ID: 1060903109

View in Genome Browser
Species Human (GRCh38)
Location 9:127279053-127279075
Sequence CAGGTGGACCTGAATTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060903098_1060903109 11 Left 1060903098 9:127279019-127279041 CCCCATTTGCAAATAAGATTATA 0: 1
1: 0
2: 6
3: 122
4: 923
Right 1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG No data
1060903099_1060903109 10 Left 1060903099 9:127279020-127279042 CCCATTTGCAAATAAGATTATAT 0: 1
1: 0
2: 42
3: 385
4: 1932
Right 1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG No data
1060903100_1060903109 9 Left 1060903100 9:127279021-127279043 CCATTTGCAAATAAGATTATATT 0: 1
1: 1
2: 14
3: 127
4: 939
Right 1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060903109 Original CRISPR CAGGTGGACCTGAATTTGGG GGG Intronic
No off target data available for this crispr