ID: 1060900461

View in Genome Browser
Species Human (GRCh38)
Location 9:127253197-127253219
Sequence TAGTGTCTAAAGAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060900461_1060900465 -8 Left 1060900461 9:127253197-127253219 CCCTGTCCCTTCTTTAGACACTA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1060900465 9:127253212-127253234 AGACACTACCCCAATATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060900461 Original CRISPR TAGTGTCTAAAGAAGGGACA GGG (reversed) Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904703870 1:32376171-32376193 TAGTATCCTAACAAGGGACAAGG + Intronic
906189681 1:43889178-43889200 TAGTGAATAAAGAAGGGAACAGG + Intronic
906243223 1:44255357-44255379 TAGAGTGTCAAGAAGGGAGAAGG - Intronic
906849036 1:49227932-49227954 TAGGATGTAAGGAAGGGACAGGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
911944288 1:104086518-104086540 TAGTTTTTAAAGAAGGGACAAGG + Intergenic
913117613 1:115711333-115711355 TTGTGTCTAAAGAGGGCACTGGG + Intronic
913382416 1:118226635-118226657 GAGTGCCTAAAGAAGGGAACAGG - Intergenic
913986054 1:143567072-143567094 TTGTGTCTAAAGAACGGAGATGG - Intergenic
914802477 1:150971709-150971731 AATTGAATAAAGAAGGGACAAGG + Intronic
915457249 1:156048936-156048958 GAGTGTCCAAAGAAGTGTCAGGG + Intronic
915708709 1:157872456-157872478 TAGTGTCTTCAGGAGGAACAAGG - Intronic
917514256 1:175694087-175694109 TGGTGTCTGAAGAGAGGACATGG - Intronic
920871971 1:209802624-209802646 GAGTTTCTCAAGAAGGAACATGG - Intronic
920924221 1:210327149-210327171 TAGTGTCAAACTCAGGGACAGGG - Intergenic
920988079 1:210909308-210909330 GAGTGTGTAAAGGAGGGAGAAGG - Intronic
921367741 1:214389777-214389799 TATACTCTAAAGAAGGGAAAAGG + Intronic
923102058 1:230824596-230824618 TATTGTCCAAAGAAGGGAAGAGG - Intergenic
923152851 1:231249630-231249652 TAGTGGGAAAAGAAGTGACAGGG + Intronic
924018530 1:239754838-239754860 TAGAGGCTAAAGGAGGCACAGGG + Intronic
924201417 1:241663308-241663330 TAATGGCAAAAGAAGGGACGGGG - Intronic
1064497652 10:15930658-15930680 TAATGTACAATGAAGGGACAAGG - Intergenic
1066685216 10:37975552-37975574 TAGTTTCTAAAGACAGGAAATGG - Intronic
1067363711 10:45605265-45605287 CATTCTCTAAAGAGGGGACACGG - Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1068913302 10:62402001-62402023 TAGTGTCAAAACATGGGAGATGG + Intronic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1071822102 10:89289389-89289411 TAGTGTGTAAGGAAGGGAGGGGG - Intronic
1074366868 10:112865027-112865049 CAGTGGCTATAGAAGGCACAAGG - Intergenic
1075154287 10:119961664-119961686 TAGATTCTCAAGAAGCGACAGGG + Intergenic
1076095269 10:127729552-127729574 TAGTGTCTTTTGCAGGGACATGG - Intergenic
1079510746 11:21206856-21206878 AAGTGTCTAAAGATGAAACATGG - Intronic
1080907461 11:36561026-36561048 TTGTGCCTAAGGAAGGTACATGG - Intronic
1081047143 11:38290088-38290110 TAGTATCTAGAAAAGAGACAGGG - Intergenic
