ID: 1060906609

View in Genome Browser
Species Human (GRCh38)
Location 9:127312959-127312981
Sequence CTGGGGCTTGCCCTGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906609_1060906622 18 Left 1060906609 9:127312959-127312981 CCCAGAGGCAGGGCAAGCCCCAG 0: 1
1: 0
2: 4
3: 55
4: 418
Right 1060906622 9:127313000-127313022 CCCAGTAATGTCAAGGACCCAGG No data
1060906609_1060906618 -5 Left 1060906609 9:127312959-127312981 CCCAGAGGCAGGGCAAGCCCCAG 0: 1
1: 0
2: 4
3: 55
4: 418
Right 1060906618 9:127312977-127312999 CCCAGGCTTGGGGGATTCAGAGG No data
1060906609_1060906620 11 Left 1060906609 9:127312959-127312981 CCCAGAGGCAGGGCAAGCCCCAG 0: 1
1: 0
2: 4
3: 55
4: 418
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906609 Original CRISPR CTGGGGCTTGCCCTGCCTCT GGG (reversed) Intronic
900250255 1:1665186-1665208 TTGAGGCTTGCGATGCCTCTGGG + Exonic
900346968 1:2214690-2214712 CTGGGTCCAGCCCTGCCTCAGGG - Intergenic
900358322 1:2275363-2275385 GTGGGGCTGCCCCAGCCTCTGGG + Intronic
900496477 1:2978266-2978288 CAGGGGCTACCCCTGCCTCGTGG + Intergenic
901453854 1:9352290-9352312 ACGGGGCTGGCCCAGCCTCTGGG + Intronic
901913687 1:12481184-12481206 CTGGGCCTCCCCGTGCCTCTGGG - Intronic
901927321 1:12574614-12574636 CTGTGGCCTGGCCTGTCTCTTGG + Intronic
902696576 1:18144386-18144408 CTAGGGGTAGCCCTACCTCTGGG - Intronic
903191098 1:21656593-21656615 CTGGGGGTTCCCCAGCCCCTGGG + Intronic
903229708 1:21914381-21914403 CTGAGGCTCCTCCTGCCTCTGGG - Intronic
903329844 1:22591734-22591756 CTGGGTCTTTCCCTGCTGCTAGG + Intronic
903339010 1:22642759-22642781 CCTGGGGGTGCCCTGCCTCTGGG - Intergenic
903453415 1:23470488-23470510 CTGGGGCTGGCCCTGGGTCCTGG - Intronic
903850102 1:26300855-26300877 CTAGGCCTTGCCCCGTCTCTGGG + Intronic
904285892 1:29453060-29453082 TCGGGGCTTGCCCTGCTGCTGGG + Intergenic
904376175 1:30083878-30083900 GTGTGGCTGGCTCTGCCTCTCGG - Intergenic
904534239 1:31188568-31188590 CTGGAGCTTGCCCTGGCCCATGG + Intronic
905074402 1:35257099-35257121 CTGGAGCTTGCTGTGTCTCTAGG + Intergenic
905474614 1:38217456-38217478 CTGTGGCTGGCCCTTCCTCACGG - Intergenic
905899568 1:41572413-41572435 CTGGGTCTCGCCCACCCTCTGGG + Intronic
906500991 1:46341720-46341742 CTGCCGCTAGCCCTGCCACTCGG + Intronic
906656239 1:47550240-47550262 CTGGGGCTTCCTCAGCTTCTTGG + Intergenic
906716985 1:47977713-47977735 CTGGAGCCTGTCCTTCCTCTTGG - Intronic
907109984 1:51918408-51918430 CTGGGACTTGCCTTTTCTCTAGG - Exonic
907271162 1:53292033-53292055 CTGGGGCTTGCCTTCTCCCTGGG + Intronic
907364266 1:53946277-53946299 CTGGGCCTGGCCCCGCCTCCAGG + Exonic
907534834 1:55141942-55141964 CTGGGGCTTATTTTGCCTCTGGG - Intronic
908426839 1:64015670-64015692 CTGGATCTTGCCTTGGCTCTTGG + Intronic
910214586 1:84830321-84830343 CTTTGGCTTGCCCTGTCTCTGGG - Intronic
910501507 1:87896868-87896890 GTGGGGATTGGCCTGACTCTTGG + Intergenic
911093157 1:94033872-94033894 CTATGGCTGGCCCTCCCTCTGGG + Intronic
911468387 1:98283877-98283899 CTGGGTTTTGCCTTGACTCTGGG + Intergenic
913270834 1:117091791-117091813 CTGTGGCTTGTCTTCCCTCTTGG + Intronic
914363008 1:146952291-146952313 CTGGTGCTGCCCCTGACTCTAGG + Intronic
914488670 1:148134848-148134870 CTGGTGCTGCCCCTGACTCTAGG - Intronic
