ID: 1060898683

View in Genome Browser
Species Human (GRCh38)
Location 9:127238290-127238312
Sequence TAGCTGTGGCAGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060898683_1060898690 13 Left 1060898683 9:127238290-127238312 CCTGGCTGTGGCTGCCACAGCTA 0: 1
1: 1
2: 3
3: 21
4: 307
Right 1060898690 9:127238326-127238348 GAGCTCCCAGACAAGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060898683 Original CRISPR TAGCTGTGGCAGCCACAGCC AGG (reversed) Intronic
900188774 1:1344696-1344718 TCACTGTGGCGGCCTCAGCCTGG - Intronic
900516768 1:3085847-3085869 CAGCTGTGGGAGCCCCACCCAGG + Intronic
900720277 1:4171553-4171575 TAGCTGTCACACCCACAGTCAGG - Intergenic
902209404 1:14893928-14893950 TTGATGTGGCAGCCGGAGCCCGG + Intronic
902457354 1:16544662-16544684 TAGTTGTGGTTGCCACAACCTGG - Intergenic
902483865 1:16728605-16728627 TAGTTGTGGTTGCCACAACCTGG + Intergenic
902494813 1:16863250-16863272 TAGTTGTGGTTGCCACAACCTGG + Intronic
903479037 1:23639762-23639784 CAGCTGTGGAGGCGACAGCCAGG - Exonic
903512840 1:23889318-23889340 TAGGTGTGGTAGCCACAGGCAGG - Intronic
903753119 1:25642177-25642199 TAGCAGAGGCAGCCACAGGAGGG - Intronic
904608886 1:31714597-31714619 AAGCGGTAGCAGCCACAGCCGGG - Intergenic
905380652 1:37559307-37559329 TCCCTGTGGCAGACACAGCGAGG - Exonic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
910729135 1:90371821-90371843 TAGCTGTGACAGGGACAGTCTGG + Intergenic
910758442 1:90713945-90713967 TAGGTTTGGCAGCCGCAGCCTGG - Intronic
913486270 1:119334776-119334798 GAGCTGTAGCAGTCACGGCCGGG + Intergenic
913578093 1:120197290-120197312 CAGCTGCGGCGGCCACACCCTGG + Intergenic
913630077 1:120701062-120701084 CAGCTGCGGCGGCCACACCCTGG - Intergenic
913662342 1:121015553-121015575 TAGCTGTGGTTGCCGCAACCTGG - Intergenic
914560011 1:148808710-148808732 CAGCTGCGGCGGCCACACCCTGG + Intronic
914612822 1:149321505-149321527 CAGCTGCGGCGGCCACACCCTGG - Intergenic
915913921 1:159930218-159930240 TTTCTGTGCCTGCCACAGCCGGG + Exonic
916360650 1:163963374-163963396 CAGCAGTGGCAAACACAGCCAGG - Intergenic
916395356 1:164380997-164381019 CAGCTGACTCAGCCACAGCCCGG - Intergenic
917188296 1:172387046-172387068 TGGCTGTGGCAGTCAGAGTCTGG - Intronic
918568226 1:185955709-185955731 CAGCTCTGGCAGCCAAAGACAGG - Intronic
920183516 1:204146993-204147015 TCCCTGAGGCAGCCCCAGCCTGG - Intronic
920361799 1:205423202-205423224 TAGCCCTTGGAGCCACAGCCTGG - Intronic
922044403 1:221929192-221929214 AGGCTGTGGCAACCACTGCCTGG - Intergenic
1063151079 10:3336872-3336894 AAGCAGTAGCAGCCCCAGCCAGG + Intergenic
1063574833 10:7252294-7252316 AAGCAGCGGCAGCCACTGCCTGG - Intronic
1065522274 10:26584449-26584471 TAGATGTGAGAGCCACAGGCTGG - Intergenic
1067508655 10:46877320-46877342 GGGCTGGGGCAGCCAGAGCCAGG - Intergenic
1067653594 10:48174530-48174552 GGGCTGGGGCAGCCAGAGCCAGG + Intronic
1067837406 10:49650111-49650133 CAGTGGTGGCAGCCACATCCTGG + Intronic
1069276961 10:66604457-66604479 CAGCAGTGGCAGCCACAGCATGG - Intronic
