ID: 1060903019

View in Genome Browser
Species Human (GRCh38)
Location 9:127277959-127277981
Sequence CACTGAGCCAAGTACTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060903019 Original CRISPR CACTGAGCCAAGTACTGCTG GGG (reversed) Intronic
901203454 1:7479833-7479855 CACATAGCCAAGTGCTCCTGTGG + Intronic
906945156 1:50288874-50288896 GAGTGAGCCAAGTACAGGTGTGG - Intergenic
907111430 1:51929874-51929896 CGCTGAGCCAAGTTCTGCCCTGG - Intronic
907745102 1:57205270-57205292 GAATCAGCCAATTACTGCTGGGG - Intronic
908485257 1:64585576-64585598 GACAGAGCCAAGAACTGCTTGGG + Intronic
908877135 1:68690364-68690386 CCCTGTGCCAGGTACTGCTCTGG + Intergenic
909130386 1:71728388-71728410 TACTGAGAAAACTACTGCTGAGG + Intronic
911037151 1:93562996-93563018 CACTGTGGGAAGTAGTGCTGTGG + Intronic
911602295 1:99858980-99859002 CACTGATCCAAATACTGTTTTGG + Intronic
912845538 1:113071724-113071746 CAGTGAGCCACTTACTGCGGAGG + Intergenic
914227193 1:145730414-145730436 CACTCTGCCAAGCCCTGCTGGGG - Intronic
914446963 1:147758496-147758518 CACTTAGCCATGTGCTGCCGCGG + Exonic
915031334 1:152882723-152882745 AACTGAGCCAGTTACTGCTGTGG - Intronic
915269459 1:154743265-154743287 CAGTGAGGCAACTACTGCAGTGG - Intronic
916470094 1:165115442-165115464 CACTGTGCTAGGTACTACTGGGG - Intergenic
917600418 1:176568335-176568357 CTCTGTGCCAAGCACTACTGTGG + Intronic
918117547 1:181509872-181509894 CACTCAGCAATGTACTTCTGGGG - Intronic
918599145 1:186333120-186333142 ACCTGTGCCAAATACTGCTGTGG + Exonic
919165766 1:193889411-193889433 CACTGAAACAAGTACTGCCAGGG - Intergenic
919512382 1:198481307-198481329 AACTGAGCCAGGTGCTGCTCGGG - Intergenic
923064987 1:230509474-230509496 CCCTGAGACAAGTTTTGCTGGGG + Intergenic
924200020 1:241649002-241649024 AACCTTGCCAAGTACTGCTGAGG - Intronic
1063152408 10:3348749-3348771 CACTGATGCACGTGCTGCTGTGG - Intergenic
1063162926 10:3432741-3432763 CACAGAGCCCAGTTCAGCTGGGG - Intergenic
1063598432 10:7458587-7458609 CACTGGGCGCAGTCCTGCTGTGG - Intergenic
1065306280 10:24372164-24372186 CACTGAGACAAGTATTGCCAAGG + Intronic
1066017907 10:31266664-31266686 CACTGAGCTAAGTCGTGATGAGG - Intergenic
1066108937 10:32179545-32179567 GACTGAGCAAATTACTGCTATGG + Intergenic
1067719222 10:48714428-48714450 CACAGAGCCAATGACTTCTGTGG + Intronic
1068271789 10:54737064-54737086 CACTGAGGCATGTAATGCTTTGG - Intronic
1068594571 10:58888779-58888801 AACTGAGCCAAGTTCTTCTGAGG - Intergenic
1069649120 10:70030387-70030409 CACCAAGCAAAGTACTGGTGAGG + Intergenic
1070318644 10:75337637-75337659 CACTAATCTAGGTACTGCTGTGG - Intergenic
1070637385 10:78140187-78140209 CACTTTGCCATGTTCTGCTGTGG + Intergenic
1070657568 10:78281949-78281971 CACAGAGCCAGGCACTGCAGGGG + Intergenic
1072909604 10:99488160-99488182 CACTGAGCTAGGCACTGTTGAGG + Intergenic
1073970173 10:109038861-109038883 TACTTAGGCAAGTACAGCTGAGG - Intergenic