1082211573 11:49509213-49509235 TAGTCAGTAAAGCAGGGACAGGG - Intergenic
1084044144 11:66559460-66559482 TAGTGTCTTGAGAAGGGCAATGG - Intronic
1084568363 11:69944349-69944371 TAGTGTCTAGGGAATGGAAAGGG + Intergenic
1085278345 11:75314217-75314239 TTGTGTGTAAGGAAGGGATAGGG + Intronic
1087006015 11:93472505-93472527 TAGTGTCCAAACAAGAGAAATGG - Intergenic
1087265118 11:96052218-96052240 TAGTGACTACAGAAAGTACAGGG + Intronic
1087507353 11:99042673-99042695 TAGAGTTTAAAGAAGGGAGGTGG - Intronic
1097777153 12:63661112-63661134 TAGTGTGTAAATAATGGCCAGGG - Intronic
1100209166 12:92383459-92383481 TTCCGTTTAAAGAAGGGACAGGG + Intergenic
1100250438 12:92816265-92816287 TAGTTTCTAGGGAAAGGACACGG + Exonic
1100934702 12:99649464-99649486 TAGTGCCTGATGAAGGGGCAGGG + Exonic
1101059330 12:100954636-100954658 TAGCCTCAAATGAAGGGACAGGG - Intronic
1102232855 12:111275571-111275593 TAGTGTCAGGAGAAGTGACAGGG - Intronic
1103324761 12:120113062-120113084 TTGTGTTTTAAGTAGGGACAGGG + Intronic
1104491065 12:129193975-129193997 TAGAGTCCAAACAAGAGACATGG - Intronic
1106639718 13:31571329-31571351 TTTTGTCTTAAGAAGGGACTTGG - Intergenic
1107182754 13:37480922-37480944 TAGTAAATAAAGAACGGACAAGG + Intergenic
1107499908 13:40963200-40963222 TAGTGTATAAGTAAAGGACATGG - Intronic
1108086410 13:46797523-46797545 TAGTTTCTACATAAGTGACACGG - Intergenic
1108490141 13:50973763-50973785 AAGTGACTAAAGAAGGTGCAAGG - Intergenic
1110249457 13:73365244-73365266 TATGCTCCAAAGAAGGGACAAGG - Intergenic
1110452787 13:75655969-75655991 TGGTGTCTCAAGATGGGACAAGG - Intronic
1116790675 14:49336719-49336741 TAGTCTATAAAGAATGTACAGGG + Intergenic
1116799728 14:49429913-49429935 TGTTGTCTCAGGAAGGGACAAGG - Intergenic
1118470941 14:66074856-66074878 TATTGTCTCAAGACAGGACAAGG + Intergenic
1118663899 14:68045747-68045769 TAGTGACTAGGGAAAGGACAAGG + Intronic
1118930533 14:70236239-70236261 TAGACTCCAAAGAAGGGACAAGG - Intergenic
1118954331 14:70466013-70466035 TAGACTCCAAAGAAGGGACAAGG + Intergenic
1121620548 14:95344930-95344952 TAATGCCTTAAGAATGGACAAGG + Intergenic
1126061950 15:44791527-44791549 AAGTAACTAAACAAGGGACAAGG + Intergenic
1126729374 15:51666495-51666517 TAGTGCAAAAAGAAGGGAAAGGG + Intergenic
1126841701 15:52723567-52723589 TAGTGTGGAAAGGAGGGAGAAGG - Intergenic
1126934994 15:53696936-53696958 TTGTGTCTAAAGAAGTGAAGAGG + Intronic
1128565050 15:68695551-68695573 TGCTGTCTAAAGAAGGGCAAGGG + Intronic
1131026981 15:89151660-89151682 ATGTATCTAAAGAAAGGACAAGG - Exonic
1131127849 15:89870388-89870410 AAGTATCTAAAGAAGGAAAAGGG + Intronic
1131857891 15:96618012-96618034 TAGGGTCTTCAGAGGGGACAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134841257 16:17403820-17403842 TTGTGTCTGGAGAAGAGACAAGG - Intronic
1135559162 16:23461963-23461985 TGGTCTGTAAAGAAGGCACAAGG + Intergenic
1138023487 16:53504295-53504317 TGGTGTCTAGAAAAGGGGCAGGG - Intronic