1069721965 10:70555460-70555482 CCGCTGTGGCAGCCACGACCCGG + Intronic
1072269339 10:93760565-93760587 TAGCTGTGGCACAGAAAGCCTGG + Intronic
1073035350 10:100561016-100561038 TTGATGTGGGGGCCACAGCCTGG + Intergenic
1073435254 10:103512427-103512449 TATCTGTGGCTGGCAGAGCCAGG - Intronic
1073452631 10:103618767-103618789 CAGCTGTGACAGCCACCCCCTGG + Intronic
1074446197 10:113523047-113523069 TATCTCTGGCAGCCAGTGCCAGG + Intergenic
1075406667 10:122200074-122200096 TGCCTGTGGCAGCCAGATCCAGG - Intronic
1075590185 10:123685459-123685481 CAGCTCAGCCAGCCACAGCCGGG + Intronic
1075680175 10:124325827-124325849 TTCCTGTGGTATCCACAGCCTGG - Intergenic
1076132876 10:128025950-128025972 TTTCTTTGGCAGCCAGAGCCAGG + Intronic
1076480692 10:130783475-130783497 GAGCTGTGTCACCCACAGCCTGG - Intergenic
1076517000 10:131051653-131051675 TAACTCTGGCAGCCAGTGCCAGG - Intergenic
1076852049 10:133098103-133098125 TACCTGTGCTGGCCACAGCCTGG + Intronic
1077139896 11:1019663-1019685 CAGCTCTGGCCACCACAGCCAGG - Intronic
1079037800 11:17036083-17036105 GACCCCTGGCAGCCACAGCCTGG + Intergenic
1079096726 11:17515826-17515848 CAGCTGTGCCAGACGCAGCCTGG - Intronic
1080646795 11:34193464-34193486 CAGCTGGGAAAGCCACAGCCTGG + Intronic
1081754799 11:45536904-45536926 GGGCTTTGGCAGCCTCAGCCTGG + Intergenic
1082784200 11:57307963-57307985 TGGCTGGGGCCACCACAGCCAGG - Intronic
1083428465 11:62601621-62601643 TAGCTGCGGCGGCGACAGCGCGG - Exonic
1085528237 11:77176318-77176340 CAGCTGTGGGAGGCACAGGCAGG - Intronic
1087231923 11:95675819-95675841 TAGCTTTGGCAGCCTCTGGCTGG + Intergenic
1089056178 11:115586986-115587008 CTCCTGTGGCAGCCACAGCATGG + Intergenic
1090068743 11:123525857-123525879 TGGCAGCGGCAGCCACAGCTCGG + Exonic
1090203237 11:124870561-124870583 TAGCTGTGGCCAACCCAGCCTGG + Intronic
1092440752 12:8499814-8499836 TACCTGTAGCAGCCACAGGAGGG + Intergenic
1099934645 12:89110632-89110654 TAAAAGTGGCAGCCTCAGCCGGG + Intergenic
1101843469 12:108343641-108343663 TCTCTGTGGCAGGCACAGGCTGG + Intergenic
1102166475 12:110810778-110810800 TGGCTGTCGCTGCCACTGCCAGG + Intergenic
1105816278 13:24039244-24039266 CAGCAGCTGCAGCCACAGCCAGG - Intronic
1106112125 13:26786294-26786316 TTGCTGGGGGTGCCACAGCCTGG - Intergenic
1106500657 13:30325393-30325415 TGGCAGTGGCAGCCACAGCATGG + Intergenic
1106529510 13:30576634-30576656 TGGCAGTGGAAGCCACAGGCTGG - Intronic
1107811888 13:44208391-44208413 TGGCTGTCACAGCCACAGACAGG + Intergenic
1112184950 13:97118718-97118740 TTCCTGTGGCAGCAACAGTCAGG + Intergenic
1113586290 13:111468316-111468338 TAGCTGTCTCAGCCACACACAGG - Intergenic
1113928607 13:113954523-113954545 TTGCTCTCGCAGTCACAGCCGGG + Intergenic
1114260883 14:21035327-21035349 AAGCTGTGGATGCCAGAGCCTGG + Intronic
1114490485 14:23098048-23098070 CAGCTGTAGCAGCCACTGCTTGG - Exonic
1116262807 14:42653233-42653255 TAGCTGTGCAAGCCATACCCAGG + Intergenic
1117296231 14:54381931-54381953 TAGCAGTGGCAGCAGCAGCTAGG - Intergenic
