCTGAGGCTGCCAGG - Intergenic
1164990011 19:32676221-32676243 GCTAACGGGCGCGGGCGGCCGGG + Exonic
1165774252 19:38395589-38395611 GGCGAGGGGCGCGGGTGGCCCGG - Exonic
1165961616 19:39539777-39539799 GCCCGGCGGCGGCGGCGGCCAGG - Exonic
1167233066 19:48297455-48297477 GCTTCGCGGCGGCGGCGGCCAGG + Exonic
1167578318 19:50328290-50328312 GCCAGGGGGCGCGGGCGGCGCGG - Exonic
929188603 2:39120449-39120471 GGAGAGGGGCGGCGGCGGCCGGG + Exonic
929701949 2:44169474-44169496 GCCCAGCGGAGGCGGCGGCCGGG - Intronic
932316895 2:70790582-70790604 GCCCAGGAGCGCGGGCGGCGCGG + Exonic
932567740 2:72920164-72920186 GCCTCCGGGCGCCGAGGGCCGGG + Intronic
932621940 2:73269736-73269758 GGCTCAGGGCGCCCGCGGCCTGG + Exonic
935595191 2:104872627-104872649 GCGGAGGGGAGCCCGCGGCCTGG - Intergenic
940640831 2:156342655-156342677 GCGAAGGGCCGCGGGCGGCCTGG - Intergenic
942098499 2:172555990-172556012 GCCCAGCGGCGCAGGGGGCCGGG + Exonic
942346161 2:175005029-175005051 TGCTGGGGGCGCCGGCGCCCGGG + Exonic
944547484 2:200812165-200812187 GCCGAGGGGTAGCGGCGGCCCGG + Intronic
947792168 2:232874745-232874767 CCCTAGGGTCGCCGGCTGGCCGG + Intronic
948458994 2:238120213-238120235 GCCCAGGAGTGCCGGCTGCCTGG + Intronic
948934060 2:241150730-241150752 GCCCGGGGGCGGCAGCGGCCGGG + Intronic
1170991239 20:21303508-21303530 GCCTAGACGTGCCGGGGGCCCGG - Intronic
1174579585 20:51562382-51562404 GCGGAGGGGCGCCCGCGCCCCGG - Intronic
1175374446 20:58514786-58514808 GGCTGCGGGCGCCGGCGGCCAGG + Exonic
1175837082 20:62003035-62003057 GCCTTGGAGCCCCGGCCGCCAGG + Intronic
1175944572 20:62552692-62552714 GCCTGGGGGGGACGGGGGCCAGG - Intronic
1176002350 20:62838261-62838283 GCCCAGGGGTGCAGGAGGCCGGG - Intronic
1176550029 21:8217038-8217060 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1176568956 21:8400073-8400095 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1176576870 21:8444308-8444330 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1177834164 21:26170968-26170990 GCCCAGGTGGGCCGTCGGCCGGG - Intronic
1178104085 21:29299118-29299140 CGCGGGGGGCGCCGGCGGCCGGG + Intronic
1178351162 21:31873719-31873741 GCCTGGGGGCGGCGGCGGCGCGG + Exonic
1179150798 21:38806390-38806412 GCCTAGCGGCGGGCGCGGCCAGG + Intronic
1179496947 21:41778176-41778198 GGCGGGGGGCGCAGGCGGCCCGG - Intergenic
1180064772 21:45406652-45406674 CCCTGTGGGCGCTGGCGGCCCGG - Intronic
1180491851 22:15855129-15855151 TCCTAGGGGTGCCGGCGCCCAGG + Intergenic
1180961960 22:19766225-19766247 GGCTCGGGGCGCCGGCGACTTGG + Intronic
1181006465 22:20016117-20016139 GCTCAGGGGCACCGACGGCCCGG - Intronic
1183213206 22:36463742-36463764 GCCTGGGGGGGCCTGCAGCCAGG + Intergenic
1183490096 22:38111432-38111454 GCCGAGGGGAGCCGGGGGTCAGG + Intergenic
1183540712 22:38427842-38427864 GCCCAGGGGTGCCTGCGGCGGGG - Exonic
1184114928 22:42416888-42416910 GCCTAGAGGGGCCCACGGCCTGG + Intronic
1184564710 22:45285118-45285140 GCCCTGGGGCGCCCGCCGCCTGG + Intronic