914701428 1:150137492-150137514 CTGGGGCTAGCTCTTCCACTTGG + Intronic
916096009 1:161350906-161350928 TTTGGGTTTGACCTGCCTCTTGG + Intronic
917042534 1:170822023-170822045 CTGGGGCTTTTTCTGCCTCTTGG + Intergenic
917455003 1:175178679-175178701 CTGTGACTTGCCCTGCCACTTGG - Intronic
919736834 1:200957871-200957893 CTGGGACTGGCCCAGCATCTGGG - Intergenic
920100962 1:203516794-203516816 CTGGGGCTTGGCCTGTTTCTGGG - Intergenic
920696208 1:208183083-208183105 CTGGGGCTCCCCCTTCGTCTAGG + Intronic
921802524 1:219417835-219417857 CTGGGCCTTGCCCTGCATCCAGG + Intergenic
922212783 1:223498271-223498293 CTCGGGGTTGCCCTGCCTTGAGG - Intergenic
922545502 1:226453587-226453609 CTGGGCCAGGCCCTGACTCTGGG + Intergenic
922863308 1:228837849-228837871 CTGGGGTTTGGCCTGCTGCTGGG - Intergenic
923085986 1:230703927-230703949 CTTGGCCTTGCCTTGCCTCAGGG - Intronic
924775933 1:247114506-247114528 CTGGGGCGTGGGCTGCCTCGGGG + Intergenic
1062768470 10:82370-82392 TTGGGGCTCTCACTGCCTCTGGG - Intergenic
1062838234 10:650331-650353 CTGGGGCTTGCAGTGGCTGTGGG - Exonic
1062882157 10:987977-987999 GCGGGGCGTGCCCAGCCTCTGGG - Intergenic
1063707988 10:8449451-8449473 CAGGGTCTTGCTCTGTCTCTTGG - Intergenic
1063957549 10:11280813-11280835 CTAGGACCTCCCCTGCCTCTTGG - Intronic
1065046917 10:21753454-21753476 CTGGGGTTTGCCCTCCCACCTGG + Intergenic
1065804762 10:29384258-29384280 CTGGGCCTTGCTTTTCCTCTGGG + Intergenic
1066360687 10:34727414-34727436 ATGAGGCTTGCCCTGCCTGCAGG - Intronic
1068838530 10:61583551-61583573 CTGGAACTATCCCTGCCTCTGGG - Intergenic
1068956748 10:62825240-62825262 CTGGGGGTTGCCAGGTCTCTGGG - Intronic
1069770677 10:70897379-70897401 CTGGGTCTGCCCCTGCCCCTCGG - Intergenic
1069947763 10:71999496-71999518 CTGTTGCTGGCCCGGCCTCTCGG - Intronic
1070312278 10:75282496-75282518 CTCTGGATGGCCCTGCCTCTGGG + Intergenic
1070569724 10:77631854-77631876 CTTGGGCTAGCCCTGCTTCTAGG - Intronic
1070586613 10:77771549-77771571 CTGGGGCTGGGCCTTCCTCCTGG - Intergenic
1070682862 10:78461453-78461475 CTGGAGCTTGCCATGGCTCCTGG + Intergenic
1070781176 10:79138215-79138237 GGGGGCCTTGCACTGCCTCTGGG - Intronic
1071892041 10:90019874-90019896 CTAGGGCCTTCACTGCCTCTTGG - Intergenic
1073049059 10:100656260-100656282 CTGCGGCCTCCCCTGCCTCCCGG + Intergenic
1073286732 10:102394235-102394257 CGGGAGCTTCCGCTGCCTCTCGG - Intronic
1073650259 10:105351342-105351364 CTGGAGACTGCCCTGCCTCACGG + Intergenic
1074445969 10:113521036-113521058 CTGGTGCTTCCGATGCCTCTTGG + Intergenic
1075226830 10:120637128-120637150 CTGGTACTTGCCCTGACTCAGGG + Intergenic
1076322204 10:129591546-129591568 CTGGGGCCTGGCCTGGATCTAGG - Intronic
1076546150 10:131246758-131246780 CTGGGGATGGCCCAGCCTCAAGG - Intronic
1076779194 10:132714600-132714622 CTGGGACCTGCCCTCCCTCCTGG - Intronic
1076847575 10:133076854-133076876 CTGCGGGTTCCCCTGCCTCCTGG + Intronic
1077217062 11:1399339-1399361 CAGGGCCTGGCCCTGCCACTGGG + Intronic
1077224418 11:1433873-1433895 CTGCAGCTCCCCCTGCCTCTGGG + Intronic
1077484409 11:2832206-2832228 GTGGGGGTTGCCCGGCATCTTGG + Intronic
1077485764 11:2837750-2837772 CATGGGCTGGCCCTGCCTCCTGG - Intronic
1077551192 11:3201027-3201049 CTGGGGCAGGACCTGCCTCTAGG + Intergenic
1079178814 11:18170104-18170126 CTGAGGCTTGCTCTGCCTGAAGG + Intronic