1117341556 14:54796555-54796577 TTCCTGTGGGAACCACAGCCAGG + Intergenic
1118971724 14:70642791-70642813 TAGCAGCAGCAGCCATAGCCAGG - Intronic
1119601772 14:75981472-75981494 TAGCTGGGCCAGCAACTGCCCGG - Intronic
1120187818 14:81412884-81412906 TAGCGATGGCAGCTCCAGCCGGG + Intronic
1122079566 14:99257424-99257446 TTGCTGTGGAAGCCACCTCCTGG - Intronic
1122290589 14:100678475-100678497 CAGCTGTGGCTGCCACCTCCAGG - Intergenic
1122290591 14:100678477-100678499 TGGAGGTGGCAGCCACAGCTGGG + Intergenic
1123893719 15:24807360-24807382 CAGCTTTGCCTGCCACAGCCAGG - Intergenic
1125195970 15:37046196-37046218 GAGCTGCAGCAGCCACAGTCTGG - Intronic
1125581121 15:40786550-40786572 GAGCTGAAGCAGCCACAGCAAGG + Intronic
1125681103 15:41530709-41530731 GAGCTGGGGCAGCTACAGCAAGG + Intronic
1127130331 15:55855600-55855622 GTGCTGTCCCAGCCACAGCCTGG - Intronic
1127140387 15:55969833-55969855 TCCCTGTGGCCGCCACAGCTGGG - Intronic
1127205414 15:56712122-56712144 TAGATTTGACAGCCACAGTCTGG - Intronic
1127712118 15:61609770-61609792 AAGCACTGGCAGACACAGCCAGG - Intergenic
1128721833 15:69955792-69955814 TAACTGACACAGCCACAGCCTGG - Intergenic
1129159274 15:73738276-73738298 TAGCAGAGCCAGGCACAGCCTGG + Exonic
1130540519 15:84817905-84817927 TAGCTGTGGAATCCCAAGCCAGG - Intronic
1131391028 15:92048990-92049012 CAGATGAGGCAGCCAAAGCCTGG + Intronic
1132146655 15:99433375-99433397 TAGCTGTCCCCGCCACAGCTGGG + Intergenic
1132558456 16:582928-582950 TTGGGGTGGCAGCCACAGCTGGG - Exonic
1132877758 16:2147993-2148015 TCGCTGTGGCAGCCAGCCCCCGG - Intronic
1132928536 16:2446212-2446234 TCGCTCTGGCAGGCACAGGCTGG + Intronic
1133065537 16:3204093-3204115 TAGCAGTAGCAGCCCCAGCAGGG + Intergenic
1133113687 16:3564298-3564320 TGGCGGTGGCAGTCCCAGCCAGG - Exonic
1133236502 16:4389628-4389650 TTCCTGTGCCGGCCACAGCCTGG - Intronic
1136059083 16:27712369-27712391 AGCGTGTGGCAGCCACAGCCTGG + Intronic
1140541299 16:75758688-75758710 GAGCTGTGGCAGCCAGCACCAGG + Intronic
1141192245 16:81833242-81833264 TTTCTGTGGGGGCCACAGCCTGG + Intronic
1141903787 16:87009476-87009498 GAGCTGTGGAAGCCACTCCCTGG + Intergenic
1141944368 16:87299184-87299206 TTGCTGTGGGAGCCACTGCAGGG - Intronic
1141950298 16:87335357-87335379 TACCTATGGCAGCCACGGCCTGG - Exonic
1142760651 17:2040174-2040196 TCACTGTGGCAGCCACTGTCAGG - Intronic
1145115825 17:20210365-20210387 CAGCACTGCCAGCCACAGCCTGG - Intronic
1147498190 17:40937465-40937487 CAGCCGTGGCAGGCTCAGCCGGG - Intronic
1148687953 17:49511027-49511049 ATGCTGTGGCACCCACATCCAGG + Intronic
1151349446 17:73522973-73522995 AAGCTGTGGCAGCCACAGCCGGG - Intronic
1151411089 17:73930215-73930237 TGGCTGTGGGAGCCACAGCCAGG + Intergenic
1151651794 17:75474872-75474894 CTGCTGTGGCAGTGACAGCCTGG + Intronic
1151670488 17:75569300-75569322 TGGCTGTGGCAGGCACGGCAGGG + Exonic
1151878419 17:76880421-76880443 TGGCTGGGCCAGCCAGAGCCAGG + Intronic
1152103872 17:78317891-78317913 TAGCTGTGGCTGCCAGAGGAGGG + Intergenic
1154411538 18:14144615-14144637 TGGCTCTGGCTGCCTCAGCCTGG + Intergenic