1138731777 16:59203274-59203296 TAGTGACCAAAGAAGGGCAATGG + Intergenic
1142861481 17:2764813-2764835 AAGGGTCTAAAGCAGTGACAGGG + Intergenic
1142899342 17:3002669-3002691 AAGAGTATAAAGGAGGGACAGGG + Intronic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150031324 17:61739105-61739127 TGTGGTCTAAAGAAGGGAAAAGG + Intronic
1155517970 18:26641716-26641738 TTGTGCCTAAAGAAGGGGCATGG - Intronic
1156920207 18:42513135-42513157 TAGTGTGGAAAGAAGGAGCAGGG + Intergenic
1158163679 18:54514938-54514960 TAGTGTTTAAAGAAAAGATAAGG + Intergenic
1158894892 18:61903529-61903551 TAAGGTGTAAGGAAGGGACATGG + Intergenic
1163229478 19:15990510-15990532 TAGGGACAAAAGAAGAGACAAGG - Intergenic
1165375002 19:35435609-35435631 TTGTCTCTAAAGAAGGAAAAAGG - Intergenic
1166059497 19:40317011-40317033 TAGTCTCTGAGGAAGGGACTAGG + Intergenic
927727446 2:25437432-25437454 TTGTGTTTTAAGTAGGGACAGGG + Intronic
927814736 2:26204970-26204992 AAGTGTTTAAGGAAGGGATAAGG - Intronic
929240796 2:39651106-39651128 GTGTGTTTGAAGAAGGGACATGG + Intergenic
930408486 2:50993462-50993484 CAGTGACTAAAGAAGGGAAAGGG - Intronic
931800314 2:65751524-65751546 TAGTGTTTGAAGAAGGGCTAAGG + Intergenic
932185657 2:69693388-69693410 TAGGGTCTAAGAGAGGGACAGGG + Intronic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
937874129 2:126808116-126808138 TGGTGACTAGAGAAGGCACAGGG + Intergenic
940933523 2:159465133-159465155 TAGTGCCTTCAGAAGGAACATGG - Intronic
948781082 2:240322353-240322375 CAGTGTCAAAAGAAGGGCAAAGG + Intergenic
1168925997 20:1579401-1579423 AAGGGTCTAAAGAAGTCACAGGG - Intronic
1168929877 20:1612446-1612468 AAGGGTCTAAAGAAGTCACACGG - Intronic
1169895355 20:10500041-10500063 CAATGTCTAATAAAGGGACAGGG - Intronic
1176695683 21:9974637-9974659 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1177230067 21:18308164-18308186 TAGTGTTTAAAGTAGGAACTTGG + Intronic
1183289107 22:36987957-36987979 TAATGACTAAAGAAGCCACACGG - Intergenic
949669521 3:6382441-6382463 TAGTCTCTGAAGAAAGGAAATGG + Intergenic
949844684 3:8357562-8357584 TAGATTCTATAGAAGGGACGGGG - Intergenic
952112526 3:30140418-30140440 TAGTATCTAAAGCAGGGAAGAGG - Intergenic
952703941 3:36357684-36357706 TAGTGTATAAGGAAGTGAGAAGG - Intergenic
956267487 3:67413390-67413412 GTCTGTCTAAAGAAGGAACATGG + Intronic
958027937 3:88071335-88071357 TTGTGTCTTTAGTAGGGACAGGG - Intronic
958673757 3:97238835-97238857 TAGAGGCTAAAGAATGGACGGGG + Intronic
959966031 3:112356205-112356227 TATTGTATAAAAAAGGGAGAAGG - Intronic
963116577 3:141735437-141735459 TACTGTCTAAATAAAGGAAAGGG - Intergenic
963190583 3:142467315-142467337 TTGTGACTAAAGTAGGAACATGG - Intronic
963427132 3:145144964-145144986 TAGTGTTTAAAGAATGAAAACGG - Intergenic
964090467 3:152870202-152870224 TGATTTCTACAGAAGGGACATGG + Intergenic
966552085 3:181216532-181216554 AAGAGTCTAAAGAACGAACAGGG + Intergenic
967630116 3:191735903-191735925 TAGTGTCTTTTGTAGGGACATGG + Intergenic