1080393729 11:31871421-31871443 CTGGGGCTACCCCTGCTCCTGGG + Intronic
1081192432 11:40120097-40120119 CTGTGCCATGCCCTGCCTCCTGG + Intronic
1081653409 11:44840605-44840627 CTGGGGCTTGCTTTGCCCATGGG - Intronic
1083180037 11:60979356-60979378 CTGGGGGTTGCCCTGCACCTTGG + Intronic
1083261054 11:61523383-61523405 CTGGGTCTTTCCTTGCCTCTGGG - Intronic
1083265252 11:61543793-61543815 CTGGCTCTGGCCCTGCCTGTGGG - Intronic
1083491478 11:63017509-63017531 CTGGGTCCAGCCCTGCCCCTCGG + Intergenic
1083584001 11:63843352-63843374 CTGGGACCTGCCCCACCTCTGGG + Intronic
1083993021 11:66258179-66258201 CCGCGGCTTGGCCTGCCTTTTGG + Intronic
1084151604 11:67290117-67290139 CTGGAGCTGGCCGTGTCTCTGGG + Exonic
1084290650 11:68163934-68163956 CTGGGGCTTGTCCTGACTTGTGG + Intronic
1084605889 11:70171388-70171410 GTTGGTCTTGCCCTGGCTCTGGG - Intronic
1084644979 11:70451235-70451257 CTGGTGCTTTGCCTGCCTGTTGG - Intergenic
1084792556 11:71483770-71483792 CTTGGGTTGTCCCTGCCTCTTGG - Intronic
1085831508 11:79906116-79906138 CTGGTTCTTGACCTTCCTCTAGG + Intergenic
1088831492 11:113540544-113540566 CTGGGCTTTTCCCAGCCTCTAGG - Intergenic
1089339557 11:117748359-117748381 CTGGTCCTTGTCTTGCCTCTTGG + Intronic
1090402944 11:126460644-126460666 CTGGGTCTTGCCAGGCCTCTGGG - Intronic
1090405039 11:126471453-126471475 CTGGGGCCTCCCCTTCCTCTGGG - Intronic
1091215622 11:133899617-133899639 CTAGGGCTTGCCCTCCCACCAGG - Intergenic
1091450796 12:570836-570858 CTGGGCCCAGCTCTGCCTCTGGG + Intronic
1091582729 12:1798916-1798938 TTGGGGCTTCCTCTGCCCCTGGG - Intronic
1091668464 12:2435953-2435975 CTTTGGCTTGCCCAGCCTCTCGG - Intronic
1094707191 12:32925641-32925663 CAGGGGTTTGCCCAGTCTCTAGG + Intergenic
1096152285 12:49322261-49322283 CTGGGGATTTCCTTGCCTCCAGG - Intergenic
1096399302 12:51291826-51291848 CTGGGGCTTGCAGTGGCTCTGGG + Exonic
1098994984 12:77108909-77108931 TTGTGGTTTGCCCTGCCCCTTGG - Intergenic
1100468862 12:94873246-94873268 CTGGGGCTGGCTCCGTCTCTGGG + Intergenic
1101394217 12:104329950-104329972 CACAGGCTTGCACTGCCTCTTGG + Intronic
1101516842 12:105444176-105444198 CTGGTGTTTGACCTTCCTCTAGG + Intergenic
1102255317 12:111411620-111411642 CTGGGGCTGGCTGTGCTTCTTGG + Intronic
1103664134 12:122548441-122548463 CTGGTGATTTGCCTGCCTCTCGG + Intronic
1103728344 12:123010173-123010195 CTGGGCCTTGCCCTGCCAGAGGG + Intronic
1104108598 12:125686039-125686061 CTAGGGCTGGCCCTGCTTGTCGG - Intergenic
1104896788 12:132168695-132168717 CTGAGGCTGTCCCTGGCTCTGGG + Intergenic
1104902429 12:132196754-132196776 CCGGGGCTTGGCCTCCCTATGGG + Exonic
1104960670 12:132487308-132487330 CTGGGGCTTGCCAGGGCCCTGGG - Intergenic
1104991099 12:132624304-132624326 CAGGGGCTTTTCCTCCCTCTGGG + Exonic
1105633736 13:22197416-22197438 CTTGGGCTGGCTCTGGCTCTGGG - Intergenic
1105750731 13:23420190-23420212 CTGGGGCCTGCTCTTCATCTTGG + Intronic
1106425539 13:29625277-29625299 CTGTGGCTGGCCCTTCCCCTGGG - Intergenic
1107423875 13:40274443-40274465 CTGTGGGTTCCCATGCCTCTGGG - Intergenic
1108379731 13:49844308-49844330 CTTGATCTTGCCCTGCCCCTCGG - Intergenic
1110913613 13:80994305-80994327 CTGGGGCTTGCCATGTGCCTGGG - Intergenic
1111775517 13:92656476-92656498 CTGGGCCCTGCCCTTCATCTTGG - Intronic