1156339886 18:36201255-36201277 TAGCTGTGTAAGCCTCAGGCTGG + Intronic
1156542475 18:37928582-37928604 GAGCCGTGGAGGCCACAGCCTGG - Intergenic
1157427195 18:47594101-47594123 TGGCTGTGGCAGTCACTGTCGGG - Intergenic
1157762583 18:50275369-50275391 CAGTTGGGGGAGCCACAGCCAGG + Intronic
1158427064 18:57349823-57349845 TTACTCTGGCATCCACAGCCAGG - Intergenic
1159053588 18:63443879-63443901 TGGGTGTGGCAGCCACCTCCAGG - Intergenic
1159126048 18:64225995-64226017 TAGATGTGGGGGCCTCAGCCAGG + Intergenic
1159344047 18:67175804-67175826 TAGCTGTCACAGGCACTGCCAGG - Intergenic
1159921167 18:74228491-74228513 TACGTGTGGCATTCACAGCCAGG + Intergenic
1160688977 19:452010-452032 TTCCTGTGACAGCCACAGACGGG - Intronic
1160837181 19:1130228-1130250 CAGCCGTGACAGCCACAGACGGG + Intronic
1161245772 19:3250981-3251003 TAGGTGAGGAAGGCACAGCCTGG - Exonic
1161389520 19:4013962-4013984 TGGCCCTGGCAGTCACAGCCTGG - Intronic
1161586393 19:5108054-5108076 GAGCCGTGCCAGCCCCAGCCGGG + Intronic
1162528511 19:11221894-11221916 TAGCAGTGGCAGGTACAGCTCGG + Exonic
1163029940 19:14537365-14537387 TAGCTGTTTCAGCCGCACCCAGG + Intronic
1164305987 19:24004073-24004095 TTCCTGTGGCTGCCACAGTCCGG - Intergenic
1164854886 19:31512996-31513018 TATCTCTGGAAGCCAGAGCCTGG + Intergenic
1165313336 19:35041192-35041214 TTGCTTTGGCAGCCTCCGCCCGG - Intronic
1165444684 19:35850363-35850385 TCACTGTGGAGGCCACAGCCAGG - Exonic
1165762106 19:38327401-38327423 TAGCTGGGGCAGCCTCTGCCAGG + Exonic
1165873706 19:38991170-38991192 TAGCAGGGACAGGCACAGCCCGG + Intronic
1166839067 19:45685287-45685309 GAGCTGTGAAAGGCACAGCCTGG - Intergenic
1167719007 19:51165324-51165346 TGACTGTGGCAGTCACAGCGGGG + Intergenic
1168298446 19:55389414-55389436 TAACTCTGTCAGCCACTGCCAGG + Intronic
925139755 2:1542015-1542037 TAGCTTTTCCAGCCACAGCAAGG + Intronic
925618845 2:5770479-5770501 CAGCTGTGGCATCCAAAGTCTGG - Intergenic
926891270 2:17640985-17641007 CAGCAATGGCAGCCAGAGCCAGG - Intronic
926895615 2:17684300-17684322 TAGCTGTGGGAGCCTCGACCAGG - Intronic
927150065 2:20190355-20190377 TTGCTGGGGCAGCTCCAGCCTGG + Intergenic
928385925 2:30867984-30868006 TGGCTGAGGCAGCCTCAGCCTGG + Intergenic
928605821 2:32944672-32944694 TACCTGTGGAGGGCACAGCCTGG - Intergenic
929770260 2:44885851-44885873 CAGCTGTAGCAGCCCCAGCCTGG + Intergenic
930652661 2:53977926-53977948 TAGATGTGGCAGCCTCAGCCAGG - Intronic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
931978709 2:67671067-67671089 TAGCTGTGGCACCAACAAACTGG + Intergenic
932453046 2:71828016-71828038 TAGCTGTGGCATTCAGAGCAAGG - Intergenic
933374968 2:81467431-81467453 TAGCTGTGGCAGCCAAGGCCGGG - Intergenic
933793471 2:85902168-85902190 TAGCTCTGGCACTCACAGGCTGG - Intergenic
935260886 2:101355073-101355095 TAGCAGTGGCAGCAGAAGCCGGG - Intronic
935627636 2:105184493-105184515 TAGCCCTTGCAGCCACAGACTGG + Intergenic
935976999 2:108587861-108587883 CTGCTGGGGCAGCCAGAGCCTGG + Intronic