1075849519 10:125575569-125575591 CTCTGAGCCAAGTCCTGTTGGGG - Intergenic
1077293162 11:1809685-1809707 CGCTGAGACAAGTACTGCCAGGG + Intergenic
1078691009 11:13580305-13580327 CCCTAAGCCAAGTAATACTGTGG - Intergenic
1080841862 11:35991224-35991246 AACTTAGCCTAGTACTGTTGTGG + Intronic
1081621840 11:44623492-44623514 GTCTGAGCCAAGTGCTGCTGTGG + Intergenic
1082281296 11:50273943-50273965 TACTGAGACAAGGACTACTGTGG - Intergenic
1083186592 11:61021447-61021469 CGCTGAGCCCAGGGCTGCTGTGG - Intergenic
1083606443 11:63981701-63981723 CCATGAGCCAAGGACTGCAGGGG + Intronic
1084045286 11:66564591-66564613 CAATGAGCCAAGGGCTGCAGAGG + Exonic
1085834592 11:79938926-79938948 CAATGTACCAAGAACTGCTGTGG + Intergenic
1086125827 11:83347408-83347430 CACTGAGCAAAGTACTGTGAAGG - Intergenic
1090086856 11:123657604-123657626 AGCTGAGCCAATTCCTGCTGTGG - Intergenic
1091179348 11:133589353-133589375 CACTGAGCCAAAGGCTGGTGTGG + Intergenic
1097342906 12:58459416-58459438 TACTGAGCCAGATACAGCTGAGG - Intergenic
1097345506 12:58487851-58487873 CACAGAGCCAGTAACTGCTGGGG - Intergenic
1098291323 12:68959200-68959222 CTCTGTGCCAGGGACTGCTGTGG - Intronic
1099564757 12:84229598-84229620 CTCCAAGCCTAGTACTGCTGCGG + Intergenic
1099731867 12:86514514-86514536 CACTGAGTGAAGTAATGCAGGGG - Intronic
1101724857 12:107380402-107380424 CACGCAGCCAAGTTCTGGTGTGG - Intronic
1101750377 12:107578559-107578581 CACTGAGCAAAGGAATGATGAGG + Intronic
1103007849 12:117436087-117436109 CACTGAGCCAAAAACTACTCAGG + Intronic
1103269558 12:119661801-119661823 CCTTGATCCAATTACTGCTGTGG + Intergenic
1106034423 13:26030888-26030910 CGCTGAGACAAGTACTGCCAGGG + Intergenic
1106815481 13:33402762-33402784 CACTGAGAGAAGTTCGGCTGGGG + Intergenic
1109245550 13:59950336-59950358 CACTGAAACATGTGCTGCTGGGG - Intronic
1113343541 13:109450432-109450454 CACTGAGCCTGGGAGTGCTGGGG - Intergenic
1114266794 14:21077062-21077084 CACTGTGCCATGTTCTACTGGGG + Intronic
1115408087 14:33041657-33041679 CACTGAGACAAGTATTGCCAGGG + Intronic
1115421905 14:33204662-33204684 CACTGAGCAAAGCACTGCTTTGG + Intronic
1115641831 14:35340156-35340178 CACAGAGCAAGGTCCTGCTGAGG - Intergenic
1120415653 14:84215466-84215488 CACTGAGGCGAGTTCTGCTGGGG - Intergenic
1121494826 14:94385096-94385118 CACTGAGCCCTGTAATGATGGGG - Intronic
1122510472 14:102262936-102262958 CACTGAGCCAATTGTTCCTGGGG - Intronic
1122756698 14:103986037-103986059 CTGTGTGCCAAGTACTGCTCAGG - Intronic
1122803026 14:104241527-104241549 CACAGAACCAAGTGCTGTTGGGG + Intergenic
1128035549 15:64521989-64522011 CACTTGGCCAACTAATGCTGAGG + Intronic
1128796212 15:70468636-70468658 CACAGGTGCAAGTACTGCTGGGG + Intergenic
1129656995 15:77530970-77530992 CACTGTGCTAAGTACTGGGGAGG - Intergenic
1131118426 15:89808440-89808462 CACTGTGCTAAGTGCTGGTGAGG - Intronic
1134126434 16:11619335-11619357 CTCTGAGCCCAGCAGTGCTGGGG - Intronic