1113944866 13:114038502-114038524 CTGGGGATGGCCCTGCCCCAAGG - Intronic
1114689489 14:24566923-24566945 TTGGGCTTTGCCCTGCCTTTAGG + Intergenic
1115563926 14:34608201-34608223 CTGGGTCTTGCTCTGCCACCAGG + Intronic
1116582811 14:46663623-46663645 CTGTGGCTTGCCCTGCACCAGGG + Intergenic
1116900403 14:50357333-50357355 CAGGGGCTTGCTCTGCCACGTGG - Intronic
1116946208 14:50837530-50837552 CTGGGCCTTGCCCGTCCTCCAGG + Intergenic
1117074777 14:52091011-52091033 TAGGGGTTTGTCCTGCCTCTGGG + Intergenic
1118456406 14:65948823-65948845 GTGGGGGCTGCCCTGCCTCAGGG - Intergenic
1119875192 14:78053619-78053641 CTTGGTCTTTCCCTGCCCCTCGG + Intergenic
1119903709 14:78282769-78282791 CTGGGCCTTGCCCTGTCTCCAGG + Intronic
1120237004 14:81903688-81903710 CTGGGGCTTGCCCAGAGCCTGGG + Intergenic
1121456767 14:94043388-94043410 CTGGGCCTGGCCCTGGCTCCAGG - Intronic
1121505180 14:94471850-94471872 CTGGGGCTTGCGATGTCTCGGGG - Intronic
1121801834 14:96780872-96780894 CTGAGGCTTGCCCAAGCTCTAGG + Intergenic
1122104017 14:99437409-99437431 CTGCTGCTTTCCCTGCCTCTGGG + Intronic
1122282793 14:100634056-100634078 CTGCAGCCTGCCCTGCCTGTAGG - Intergenic
1122691888 14:103535457-103535479 GTGGGGGATGCCCCGCCTCTTGG - Exonic
1122893681 14:104744779-104744801 CTTGGGTTTGCCCGGCCCCTTGG + Intronic
1123061761 14:105597733-105597755 CTGGGGCCTCCCCTGCCGCGTGG + Intergenic
1123086499 14:105719464-105719486 CTGGGGCCTCCCCTGCCGCGTGG + Intergenic
1123507631 15:20960714-20960736 CTTGGGCTTCCCCTGCCGCTGGG + Intergenic
1123564853 15:21534457-21534479 CTTGGGCTTCCCCTGCCGCAGGG + Intergenic
1123601111 15:21971748-21971770 CTTGGGCTTCCCCTGCCGCTGGG + Intergenic
1124132902 15:27005639-27005661 CAGGGGCTTGCTCTGTCTCAAGG + Intronic
1126192681 15:45895123-45895145 CTGGAGGCTGCTCTGCCTCTGGG - Intergenic
1127621754 15:60740900-60740922 CTGGGGTTTGCCCAACCTTTTGG - Intronic
1127766202 15:62187639-62187661 CAGGGGCTTCCCCAGCCTCTTGG + Intergenic
1127829502 15:62737938-62737960 CTGTGGCTTACCCTGGCTTTGGG + Intronic
1128240884 15:66100252-66100274 CCAGGCCTTGCCCTGCCTCCTGG + Intronic
1128310845 15:66631100-66631122 CAGGGGCTGGCCCAGCCTCAGGG + Intronic
1128529314 15:68432915-68432937 CTGTGGCTTTCCCTGCATCTTGG - Intergenic
1130766848 15:86879448-86879470 CTGGGGCTTGGCCTGAGTCCAGG + Intronic
1131112875 15:89776420-89776442 CTGGGGCTGGGCCGGCCACTGGG + Exonic
1132151727 15:99467070-99467092 CTGGGGTCTTCCCTGCCTCCTGG + Intergenic
1132190000 15:99846278-99846300 CTGGGCCCTGCCCTTCATCTCGG + Intergenic
1202973219 15_KI270727v1_random:261567-261589 CTTGGGCTTCCCCTGCCGCTGGG + Intergenic
1132457341 16:31394-31416 TTGGGGCTCTCACTGCCTCTGGG - Intergenic
1132698823 16:1213629-1213651 ATGGGGCTGGCCCTGCCTCATGG - Intronic
1133104757 16:3500246-3500268 CCGAGGCCTGGCCTGCCTCTGGG + Intergenic
1133115429 16:3575781-3575803 CTGGGTCCTTCCCTGCCACTTGG + Intronic
1133304298 16:4800167-4800189 CAGGGACTTGCCATGGCTCTGGG - Intronic
1135329034 16:21545869-21545891 CTGGGGCAAGCCCTTCCTCGCGG - Intergenic
1136339380 16:29631846-29631868 CTGGGGCGAGCCCTTCCTCGCGG - Intergenic
1137236861 16:46624320-46624342 CTGGGACTTGCCCTGGAACTGGG + Intergenic
1139249401 16:65480468-65480490 CTGGGGCTTCCACTGCCGCTTGG - Intergenic