1184791276 22:46701578-46701600 GCCTGGGGGCGCAGGAGGCCCGG + Intronic
1185055189 22:48575645-48575667 GCCCAGGGGCGCGGTGGGCCCGG + Intronic
1185316035 22:50179501-50179523 GCCCAGTGGAGCCGGTGGCCAGG + Exonic
1203254919 22_KI270733v1_random:133364-133386 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1203262975 22_KI270733v1_random:178443-178465 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
951881322 3:27483918-27483940 GGCGAGGCGCGCCGGCCGCCGGG + Intronic
952867215 3:37862066-37862088 GCCTGGGCGCGCCCGCCGCCCGG - Intronic
953257515 3:41305746-41305768 TCCTAGGTGGGACGGCGGCCGGG - Intronic
954124175 3:48518992-48519014 GCTTAGGGGAGCTGGTGGCCAGG - Exonic
954404336 3:50337144-50337166 GCCAGGGGGTGCCGGCGGGCGGG - Intronic
954838978 3:53494784-53494806 GCCGAGCGGCCCCGGCGGCCGGG + Intronic
958719147 3:97822752-97822774 GCCGAGCGGAGCCGTCGGCCAGG + Intronic
961161477 3:124730410-124730432 TCATCGGGGCGCCGGAGGCCCGG + Exonic
963035160 3:141019497-141019519 GCCCAGCTGCGCCCGCGGCCCGG + Intergenic
963253367 3:143121130-143121152 GCCCAGGGCCGCCTCCGGCCGGG + Exonic
966866113 3:184260011-184260033 GCCTGGCGGCGGCGGCGGCACGG + Exonic
967098126 3:186193998-186194020 TCCTGGGTGCGCCGGCGGCCAGG + Intronic
968514479 4:1010489-1010511 GCCTGGGGACACCGGCTGCCAGG + Intronic
968651962 4:1763724-1763746 GCCGAGAGGCGCCGGCAGCGAGG + Intergenic
969109208 4:4831316-4831338 GACTACAGGCGCCGGCTGCCAGG - Intergenic
969240333 4:5893004-5893026 GCCCAGGGCCGCGGGCGGGCAGG - Exonic
969715873 4:8867848-8867870 GCCCAGCGGCGGCTGCGGCCGGG + Exonic
972265431 4:37454538-37454560 CCCCAGGGGTGCTGGCGGCCTGG + Intronic
975883549 4:78939229-78939251 GCCGGGGAGCGGCGGCGGCCGGG - Exonic
979335249 4:119454913-119454935 GCTTATGTGCGGCGGCGGCCGGG - Intergenic
985527786 5:415688-415710 GCCTAGGGGCGGAGTCTGCCTGG + Intronic
992088626 5:73299158-73299180 CCCTCGGAGCGCCGGCGGGCCGG - Intergenic
997453995 5:134004528-134004550 GGCGAGGGGCCCCGGCAGCCCGG - Intronic
998142931 5:139709986-139710008 GCCTAGGAGGGCGGGCGGGCAGG + Intergenic
999248197 5:150166722-150166744 GGCTGGGGCCGCGGGCGGCCCGG + Intergenic
999330828 5:150672319-150672341 GCCTAGGGGCGCGGGGGGAAGGG - Exonic
1000220187 5:159208223-159208245 GCCCCGCGGCGGCGGCGGCCCGG - Intronic
1002106278 5:176880829-176880851 CCCTATGTGCCCCGGCGGCCGGG - Exonic
1002180127 5:177426973-177426995 GCCTAGGGGATCCGACGGCTGGG - Intronic
1002541296 5:179907938-179907960 GCCAGGGGGCGCCGCCCGCCCGG - Intergenic
1002927282 6:1611690-1611712 GCCCGGGGGCGCGGGCGGCTCGG + Exonic
1004241329 6:13925002-13925024 GCCCTGGGCCGCCGCCGGCCAGG + Exonic
1004720497 6:18264353-18264375 GCTTCGGGACGCCGGAGGCCCGG - Intronic
1006546589 6:34786351-34786373 TCCTAGGTGCGATGGCGGCCGGG - Intergenic
1011640475 6:89412347-89412369 GCCGAGTGGTGCCCGCGGCCGGG - Intergenic
1013619289 6:111872891-111872913 GCGCGGGGGCGCCGGCGGCCGGG + Intronic