968033362 3:195523201-195523223 TAGTGTCACAGGAAGGGAGATGG - Intronic
969145525 4:5120354-5120376 TATTGTCACAAGAAGGGAAAGGG + Intronic
970739021 4:19210970-19210992 AAGTTTTTAAAAAAGGGACAGGG + Intergenic
971233864 4:24823910-24823932 TAGTGTCTATTGAAGGGTCAGGG - Intronic
972517213 4:39819580-39819602 AGGTGTCTAAAGAAGTGACTGGG - Intergenic
972596603 4:40535077-40535099 TAATCTCTAAAGAAGGGGCTAGG - Intronic
974302631 4:60087774-60087796 TAGTTTCTAAAGAAGTTTCAGGG + Intergenic
975733809 4:77362911-77362933 TGGTGTCTAAGGAATGGCCACGG + Intronic
975925657 4:79448589-79448611 TAGTGTCTAGTGATGGAACAGGG + Intergenic
976525220 4:86079246-86079268 TAGTGTTATAATAAGGGACATGG + Intronic
976590784 4:86848012-86848034 TAAAGTGTAAATAAGGGACAAGG + Intronic
978612927 4:110564557-110564579 TAGTGTCTTAAGTAGGGATGGGG - Exonic
979724805 4:123948095-123948117 TAATGTCTGAAGAAGGTAAAAGG - Intergenic
980368305 4:131834870-131834892 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981998541 4:151001364-151001386 TACTGTGGTAAGAAGGGACAGGG - Intronic
982363236 4:154546579-154546601 TAGTATGTAAAGAAAGTACAGGG - Intronic
982739023 4:159038736-159038758 TAGGATCTAGACAAGGGACAAGG + Intronic
983215315 4:164997119-164997141 TAGATTGTAAAGAAGAGACAGGG + Intergenic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
984865867 4:184280097-184280119 TTGTGTCTATGGAAGGGACTAGG + Intergenic
986463853 5:8001275-8001297 TTGTGTCTAAAGAGGGTTCATGG - Intergenic
987212284 5:15695137-15695159 TAGAGTCAAAAGAAAGGAAAAGG + Intronic
988640299 5:33034313-33034335 TAGTGTCGAAAGCAGGGAGAAGG - Intergenic
989837201 5:46007735-46007757 TAGATTGTAAAGAAGAGACAAGG - Intergenic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
991068862 5:62455004-62455026 TAGGGACTAAAGTAGGGACTAGG + Intronic
992529485 5:77640904-77640926 AAGTGGCTAAGGAAGAGACAGGG + Intergenic
992738711 5:79751112-79751134 AAGTGTCTAAGGAAGGATCAGGG - Intronic
993151038 5:84162338-84162360 CAGTGTCTAAGGAAGGAACTGGG + Intronic
995979871 5:118088441-118088463 AAGTGTTTTAAGAAGGGAAATGG - Intergenic
996347195 5:122499906-122499928 TCTTTTGTAAAGAAGGGACATGG + Intergenic
997786415 5:136717931-136717953 TAGGGCCCAAAGAAGGAACAGGG + Intergenic
999727487 5:154448275-154448297 AAGAGTCTGAAGAAAGGACAGGG - Intronic
1000705028 5:164500541-164500563 TATTGACTGAAAAAGGGACATGG - Intergenic
1003690525 6:8349199-8349221 TAGTGTGGAAAGAAGAGATAAGG - Intergenic
1007065004 6:38981221-38981243 CAGTCTCTAAGGAAGGGCCAGGG - Intronic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1008542553 6:52557885-52557907 TTGTGTCTAAAAAATGGCCATGG - Intronic
1009715875 6:67394535-67394557 TTGTGACTAAACAAGGGCCAAGG + Intergenic
1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG + Intergenic
1012268906 6:97183257-97183279 AAGTGTCCTAAAAAGGGACAGGG - Intronic
1014689069 6:124539633-124539655 TAGTGATTAAAGAAAGGAAATGG + Intronic