1139391787 16:66610041-66610063 CAGGGGCCTGCCCTCCCTCGGGG + Intronic
1139597041 16:67964102-67964124 CTGGGGCTTGCCCCACCTCCCGG - Intronic
1141169964 16:81684954-81684976 CTCGGGACTGCCCTGGCTCTGGG - Intronic
1141660000 16:85436642-85436664 CTGGGGCTAGAGCTGCCTCCCGG - Intergenic
1141714285 16:85717809-85717831 CTGGGGCTTGACGTGGCTCCAGG + Intronic
1142000547 16:87661798-87661820 CTGTGGTTTTCACTGCCTCTGGG + Intronic
1142627369 17:1200875-1200897 CTGGGGCTCTTCCTTCCTCTGGG + Intronic
1142808740 17:2385516-2385538 ATGCGGCTTTCTCTGCCTCTGGG - Exonic
1143096769 17:4482560-4482582 CTCGGGCAGCCCCTGCCTCTCGG + Intronic
1143496106 17:7313529-7313551 ATGGGGCTTGGCCTTCCTCAAGG - Intronic
1143560260 17:7689511-7689533 CTAGGGCTGAGCCTGCCTCTGGG - Intronic
1143609895 17:8012180-8012202 CTGGGGCTTTTCCTGGCTCGGGG + Exonic
1144032369 17:11334226-11334248 CTGAGGTTTGCCCTAACTCTAGG + Intronic
1144890236 17:18490171-18490193 CTGGCGCTGGCCCTGGCCCTAGG + Intronic
1145141980 17:20454147-20454169 CTGGCGCTGGCCCTGGCCCTAGG - Intronic
1145793925 17:27644752-27644774 CTGGCGCTGGCCCTGGCTCTGGG + Intronic
1147155969 17:38544655-38544677 CTGGGGATTGGCCGGCCCCTGGG + Intronic
1147442134 17:40453797-40453819 CTGGGTCCTGCCCAGCCCCTGGG + Intronic
1148052915 17:44777930-44777952 CCTGGCCCTGCCCTGCCTCTAGG + Exonic
1148779397 17:50112956-50112978 CTGGGCCTTGCGCTCCTTCTCGG + Exonic
1151682176 17:75628069-75628091 CTGGGGCCTGCCTTGCCGTTGGG - Intronic
1151730908 17:75910532-75910554 CCGGGGCAGCCCCTGCCTCTGGG - Exonic
1152366623 17:79860224-79860246 CTGGGGCTTGGGTTTCCTCTGGG + Intergenic
1152541190 17:80976847-80976869 CTGGGGACTGCCCAGTCTCTGGG + Intergenic
1152789679 17:82272652-82272674 GTGGGGCTTGCCCTCCCGCTGGG - Intronic
1152961358 18:82203-82225 TTGGGGCTCTCACTGCCTCTGGG - Intergenic
1155083013 18:22429374-22429396 CTGGGCTTCACCCTGCCTCTGGG + Intergenic
1155839019 18:30625189-30625211 CTCGTGCTTGCTCTGCCTATGGG - Intergenic
1156337063 18:36181662-36181684 CTGGGACCTACTCTGCCTCTAGG - Intergenic
1157293159 18:46424281-46424303 CAGGGGCCTTGCCTGCCTCTGGG - Intronic
1159429816 18:68337088-68337110 CTGGATATTGCCCTGCCTCTAGG - Intergenic
1159949455 18:74471389-74471411 TTGGGGTTTGCTCAGCCTCTTGG + Intergenic
1160516334 18:79481127-79481149 CTTGGCCAAGCCCTGCCTCTGGG + Intronic
1160933902 19:1584240-1584262 CTGGGTCTTGCTCTGCCCCCAGG + Intronic
1161361094 19:3850199-3850221 CCGGGGCTTTTCCAGCCTCTGGG - Intronic
1161362814 19:3860694-3860716 CTGTCGCTTGTCCTGCGTCTGGG - Intronic
1161558386 19:4957193-4957215 CTGGGGCCTGCAGTGGCTCTGGG + Intronic
1161775989 19:6262410-6262432 CAGGGGCTTGGCTGGCCTCTCGG + Intronic
1162723375 19:12675529-12675551 CTGGCTCTGGCCCTGCCTGTGGG + Exonic
1162829551 19:13275925-13275947 CTGGGGCTCGTCCTGCATCAGGG - Exonic
1163441370 19:17324042-17324064 CCGGTGCATACCCTGCCTCTGGG + Intronic
1163671763 19:18633489-18633511 GTGGCGCGGGCCCTGCCTCTAGG + Intergenic
1164157668 19:22606322-22606344 CTGGGGCCTGCCCAGCCACGGGG - Intergenic
1164524063 19:29000607-29000629 CTCGGGGTTCCCCTGCCCCTTGG - Intergenic
1164539812 19:29114179-29114201 GTGGGGCTGGGCCTGGCTCTAGG + Intergenic
1165081762 19:33311019-33311041 CTGAGGCTGGCCCTAGCTCTGGG - Intergenic
1165126363 19:33600780-33600802 CTGGGCCTTGTCCTCCCCCTGGG - Intergenic