1134195376 16:12155560-12155582 CACTGAGCCAACTATAACTGGGG + Intronic
1140601658 16:76483342-76483364 CACTGAACAAATTACTCCTGGGG + Intronic
1141113798 16:81291517-81291539 CCCTGAGCCAGGTAGTGATGGGG + Intergenic
1141826405 16:86483810-86483832 CCCAGAGCCAAGTCATGCTGGGG + Intergenic
1143257181 17:5568762-5568784 CCCTAAGCCCAGTAATGCTGTGG + Intronic
1143480125 17:7223306-7223328 CACTGCCCCAGGTGCTGCTGGGG - Intronic
1143537514 17:7549978-7550000 CCCTCAGCCAACTACAGCTGGGG - Intronic
1145828736 17:27897853-27897875 CACTGAGCTTCGTCCTGCTGGGG + Intergenic
1145845012 17:28031018-28031040 CACTGAGCAACCTTCTGCTGAGG + Intergenic
1146305522 17:31727187-31727209 CACTGCCCCAGGTCCTGCTGGGG - Intergenic
1151407943 17:73901665-73901687 CACTCAGCGAGGCACTGCTGGGG - Intergenic
1152358543 17:79818728-79818750 CACTGAGCCAGGTGCCGCGGAGG - Intergenic
1152530137 17:80913837-80913859 CACTGAGGTGAGAACTGCTGGGG - Intronic
1153225330 18:2895499-2895521 CGCTGAGCCAAGCCCTGCCGGGG - Intronic
1153817989 18:8807584-8807606 CACAGAGCCATGTAGTGCTAGGG + Intronic
1153954252 18:10082819-10082841 CACTGAGACAAGTATTGCCGGGG + Intergenic
1154529682 18:15331046-15331068 CACTGGGCCCTGTACAGCTGCGG + Intergenic
1157811073 18:50696405-50696427 CACTGAGCTGAGCACTGTTGGGG + Intronic
1157975181 18:52319161-52319183 CACTGATCCAAGTACTGTGCAGG - Intergenic
1158031083 18:52965972-52965994 CACAGAGCCAAGTACATCAGTGG - Intronic
1159198424 18:65149522-65149544 CACTGAGACAAGTACTGCCAGGG + Intergenic
1160571248 18:79818975-79818997 CACAGTGCCCAGTTCTGCTGGGG + Intergenic
1161865294 19:6828613-6828635 CACTGAGCCAGGTCCTGGGGAGG - Exonic
1164012378 19:21214889-21214911 AACTAAGACAAGTACTGTTGAGG + Intergenic
1165120806 19:33557212-33557234 CAGTGAGCCAGGTACAGCTCTGG + Intergenic
1167049186 19:47068287-47068309 CACTGTGGCAAGTCCAGCTGTGG + Intronic
1167451241 19:49570822-49570844 CCCAGAGCCAAATACTGCAGAGG - Intronic
1168102237 19:54147421-54147443 CACTGAGGCAGGTACTCCAGGGG + Intronic
927072488 2:19545413-19545435 AACTGTGCCAGGTACTGCTATGG + Intergenic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
933733452 2:85476205-85476227 CACTGCACCAAGTCCAGCTGGGG + Intergenic
935110182 2:100085946-100085968 AGCTGAGCCAGGCACTGCTGTGG + Intronic
935356470 2:102206449-102206471 CCCTAAGCCCAGTAATGCTGTGG + Intronic
935576449 2:104716647-104716669 CCCTAAGCCCAGTAATGCTGTGG + Intergenic
935928119 2:108092834-108092856 CCCTAAGCCCAGTAATGCTGTGG + Intergenic
937974158 2:127571232-127571254 CACTGTGCCAGGTGCTGGTGGGG - Intronic
938528776 2:132162486-132162508 CACTGGGCCCTGTACAGCTGCGG + Intronic
938708412 2:133954027-133954049 CACTGAGACAAGTATTGCCAGGG - Intergenic
939235884 2:139492271-139492293 TACTGTGTCAAGTACTGCTGGGG - Intergenic
940315033 2:152319744-152319766 CCCCAAGCCCAGTACTGCTGTGG + Intergenic
940660681 2:156541457-156541479 CACTAAGCTAAGTACTACTGTGG - Intronic