936477357 2:112850817-112850839 TAGCTATGGAACCCACAGCATGG - Intergenic
938820614 2:134954736-134954758 AAGCAGTGGCAGCAACAGCAGGG - Exonic
939001281 2:136738181-136738203 TGGCTGTGCCAGTCACAACCTGG + Intergenic
941324625 2:164098285-164098307 TGGCTGTGTCAGCCATTGCCTGG - Intergenic
943371668 2:187023524-187023546 TAGTAGTGGCAGCAACAGGCTGG - Intergenic
944412760 2:199458974-199458996 TTCCTGTGCCACCCACAGCCCGG - Intronic
946310936 2:218882281-218882303 TGGCTGAGGCAGCCACATCAGGG - Exonic
948762239 2:240199340-240199362 GAGCTGTGGCTGGCACAGCAGGG + Intergenic
948992743 2:241563075-241563097 CAGGTGAGGCAGGCACAGCCAGG - Intronic
949042033 2:241853936-241853958 CAGCTGTGGCAACCAGGGCCTGG - Intronic
1169345318 20:4823903-4823925 GAGCTGTGACAGCCACTCCCAGG + Intergenic
1169416733 20:5423693-5423715 GAGCTGCAGCAGCCACAACCAGG - Intergenic
1169915537 20:10678879-10678901 TAGTTGTAGCAACCACAACCAGG + Intergenic
1170099252 20:12680751-12680773 CAGCTGGGGCAGCCACAGGCCGG + Intergenic
1171262608 20:23747431-23747453 GAGCTGACGCAGCCACAGCAAGG - Intergenic
1171427964 20:25060203-25060225 AAGCTGTCCCATCCACAGCCAGG + Intergenic
1171807106 20:29689706-29689728 CAGCAGTGGCAGCGACAGCGAGG - Intergenic
1172162207 20:32876409-32876431 TAGATGTAACAGCCACAGGCTGG - Intronic
1172339299 20:34143633-34143655 CTGCTGTGGCTGCCACTGCCAGG + Intergenic
1172512237 20:35508793-35508815 TAGCTGTGCCTTCCTCAGCCAGG + Intronic
1172637318 20:36418664-36418686 GAGCTGTGACATCCACATCCTGG + Intronic
1172827693 20:37804444-37804466 TAGCTGTAGAACCCACAGCTCGG - Intronic
1174266181 20:49333827-49333849 CAGCTGTGGGAGCCACGGCCAGG + Intergenic
1175751351 20:61500084-61500106 TCACTGTGGCATCCTCAGCCAGG + Intronic
1175770252 20:61618940-61618962 TATCTGTGGGAGGCACATCCCGG - Intronic
1176138868 20:63536541-63536563 CAGCTGTGGAAGCCAGGGCCAGG + Intronic
1176861517 21:14013809-14013831 TGGCTCTGGCTGCCTCAGCCTGG - Intergenic
1178478385 21:32957405-32957427 TCGCATTGGCAGCCAGAGCCAGG + Intergenic
1179439193 21:41381218-41381240 TAGCTGTGGTGGGCACAGCTGGG - Intronic
1179584558 21:42366351-42366373 CAGCTCTGGCAGCCTCCGCCAGG - Intronic
1180942075 22:19666071-19666093 CAGGCGTGGCAGGCACAGCCAGG + Intergenic
1181695602 22:24591410-24591432 CTGATGGGGCAGCCACAGCCAGG + Intronic
1182222877 22:28772773-28772795 TAGCTGTGGCTGCGGCTGCCGGG + Exonic
1182301247 22:29338368-29338390 TGACTGTGGCAACCACAGTCTGG - Intronic
1182694854 22:32191179-32191201 TACCTGTGGCCGCCACTGCTGGG - Exonic
1182709261 22:32310448-32310470 CAGCTGTGGCTGCCCCAGCTGGG + Intergenic
1183469842 22:37999394-37999416 CCCCTGTGGCAGCCTCAGCCTGG + Intronic
1184309393 22:43631463-43631485 TAGATGAGGCAGCCTGAGCCAGG - Intronic
1184620136 22:45671307-45671329 TAGCAGTGGGAGCCTCTGCCCGG + Intergenic
1184856679 22:47150192-47150214 GATCAGTGGCAGCCACAGTCCGG + Intronic
1185316399 22:50181040-50181062 TGGCTGTGGGGGCCACACCCTGG - Intergenic
1185341589 22:50293553-50293575 TGGCAGAGGCAGCCTCAGCCAGG + Intronic