1165371588 19:35410698-35410720 CTGAGGCTTGCCCAGCCCCGTGG - Intergenic
1165803510 19:38566889-38566911 CTGATGCTTGCCCTGTCCCTAGG + Exonic
1166069569 19:40379221-40379243 CTGGGGCTTGGACTGGCCCTGGG - Intronic
1166107775 19:40605820-40605842 CTGGGGCTTACCCAGGCGCTCGG - Exonic
1166286402 19:41832493-41832515 CAGGTGCCTGCCCTGCCCCTTGG - Intergenic
1166723691 19:45012310-45012332 CTGGGGCTTCCCCTGCACCCCGG + Intronic
1167315904 19:48762520-48762542 CTGGGTCTTCTCCTCCCTCTAGG - Intergenic
1167441603 19:49512592-49512614 CTGGGGTGTGCCCTGCAACTGGG + Exonic
1168701060 19:58439832-58439854 CCAGGGCTAGCCCTGCCGCTGGG + Exonic
925109468 2:1321634-1321656 CTGGGACTGGCCCTCCCTCCTGG - Intronic
925302281 2:2825888-2825910 CTGTGGCTGCCCCTGCCTCCTGG - Intergenic
925309870 2:2874954-2874976 CCGGGGCTGGCTCTGGCTCTGGG - Intergenic
925361172 2:3281257-3281279 CTGGGACCTGCCCTCCTTCTCGG + Intronic
925609747 2:5692960-5692982 CCAGCGCTTGCCCAGCCTCTTGG - Exonic
925897955 2:8487774-8487796 CTGGAGCCCGCCGTGCCTCTGGG - Intergenic
926051067 2:9745104-9745126 CTGGTGGCTGCCCTGACTCTTGG + Intergenic
926111636 2:10187695-10187717 CTTGGGCTTGCCCTGCAGATGGG + Intronic
926625287 2:15085500-15085522 CTGGGCCTGGGCCTGCATCTGGG - Intergenic
927074471 2:19564105-19564127 CTGGGACTCGCCAGGCCTCTAGG + Intergenic
927491753 2:23525698-23525720 CTGGGGCTCACTCGGCCTCTGGG - Intronic
928584440 2:32744536-32744558 CTTGAGGTTGCCCTACCTCTAGG - Intronic
929905901 2:46046314-46046336 CTGGGGCCTGCCCTACCTCTAGG + Intronic
931361981 2:61585575-61585597 CTGGGGTTTTCCCTGCCACTGGG + Intergenic
932769675 2:74493530-74493552 CTGGGCCTTTCTCTTCCTCTTGG + Exonic
933851747 2:86372924-86372946 CTGGGAATTGCCCTGGCTGTGGG + Intergenic
935145425 2:100392070-100392092 CTGCGGCTTGCCCTGCACCAGGG + Exonic
935571145 2:104661146-104661168 ACGGGGGTTCCCCTGCCTCTGGG - Intergenic
935941088 2:108240000-108240022 CTGGAGCTGGACCTGGCTCTGGG + Intergenic
936559496 2:113524395-113524417 CTGGGGTTTGCCCTGAGTCTAGG - Intergenic
936683812 2:114804486-114804508 CTGTGGCTTTGCCTGCCTCCTGG - Intronic
937358096 2:121211108-121211130 CTGGGCCTTACTCTTCCTCTGGG - Intergenic
938408236 2:131044556-131044578 CTGGGCCTTGCCCCGCCCCCAGG + Intronic
939141104 2:138355519-138355541 CTGGTACTTCTCCTGCCTCTGGG + Intergenic
939728643 2:145754279-145754301 AAGGGGCTTCACCTGCCTCTAGG - Intergenic
941654337 2:168127174-168127196 CGGGGTCTTGCTCTGCCGCTAGG + Intronic
942101590 2:172589410-172589432 CTGCAGCTTTCCCTTCCTCTGGG - Intronic
942168296 2:173264282-173264304 CTGGAGCCTGCCCTACCTCTGGG - Intronic
942182559 2:173394305-173394327 CTCTGGCTTGCTCTGCATCTGGG + Intergenic
946415796 2:219539079-219539101 CTGACGCCAGCCCTGCCTCTGGG - Exonic
948333545 2:237190629-237190651 CAGGGGCTTGCTCTGTCACTTGG + Intergenic
948456575 2:238107249-238107271 TTGAGGCCAGCCCTGCCTCTGGG - Intronic
948484256 2:238270644-238270666 CTGGGGGTGTGCCTGCCTCTGGG - Intronic
948495386 2:238345467-238345489 CTGGCTCTGGCCCTTCCTCTGGG - Intronic
948541925 2:238697383-238697405 GTGGGGCTGGGCCTGCCTTTGGG + Intergenic
948668864 2:239553620-239553642 CTGGGTCCTCTCCTGCCTCTGGG + Intergenic
949020323 2:241737450-241737472 CTGGGGCTGGCACTTCCTTTTGG + Intronic