940840876 2:158580447-158580469 CACTGAGCCTCTTACTGCTCGGG - Intronic
941092224 2:161191070-161191092 CACTGAGAGAAGAACTGATGTGG - Intronic
941500162 2:166264160-166264182 CACTGTGCTAAGAATTGCTGAGG - Intronic
942139929 2:172967582-172967604 AACAGAGACAAGCACTGCTGTGG - Intronic
943701595 2:190993886-190993908 CACTGCGCTAGGTCCTGCTGGGG + Intronic
943761547 2:191614924-191614946 CATTGAGCCAAGCCCTGATGAGG - Intergenic
945973939 2:216256299-216256321 CTGTGTGCCAGGTACTGCTGTGG + Intergenic
945974921 2:216263007-216263029 CACTGATCTATGTAGTGCTGAGG + Intronic
946845650 2:223856676-223856698 CCATGGGCCAAGTCCTGCTGAGG + Intronic
947637996 2:231689805-231689827 CTTTGAGCCAAGTTCTGCTGTGG - Intergenic
947958464 2:234214741-234214763 AACTCATTCAAGTACTGCTGGGG - Intergenic
948425213 2:237883023-237883045 CTCTGAGCCAAGTGCAGTTGAGG + Intronic
948774805 2:240278642-240278664 CCCTAAGCCCAGTAATGCTGTGG - Intergenic
949076798 2:242064321-242064343 CTGTGAGCAAAGCACTGCTGTGG + Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171044914 20:21801121-21801143 CTCAGATCCAAGTGCTGCTGTGG - Intergenic
1171288641 20:23966512-23966534 CACTGAGACGAGTACTGCCAGGG + Intergenic
1172719384 20:36987777-36987799 CACTGAGACAAGTATTGCCAGGG - Intergenic
1172861987 20:38061774-38061796 TACTGGGCCAAATACTACTGGGG - Intronic
1174123967 20:48289055-48289077 CTATGTGCCAAGTACTGATGTGG - Intergenic
1174185794 20:48705079-48705101 CTCTGAGCCAGGCACTGCCGAGG + Intronic
1175653324 20:60748023-60748045 CACTGTGAAAAGAACTGCTGTGG - Intergenic
1175941620 20:62539975-62539997 CACTGTGCCAAGGGCTTCTGGGG + Intergenic
1176767728 21:13037426-13037448 CACTGGGCCCTGTACAGCTGCGG - Intergenic
1178314359 21:31557029-31557051 CAGTGAACCAAGGACTGCTGTGG - Intronic
1179285089 21:39970339-39970361 CACTGAGACAAGTATTGCCAGGG - Intergenic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1183499195 22:38168333-38168355 CAGTCTGCCAAGCACTGCTGGGG + Intronic
949388956 3:3537615-3537637 CACTAAGCAAGTTACTGCTGGGG + Intergenic
956372505 3:68579021-68579043 CCCTAAGCCCAGAACTGCTGTGG + Intergenic
956536439 3:70282063-70282085 CACTGAGACAAGTACAGCCAGGG + Intergenic
957569514 3:81928325-81928347 AACTGTACCAAGTACAGCTGAGG + Intergenic
959297461 3:104555159-104555181 CACTGAGCCAACTACTCCTATGG - Intergenic
962246646 3:133800821-133800843 CCATGAGCCAAGTACTGTTCAGG + Intronic
962312631 3:134337181-134337203 CACTGACGCAAGTACAGGTGAGG + Intergenic
962615674 3:137124062-137124084 CCCTAAGCAAATTACTGCTGTGG - Intergenic
964403383 3:156322819-156322841 GACTGCTCCAAGTACTTCTGGGG + Intronic
966194072 3:177296583-177296605 CAGTGAGCCAAGTTCTTGTGTGG + Intergenic
966931516 3:184678658-184678680 CCCTGAGCCAAGGGCAGCTGAGG - Intronic
967330674 3:188286243-188286265 CTCTGACACAAGTGCTGCTGTGG + Intronic
967407395 3:189132898-189132920 CACTGAGCTAAGTTCTGTGGGGG + Intronic