1014272365 6:119349161-119349183 GCCGAGGGGGTCGGGCGGCCTGG - Exonic
1017672204 6:156778580-156778602 GCCCGGGGGCGGCGGCGGCCCGG + Exonic
1017954955 6:159169719-159169741 GCTGAGGAGCGCCGGGGGCCCGG - Intronic
1018443509 6:163834551-163834573 GCAGAGGGGCGCCGGCCGCGTGG + Intergenic
1019381555 7:726850-726872 TCCAAGGCGCGCCGCCGGCCCGG - Exonic
1020106236 7:5423497-5423519 GCCTAGCTGCGCCGGGAGCCGGG - Exonic
1020274408 7:6615781-6615803 GCCTGGGGTCGGCGGCGGCCAGG - Exonic
1025829761 7:65038652-65038674 GCCTGGGGGCGGCGGGGACCGGG + Intergenic
1025917016 7:65873652-65873674 GCCTGGGGGCGGCGGGGACCGGG + Intronic
1026586104 7:71657507-71657529 GCCCAGGGGAGCAGGTGGCCTGG + Intronic
1031886994 7:127253398-127253420 GCCCAGCGGCTCCGGCTGCCTGG + Intergenic
1033220496 7:139523959-139523981 GGCGAGGGGCGGCGGCGGCCGGG - Exonic
1033672944 7:143510967-143510989 GTGCTGGGGCGCCGGCGGCCAGG - Intergenic
1034192811 7:149224596-149224618 GCCGTGGGGCGCCGGGGCCCGGG - Exonic
1034610809 7:152366810-152366832 GCTGATGGGCGGCGGCGGCCGGG - Intronic
1035528929 8:336235-336257 GCCTGGGGCTGCCGGCTGCCAGG - Intergenic
1036662000 8:10714792-10714814 GGCTAGGGGAGCTGGGGGCCAGG + Intergenic
1038798233 8:30727853-30727875 GCCAAGTGGGGCGGGCGGCCCGG + Exonic
1039949039 8:42153389-42153411 GCCGCGGGGCGCAGGCGGGCAGG - Intronic
1042499545 8:69492967-69492989 TCCGAGGAGCGCCGGCAGCCGGG - Intronic
1043883257 8:85568800-85568822 GCCAAGGGGGGCCGGAGGACTGG + Intergenic
1049654796 8:143792759-143792781 GCTTAGGGGGGCCCTCGGCCTGG + Exonic
1049788373 8:144462170-144462192 GCCTGCGGGGCCCGGCGGCCGGG - Intronic
1052824766 9:33166903-33166925 GCCTAGAGGAGGCGGCGGCCGGG + Exonic
1053129090 9:35605333-35605355 GCTCCGGGGCGCCGGCGGGCTGG - Exonic
1053206585 9:36191218-36191240 GCCCGGGGGCGCCGCCGTCCAGG - Exonic
1060784129 9:126435755-126435777 GCCTCTGGGTGCCGCCGGCCTGG - Intronic
1060897342 9:127225875-127225897 GCCTAGGGGCGCCGGCGGCCCGG - Intronic
1061321828 9:129835641-129835663 GGAGAGGGGCGGCGGCGGCCGGG - Intronic
1061666416 9:132162991-132163013 GGCTGGGGGCGGCGGCGGCCGGG + Intronic
1062207821 9:135346969-135346991 GCCTAGGGGTGCCGGGGGGCTGG - Intergenic
1062360445 9:136185653-136185675 GCATGGGGGCGCGGGCGGCAGGG + Intergenic
1062582894 9:137236243-137236265 GCCCAGGAGCGCAGGCGGACAGG - Exonic
1062656360 9:137606037-137606059 GCCGAGGGGCGGCGGGGTCCCGG + Intronic
1203791643 EBV:154817-154839 CCCGAGGGGCGCAGGCGGCTCGG - Intergenic
1203471321 Un_GL000220v1:116510-116532 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1203479142 Un_GL000220v1:160482-160504 GCCGCGGGGCCCCGGCGGCGGGG + Intergenic
1203607196 Un_KI270748v1:68440-68462 GCCCACGTGCGCCGGCCGCCAGG + Intergenic
1185641539 X:1591724-1591746 GGCCAGCGGCGGCGGCGGCCTGG + Exonic
1186496484 X:10015672-10015694 GGCGGGGGGCGCCGGCGGCGCGG - Exonic
1195884540 X:109625169-109625191 GGCTGGGGGCGCCGACGGCGGGG + Exonic