950088341 3:10277414-10277436 GTGCTGTGGGAGCCACAGCAGGG + Intronic
951519079 3:23594492-23594514 TAGGTGTGGAAGCCACAGAGAGG - Intergenic
951989942 3:28665297-28665319 TAGCTGTGGCAGACACTGTATGG + Intergenic
952931133 3:38361802-38361824 TAGAGATGGCAGCCACAGCCAGG + Intronic
953655293 3:44847002-44847024 TAGCTGTGGCAGAGACCGCATGG + Intronic
953727492 3:45412960-45412982 CAGCTGTGGCAAGAACAGCCGGG + Intronic
954301127 3:49701389-49701411 GAGCTGTGGTAGGCACATCCAGG + Intronic
954413449 3:50381268-50381290 GAGCTGGGGCAGCCCCAGCTGGG - Intronic
954650634 3:52160142-52160164 TTGCTCTGTCACCCACAGCCTGG + Intergenic
954685867 3:52369854-52369876 TAGCTGGTGAAGCCACCGCCAGG - Exonic
955388133 3:58496379-58496401 TAGCTGAGGGCGCCACAGCTGGG - Intronic
955643169 3:61108777-61108799 TGGGTGTGGCAGCCATAGCTAGG + Intronic
959995488 3:112676095-112676117 TATTTGTAGAAGCCACAGCCTGG + Intergenic
960603668 3:119482894-119482916 TAACGGTGGCCACCACAGCCTGG - Intronic
962080153 3:132129958-132129980 TAGCTGTGGATGCTCCAGCCTGG + Intronic
962197150 3:133373972-133373994 CAGCTGTCCCAGCCCCAGCCAGG - Intronic
966779519 3:183571839-183571861 TAGCAGTGGCATCCAGTGCCCGG - Intergenic
967324031 3:188221069-188221091 GGGATGTGGCAGCCAGAGCCTGG - Intronic
967351319 3:188516805-188516827 AAACTGTGGCAGGTACAGCCTGG + Intronic
968296239 3:197578433-197578455 AGGCTGTGGCTGCCACAGCAGGG + Intergenic
968584861 4:1411590-1411612 CGACTGTGGCAGCCACAGACAGG - Intergenic
969117333 4:4878919-4878941 CAGATGAGGAAGCCACAGCCCGG + Intergenic
969243475 4:5917236-5917258 TAGCTTTTGCAGCCCCAGGCTGG - Intronic
969264757 4:6057227-6057249 TCGCTGTGGCACCCTGAGCCTGG + Intronic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
971351365 4:25859093-25859115 GAGCTGGGGCAGCCTCAGGCTGG + Intronic
973543720 4:51959596-51959618 TAGCTGTGGTAGCCCCAGGTTGG + Intergenic
976587799 4:86818400-86818422 GAGCTGTGGCAGCCACTTCCAGG - Intergenic
978159335 4:105527130-105527152 TAGCTGAGGGAGCTGCAGCCTGG + Intergenic
978397903 4:108301807-108301829 CAGGTCTGGCAGGCACAGCCTGG + Intergenic
980093134 4:128462915-128462937 TAGCTGTGGCAGACCCAGCTGGG + Intergenic
980791973 4:137632090-137632112 TAGCAGTGGCACCCACACACTGG - Intergenic
982920879 4:161273566-161273588 TAGCTGGGGCAGCAAAAGGCTGG + Intergenic
984759337 4:183350388-183350410 TAGAAATGGCAGCCACAGGCTGG - Intergenic
985744391 5:1638012-1638034 TGACTGTGGCGCCCACAGCCTGG + Intergenic
986106413 5:4663606-4663628 TAACAGAAGCAGCCACAGCCTGG - Intergenic
990149392 5:52799818-52799840 TTGCAGTGGCAGCCGCAGGCAGG + Intronic
990283852 5:54279918-54279940 AAGCTGTGGCAGCAAGAGGCCGG - Intronic
991067273 5:62437376-62437398 AAGCAGTGGGAGACACAGCCAGG + Exonic
991929010 5:71733330-71733352 TTTCTGTAGCAGCCACGGCCTGG - Intergenic
992291414 5:75283608-75283630 AAGCTGTGGCAAGCACTGCCTGG - Intergenic
995214491 5:109580050-109580072 CAGCAGTGGCAGCCATAGCACGG + Intergenic
998248184 5:140529102-140529124 TAGCTCTGCCAGCAACACCCCGG + Exonic