1168841345 20:912005-912027 GTGGGGTCAGCCCTGCCTCTGGG + Intronic
1169263257 20:4152671-4152693 CAGGGCCCTGCCCTGCCTCTTGG - Intronic
1170567738 20:17616306-17616328 CAGGGACAGGCCCTGCCTCTTGG + Intronic
1170692131 20:18625457-18625479 CTGGCACTGGCCCAGCCTCTGGG + Intronic
1171207873 20:23295021-23295043 CTGTGGCAGGCCCTCCCTCTCGG - Intergenic
1171252736 20:23661877-23661899 CAGGGGCTCGCTCTGCCTCCTGG + Intergenic
1172642218 20:36447250-36447272 CTGCAGCTTGACCTGCCTCTTGG + Intronic
1172657672 20:36546914-36546936 CTGGGGCTTTCCCAGCTTCGTGG + Intronic
1173519592 20:43689332-43689354 CTGGGGCTTCCCCTGACACTTGG + Intronic
1173595792 20:44257830-44257852 CTGGGCCTTCCCCTGTCTCAGGG - Intronic
1174606896 20:51768024-51768046 CTGGGGCGGGCCCGGCTTCTCGG + Intronic
1175593377 20:60211720-60211742 CTCCGGATGGCCCTGCCTCTGGG + Intergenic
1175715285 20:61251548-61251570 CTGGAGCTGGCCCAGCCTGTCGG + Intergenic
1175762594 20:61571616-61571638 CTGGGGCTTGCCAGGCTTCTGGG - Intronic
1175914190 20:62418195-62418217 AGGGGGCTTGCCCCGCCCCTGGG + Intronic
1176169516 20:63690618-63690640 CTGGGGCGTTCTCTGCCTGTAGG - Intronic
1176426588 21:6552468-6552490 CTGGGTCCTGCCCAGCCCCTGGG + Intergenic
1178367564 21:32000033-32000055 CCGAGACTTGCCCTGCCTGTGGG - Exonic
1178629722 21:34248669-34248691 CTGAGCCTCACCCTGCCTCTTGG + Intergenic
1179702079 21:43160790-43160812 CTGGGTCCTGCCCAGCCCCTGGG + Intronic
1179928239 21:44550288-44550310 GTGGGGCCTGGCCTGGCTCTGGG - Intronic
1179939446 21:44628425-44628447 GTGGGGCCTGGCCTGGCTCTGGG + Intronic
1180557739 22:16591507-16591529 CTGGCACTTGCCTGGCCTCTGGG + Exonic
1181306466 22:21919972-21919994 CTGAGGCTGGGACTGCCTCTGGG + Exonic
1182712692 22:32332483-32332505 CATGGCCTGGCCCTGCCTCTCGG - Intergenic
1182904140 22:33921346-33921368 CTCGGGCTTGGCGTGCCTCGCGG + Intronic
1183273125 22:36874348-36874370 TGGGGGCTGACCCTGCCTCTGGG - Intronic
1183376273 22:37467344-37467366 CTTGGCCTTGCCATGCCCCTTGG - Intergenic
1183381175 22:37491299-37491321 CTGGGGGCTGCCCTGCTCCTGGG - Exonic
1183688714 22:39376277-39376299 CTGGGACCCGCTCTGCCTCTGGG + Intronic
1184062377 22:42091218-42091240 GTGGGGCTTGTCCTGCCGCCTGG + Intergenic
1184097708 22:42325471-42325493 CTGGTGCCAGCCCTGCCTCTTGG - Intronic
1184518958 22:44981081-44981103 GTGGGGGTTGCCGTGTCTCTGGG + Intronic
1184570616 22:45322051-45322073 CTGGGGTTTTCGCTGTCTCTTGG - Intronic
1184706176 22:46215021-46215043 CGGGGCCGGGCCCTGCCTCTGGG - Intronic
1185334416 22:50265246-50265268 CTGGGGCATTTCCTGCCTCTGGG + Intronic
950088320 3:10277313-10277335 CTGGGCTTTGGCTTGCCTCTGGG + Intronic
950519857 3:13491669-13491691 CTGGGGCTGGCCATATCTCTGGG - Intronic
950534291 3:13570395-13570417 CTGGGCCTGGCCCTGGCCCTGGG + Exonic
950583767 3:13879278-13879300 CTGGGGACTGCCCAGTCTCTAGG + Intronic
950584235 3:13881014-13881036 CTGGGGGTTGCCCAGTCTCTAGG + Intergenic
951321246 3:21248644-21248666 CTGTGATTTGCCCTGCCACTGGG + Intergenic
952634056 3:35505632-35505654 CTGCGGCTACCCCTCCCTCTAGG - Intergenic
952900284 3:38107920-38107942 CTTTTTCTTGCCCTGCCTCTAGG + Intronic
953114865 3:39982557-39982579 CTGAGGCCTGCCAAGCCTCTTGG + Intronic
953358479 3:42274662-42274684 GTGGGGCTTCCCCAGCCACTTGG - Intergenic