967590784 3:191271436-191271458 CACTGAGACAAGTATTGCCAAGG - Intronic
968341750 3:197961154-197961176 CATTTAACCAAGTACTGCTATGG + Intronic
968589780 4:1451571-1451593 CTCTGTGCCAAGCCCTGCTGGGG + Intergenic
969087843 4:4669708-4669730 CAATGAGCCAGGTGCTGTTGTGG - Intergenic
969231224 4:5833033-5833055 CATGGAAGCAAGTACTGCTGGGG + Intronic
970205512 4:13651732-13651754 CTTTGAGCCAGGTACTGCTGTGG - Intergenic
975457021 4:74603978-74604000 CACTTAGCCAATTATTGCTAGGG - Intergenic
975910892 4:79265653-79265675 AAATGAGCCAAGGACTGATGAGG - Intronic
976187840 4:82459976-82459998 CACAGAGGCCAGTGCTGCTGAGG + Exonic
977185019 4:93925812-93925834 CCCTAAGCCCAGTAATGCTGTGG - Intergenic
979959013 4:126993150-126993172 CAATGAGCCAAGAAATGCAGTGG - Intergenic
982621701 4:157715409-157715431 CACTGAGCCAAGTACTCAACGGG + Intergenic
985715177 5:1454042-1454064 CCCTGAGCAAAGCACTGCTCTGG - Intergenic
986398981 5:7361091-7361113 CTCTGAGCCAAGGAATGCAGGGG + Intergenic
987083163 5:14444318-14444340 CATTGTGACAAGTACTTCTGTGG - Intronic
987203504 5:15601451-15601473 CACTGAGACAGATGCTGCTGCGG - Intronic
988276031 5:29081780-29081802 CACTTAGCCAAATACTTATGAGG - Intergenic
990516984 5:56539442-56539464 CACTAATCTAAGTACTGCTATGG + Intronic
992083352 5:73255990-73256012 CACTGACCCCTGTCCTGCTGGGG - Intergenic
993379992 5:87195974-87195996 AACTGGGCCCAGTACTGCTGAGG + Intergenic
995718141 5:115101109-115101131 TGCTGAGCTGAGTACTGCTGTGG - Intergenic
997728774 5:136147718-136147740 CACTATGCCAAGTACTGTTAAGG - Intronic
998984665 5:147743143-147743165 CACTGAGAGAAGTACTCATGTGG + Intronic
1001430911 5:171661317-171661339 CACTGAGCCAAGCACTCCACAGG + Intergenic
1001431817 5:171668060-171668082 CACCGAGCCAGGTCCTGCGGAGG - Intergenic
1002781565 6:370595-370617 CCCTGTGCCAAGCACTGCTCTGG - Intergenic
1004016506 6:11736854-11736876 AACTGAGCTCAGTCCTGCTGAGG + Intronic
1005740814 6:28788929-28788951 TACTGAGACAAGGACTGCTGTGG - Intergenic
1005742129 6:28801986-28802008 TACTGAGACAAGGACTGCTGTGG - Intergenic
1005917530 6:30366182-30366204 CACTGACCCAAGTCTTGCTTGGG - Intergenic
1009899329 6:69792741-69792763 CTTTGTGTCAAGTACTGCTGAGG - Intronic
1010529010 6:76942881-76942903 CTCTGAGCCATGTAAAGCTGGGG - Intergenic
1011877621 6:91980572-91980594 CACTGAGCCTAGAACTGCTAAGG + Intergenic
1012665390 6:101962024-101962046 CATGAACCCAAGTACTGCTGTGG - Intronic
1013300278 6:108798823-108798845 CACTGAGCCCGCTCCTGCTGCGG - Intergenic
1014540556 6:122670531-122670553 CACTGAGCAAAGGTCTGATGAGG - Intronic
1015480068 6:133698981-133699003 CACTGAGACAAGTATTGCCAAGG - Intergenic
1015640178 6:135323419-135323441 CACTTACCAAAGTACTGCTTTGG - Intronic
1016324204 6:142880875-142880897 AACTGAGACCAGAACTGCTGGGG - Intronic
1017318732 6:153063003-153063025 CCCCGAGCCCAGTAATGCTGTGG - Intronic
1018574177 6:165241457-165241479 CACAGAGCCAAGTTCTTCAGGGG + Intergenic