999056940 5:148587945-148587967 ATGCTGAGGCAGGCACAGCCAGG - Intronic
999108356 5:149093640-149093662 TAGCTGTGGTAGGCAGAGGCAGG - Intergenic
999240935 5:150127008-150127030 GAGCTGTGGCAGCCCCAGCAAGG - Intronic
999240936 5:150127010-150127032 TTGCTGGGGCTGCCACAGCTCGG + Intronic
999743801 5:154576574-154576596 GACCTGGGGCCGCCACAGCCAGG + Intergenic
1001343155 5:170865548-170865570 TAACTGTGGCTGCCAGGGCCAGG - Intronic
1002300359 5:178254309-178254331 TAACTGTGGCACCCACCCCCAGG - Intronic
1003073117 6:2960125-2960147 TGGGTGTGGCAGCCCCAGCAGGG + Exonic
1003364812 6:5462996-5463018 TAGCTGTGGCAGAGACTGCAGGG - Intronic
1003522645 6:6871540-6871562 TAGCTGAGGCAGAAACAGCTAGG - Intergenic
1005312575 6:24572461-24572483 GAGCTTTGGCACCCACAGGCCGG + Intronic
1006611154 6:35295321-35295343 TCTATGTGTCAGCCACAGCCTGG - Exonic
1008369816 6:50719574-50719596 TAAATGTGCTAGCCACAGCCTGG + Intronic
1008552585 6:52647104-52647126 TTGCTGTGGCACCAGCAGCCTGG - Intergenic
1011167575 6:84466652-84466674 TAGCTCAGGCAGCCACATTCAGG - Intergenic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1012125967 6:95428480-95428502 TAGCAGTGGCTGGCACAGCTGGG - Intergenic
1015826686 6:137320230-137320252 TCGCTGTGGGTGCCACAGGCTGG - Intergenic
1016686595 6:146889177-146889199 GAGCTGAGGGAGCCACAGTCTGG - Intergenic
1018647238 6:165959961-165959983 TAGCTGCACCAGCCACAGCAAGG + Intronic
1018978599 6:168583968-168583990 TTACTGTTGCAACCACAGCCTGG - Intronic
1019071002 6:169344823-169344845 GTGCTGCTGCAGCCACAGCCTGG - Intergenic
1019418098 7:936484-936506 GCGCTGTGGCACCCACACCCTGG - Intronic
1021067556 7:16195643-16195665 TTGATGGAGCAGCCACAGCCTGG - Intronic
1022382629 7:29874657-29874679 TTGCCCTGGAAGCCACAGCCAGG - Intronic
1022534955 7:31092743-31092765 TGGCTGTGGCAGCCACACAATGG - Intronic
1022865044 7:34409053-34409075 TGCCTGTGGTAGCCACAACCTGG + Intergenic
1022889903 7:34685981-34686003 AAGCTGTGGCATCCTCATCCAGG - Intronic
1024128352 7:46323790-46323812 TACATGTGGAAGCCACAGGCTGG + Intergenic
1024199345 7:47090365-47090387 CAGGTGTGGGAGCCCCAGCCAGG - Intergenic
1024957086 7:54933456-54933478 TTGCTGCCGCAGCCACAGCCAGG + Intergenic
1027123292 7:75537602-75537624 TGGCTTTGGCATTCACAGCCAGG + Exonic
1029146922 7:98452989-98453011 TACCTGTGGCACCCACCACCAGG - Intergenic
1029597430 7:101545294-101545316 TCACTGTGGCAGCCGGAGCCTGG - Intronic
1029658894 7:101945875-101945897 TAGCTGTGTCAGCCAAGGCCGGG + Intronic
1031965424 7:128024770-128024792 TAGAAGTGGCAGCTACAGCATGG + Intronic
1032192308 7:129772037-129772059 CAGCTGTGGCCGCACCAGCCGGG + Intergenic
1033347984 7:140540321-140540343 CAGCTGTGGCTGCCACAAGCAGG - Intronic
1033474173 7:141674829-141674851 CAGCAGGGCCAGCCACAGCCAGG - Intronic
1034310379 7:150082568-150082590 TATATGTGGTAGCCACAGCAGGG - Intergenic
1034397175 7:150835998-150836020 TAAGGGAGGCAGCCACAGCCTGG - Intronic
1034796466 7:154018085-154018107 TATATGTGGTAGCCACAGCAGGG + Intronic
1034950917 7:155296973-155296995 TTGATGTGGCATCCTCAGCCTGG - Intergenic