1014911521 6:127099809-127099831 TATAGTGTTAAGAAGGGACAAGG + Intergenic
1016261985 6:142182887-142182909 AAGTGTAGAAAGAAGAGACAAGG + Intronic
1018691604 6:166349340-166349362 TAGTTAATAAAGAAGTGACAGGG - Intergenic
1020149761 7:5673000-5673022 TTGTGTCTTAACAAGAGACACGG + Intronic
1021047293 7:15939493-15939515 TAGTGACTAAAGAAGAATCAAGG - Intergenic
1022361257 7:29660656-29660678 TAGTGTGTAAATAATGGCCAGGG + Intergenic
1022936069 7:35178786-35178808 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1029832037 7:103271502-103271524 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1031205789 7:118755988-118756010 TAGTGTCAAAAGAAGAGAAGTGG - Intergenic
1032265592 7:130368004-130368026 TGGTGTCTGAAGCAGGGCCAGGG - Intronic
1033091100 7:138386655-138386677 TACTGTTTAATAAAGGGACAGGG + Intergenic
1034033292 7:147791582-147791604 GAGAGTATAAGGAAGGGACAAGG + Intronic
1035924729 8:3715497-3715519 TAGTTTGTAAAGATGGGAAATGG - Intronic
1036974400 8:13394787-13394809 TGGTGTCTACAGGAGGGACTAGG + Intronic
1037453103 8:19036813-19036835 TAGTGTCTAAAGAAGAGCCCTGG - Intronic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1038645193 8:29355243-29355265 TATATTCTAAAGCAGGGACAAGG - Intergenic
1041031808 8:53744481-53744503 TGGTGGCTGAAGAATGGACAGGG - Intronic
1043132726 8:76481778-76481800 AAGGGACTAAAGAAGGGAGACGG - Intergenic
1044190895 8:89316188-89316210 TAGTGTCTAAAAAAGGGGCTAGG + Intergenic
1045316196 8:101045801-101045823 CAGTGTCTAGAGAAGCCACAGGG + Intergenic
1047096187 8:121628607-121628629 TACTGTGTTCAGAAGGGACAAGG + Intronic
1051423400 9:16911308-16911330 TAGTATCTCAAGAAGTTACAAGG + Intergenic
1052452722 9:28652594-28652616 TAGTTTCTTAAGAAGCAACAAGG - Intronic
1053632668 9:39960594-39960616 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1053773091 9:41502939-41502961 TTGTCTCTGAAGAAGAGACAGGG - Intergenic
1054211220 9:62290103-62290125 TTGTCTCTGAAGAAGAGACAGGG - Intergenic
1054313759 9:63558742-63558764 TTGTCTCTGAAGAAGAGACAGGG + Intergenic
1055725062 9:79218615-79218637 AAGTGACTAAAGGAGGTACAGGG + Intergenic
1056024858 9:82483331-82483353 TACAGTCTAAAGAAGGAAGAGGG - Intergenic
1056146129 9:83731202-83731224 TAATGTCTAATGAAGGAAAATGG - Intergenic
1060257632 9:122046661-122046683 AAGTGTCTGAAGAAGAGAAAAGG - Intronic
1060900461 9:127253197-127253219 TAGTGTCTAAAGAAGGGACAGGG - Intronic
1186675813 X:11816188-11816210 TGGTGTCTAATGAAGGTACATGG - Intergenic
1187721559 X:22156171-22156193 TATTGTCTTAAGAAGGGGTAGGG + Intronic
1190756805 X:53408463-53408485 CAGTGTCTAGAGAAGTGATAGGG + Intronic
1194793867 X:98185516-98185538 TAGTACCTAGAGAAGTGACAAGG - Intergenic
1194863451 X:99034777-99034799 ATGTGTCTAAAGCAGAGACAAGG + Intergenic
1195025025 X:100868132-100868154 TAGTTTCTAAAGAAGGATCAAGG + Intronic
1196776920 X:119346891-119346913 TAGTATATAAAGAAGAAACAGGG + Intergenic