1024410967 7:49040144-49040166 CCCTAAGCCCAGTAATGCTGTGG - Intergenic
1024736348 7:52308952-52308974 AACTGAGACAAGTACTGCCAAGG - Intergenic
1024975079 7:55106258-55106280 CACTGTTCAACGTACTGCTGGGG - Intronic
1035231845 7:157470113-157470135 CACTCAGCCAGGTCTTGCTGAGG - Intergenic
1037490577 8:19393626-19393648 GACTGAGACAAGTACTGGGGAGG + Intronic
1038881096 8:31612727-31612749 CACTTAGCATAATACTGCTGAGG + Intergenic
1042808222 8:72794891-72794913 AGCTGGGCCAAATACTGCTGAGG + Intronic
1045251359 8:100485768-100485790 GACTGGGCCAAGTCTTGCTGTGG - Intergenic
1046519386 8:115304858-115304880 CACTGATGCATGGACTGCTGTGG - Intergenic
1048204993 8:132408282-132408304 CTATTTGCCAAGTACTGCTGTGG + Intronic
1048262196 8:132954631-132954653 CACTGTGCCAAGGGCAGCTGTGG + Intronic
1048810245 8:138279165-138279187 CACTGAGGGAAGAACTTCTGAGG - Intronic
1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG + Intronic
1050200150 9:3136279-3136301 AACAGAACCAAGTACTGCTTAGG - Intergenic
1050526278 9:6549450-6549472 CACTGTGCCAAGCACTGCCAGGG + Intronic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1053707390 9:40768815-40768837 CACTGGGCCCTGTACAGCTGCGG + Intergenic
1054417304 9:64889583-64889605 CACTGGGCCCTGTACAGCTGCGG + Intergenic
1056153061 9:83806491-83806513 AACAGAACTAAGTACTGCTGAGG + Exonic
1056896952 9:90559902-90559924 CCATGAGCCAAGGAATGCTGGGG - Intergenic
1057149452 9:92783460-92783482 CACTGAGACAAGTATTGCCAAGG + Intergenic
1057944024 9:99309032-99309054 AGCGGAGCCAAGTGCTGCTGAGG - Intergenic
1059393638 9:114017062-114017084 CACTTGTCCAAGTCCTGCTGTGG + Intronic
1059656210 9:116360111-116360133 CCCTGGCCCAAGTAGTGCTGAGG + Intronic
1060903019 9:127277959-127277981 CACTGAGCCAAGTACTGCTGGGG - Intronic
1062274968 9:135726242-135726264 CCCTGTGCCACGTAGTGCTGTGG - Intronic
1062482652 9:136759561-136759583 GACTGACCCCAGCACTGCTGGGG - Intergenic
1186879034 X:13846248-13846270 AACTGAGCCTAGAAATGCTGGGG - Intronic
1188526213 X:31090654-31090676 CACGGTGCCAAGTATTGGTGAGG + Intergenic
1190368037 X:49716096-49716118 CCCTAAGCCCAGTAATGCTGTGG + Intergenic
1191868767 X:65727619-65727641 CTCTGCACAAAGTACTGCTGAGG - Intronic
1192303216 X:69928390-69928412 CACTGACCAAAATACTACTGTGG - Intronic
1192875139 X:75222232-75222254 GAGTGACACAAGTACTGCTGTGG + Intergenic
1195312416 X:103644184-103644206 CCCTGAGCCCAATAATGCTGTGG - Intergenic
1195614851 X:106903968-106903990 CACTGGACCACTTACTGCTGAGG - Intronic
1196232350 X:113239241-113239263 CACCAAGCAAAGTAATGCTGTGG + Intergenic
1196661768 X:118278149-118278171 CACCGAGCCAAGTACTGTTGAGG + Intergenic
1197280700 X:124532251-124532273 AATTGAGCCTAGTACAGCTGTGG - Intronic
1198363198 X:135915899-135915921 CACTAATCCAAATACTGCTATGG + Intergenic
1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG + Intergenic
1199573290 X:149289430-149289452 CACTGAGCAAAGAGCTGCTGGGG - Intergenic