1037761202 8:21742934-21742956 AAGCAGTAGCAGCCACAGCAGGG + Intronic
1038242016 8:25818709-25818731 TGTCTGTAGCAGCCCCAGCCTGG - Intergenic
1039469078 8:37802564-37802586 TAGCTGCGGCACCCCCACCCGGG + Intronic
1039839206 8:41281388-41281410 TTGATGTTGCAGCCACAGACAGG + Intronic
1040630977 8:49209902-49209924 GAGTTGTGGCAGCCATGGCCAGG - Intergenic
1045727126 8:105186646-105186668 TGGCTGTGGAGGCCACAACCCGG + Intronic
1046488958 8:114922295-114922317 CAGCTGTGTTTGCCACAGCCAGG + Intergenic
1047844131 8:128787783-128787805 GAGCTGGGGAATCCACAGCCAGG + Intergenic
1047965917 8:130046683-130046705 TGGCTGTGGCTGGCCCAGCCAGG + Intergenic
1049352598 8:142172058-142172080 CAGCTGGGGCACCCACAGGCTGG + Intergenic
1049446918 8:142635442-142635464 GACCTGTGGCAGCCCCAGGCTGG + Intergenic
1049685456 8:143937545-143937567 CTGCTGTGGCTGCCACCGCCAGG - Intronic
1051358980 9:16265321-16265343 TAACTGTGTCTGCAACAGCCTGG + Intronic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1052033721 9:23657143-23657165 AAACTGAGGCAGCCAGAGCCAGG - Intergenic
1052736275 9:32345538-32345560 TAGCTGAGGCAACCAGAGGCTGG - Intergenic
1053148971 9:35731015-35731037 TAACTGTGGTGGCCACAGCAAGG + Intronic
1056210151 9:84357768-84357790 TAGCTGTGTGACCCACAGCTCGG - Intergenic
1059362811 9:113759005-113759027 CAGCTGTAGCAGCCACTGCTTGG + Intergenic
1060242251 9:121914275-121914297 TAGATGTGGCAGAGATAGCCTGG + Intronic
1060898683 9:127238290-127238312 TAGCTGTGGCAGCCACAGCCAGG - Intronic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061060219 9:128246517-128246539 GGGCTGCAGCAGCCACAGCCAGG - Intronic
1061395485 9:130341400-130341422 CAGCTCTCCCAGCCACAGCCTGG + Intronic
1061816781 9:133202055-133202077 TGGCTGTGGCAGTCAGTGCCAGG - Intergenic
1061845393 9:133385310-133385332 GAGCTGTGGCAGGCAGTGCCAGG - Intronic
1062032548 9:134368204-134368226 GCACTGTGGGAGCCACAGCCAGG - Intronic
1062125018 9:134855568-134855590 GAGCTGAGGCAGACACAGGCAGG - Intergenic
1062210971 9:135363830-135363852 AGGCTGTGGCAGCTGCAGCCAGG - Intergenic
1062359027 9:136178701-136178723 GAGCTGTGGCAGCTACAGAGGGG - Intergenic
1062452484 9:136621440-136621462 GGGCTGTGGCAGCCCCAGCCTGG + Intergenic
1062582060 9:137233147-137233169 CTGCAGTGGCAGCCCCAGCCCGG + Intronic
1062685695 9:137811971-137811993 GAGCAGTGCCACCCACAGCCAGG + Intronic
1186290635 X:8093952-8093974 AAGCAGTGACCGCCACAGCCAGG + Intergenic
1189072345 X:37877048-37877070 TAGGTGTGGCAACCACATTCTGG - Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1193905873 X:87243525-87243547 TAACTATAGCAGCCACAGCTGGG + Intergenic
1195926828 X:110034450-110034472 TAGTTGTGGCAGACACAGCATGG - Intronic
1198051449 X:132956629-132956651 TTTCTGTGGCCGCCACAGCGCGG + Intronic
1198419345 X:136453923-136453945 TAGCTGTGGCAGAGACTGTCTGG - Intergenic
1199136179 X:144255566-144255588 TAGCTGTGGTAGGCAGAGGCAGG - Intergenic
1200053396 X:153446297-153446319 CAGGCCTGGCAGCCACAGCCTGG - Intronic