953853073 3:46480540-46480562 CTGGTGCTGGGCCTGGCTCTGGG + Intronic
954068488 3:48125833-48125855 CTGGGTCTTGCCTTGGTTCTTGG - Intergenic
954152074 3:48662683-48662705 CTTGGGCTGGCCCCGCCGCTCGG + Exonic
954577564 3:51685011-51685033 CTGGGGCCTGCCCAGACACTGGG - Intronic
954882046 3:53843141-53843163 CTGGGGATTACCGTGACTCTTGG + Intronic
955075335 3:55608015-55608037 CTGGGACTTTCCCAGCCTTTAGG - Intronic
955642274 3:61098408-61098430 CTTGGGATTGCCTTGGCTCTTGG + Intronic
956626102 3:71268391-71268413 CTGGGGCTTTTCCTGCCCCTTGG - Intronic
958769204 3:98406743-98406765 CAGTGCCTTGCCCTGCTTCTCGG - Intergenic
959512128 3:107225659-107225681 CTGGCCCTGGCCCTGCCTCCAGG + Intergenic
960844612 3:121994341-121994363 GTGGGGCTTGCCCTGGCTGAGGG - Intronic
961197485 3:125014977-125014999 CTAGTGCTTGGCCTGGCTCTCGG + Intronic
961269814 3:125680389-125680411 CTGGGGCTTGAGGTGCCTCTTGG - Intergenic
961615208 3:128173923-128173945 CAGGGGCTTGGCCTGCCACGTGG + Intronic
961749980 3:129089017-129089039 CTGGGACTTGCCCTGGAACTGGG + Exonic
962747734 3:138410022-138410044 CTGGGGGCTGCTCTGCCTATAGG - Intergenic
964753084 3:160070033-160070055 CTGGGCAATGCCCTCCCTCTGGG + Intergenic
966937845 3:184725585-184725607 ATGCAGCTTCCCCTGCCTCTAGG + Intergenic
967171195 3:186824925-186824947 CTGGGGGTTGGCCTGGCTCAGGG - Intergenic
968137900 3:196232324-196232346 CCGGGCCTTGCCCTTCCGCTGGG - Intronic
968609544 4:1550863-1550885 GGGGGGGTGGCCCTGCCTCTGGG - Intergenic
968631402 4:1653992-1654014 CTTGCCCATGCCCTGCCTCTGGG - Intronic
968731018 4:2269248-2269270 TTGGGGCCTGCCCTGCCTGGTGG - Intergenic
968934812 4:3604470-3604492 CTGGGGTTCGCCAGGCCTCTGGG + Intergenic
969474369 4:7412823-7412845 CTGGGTCTTGCCCCACCCCTGGG + Intronic
969596489 4:8152008-8152030 TTGGGTCTTGTCCTGCCTCCTGG + Intronic
969643106 4:8411044-8411066 CTGGGGCTGGGCCTGCCCCAGGG + Intronic
969660071 4:8522245-8522267 CTGCTCCTTGCCCTGCCTTTCGG + Intergenic
973804453 4:54512313-54512335 GAGAGGCTTGCCCTGCCTGTTGG + Intergenic
975686882 4:76924884-76924906 CTGGGGTCTGCACTACCTCTGGG + Intergenic
976168082 4:82276163-82276185 CTGGGGCTTGCAGTGGCTCTGGG - Intergenic
978628690 4:110717568-110717590 GAGGGGCTTGCCCTGCCTAAAGG + Intergenic
979349400 4:119627808-119627830 CTGGGGTCTGCGCTGCCCCTTGG + Intronic
979610873 4:122687508-122687530 TTGGGGCCTGCCCTAGCTCTGGG + Intergenic
985008864 4:185562054-185562076 CTGGGTGTTGCCCTGACTCCAGG - Intergenic
985020142 4:185680297-185680319 CTGGGCCTGGCCCTTCTTCTAGG + Intronic
985127372 4:186708180-186708202 CTGGGGCTTGCCGTACCGCCGGG - Exonic
985656017 5:1131683-1131705 CTGGGGATTGGCCTGACTCAGGG - Intergenic
985843151 5:2324653-2324675 CTGCTGCTTTCTCTGCCTCTTGG - Intergenic
988589067 5:32533272-32533294 CTGGGGTGTGCCCTGTCTTTGGG + Intronic
991251759 5:64569895-64569917 CTGGGTCTTTCCTTGCCACTTGG + Intronic
991406715 5:66307082-66307104 CTGGGGCTTGCCTTGAGTATAGG - Intergenic
992352500 5:75944823-75944845 CTGGGGCTGGCCCTGGGTCAGGG - Intergenic
992554051 5:77885903-77885925 CTGTGGCATTCCCTACCTCTAGG - Intergenic
994353796 5:98773695-98773717 CTAGGGCTGGGCCAGCCTCTTGG + Intronic
997208170 5:132062436-132062458 GTTGGCCCTGCCCTGCCTCTGGG + Intronic
997257057 5:132437168-132437190 CAGGGGCCTGCTCTGTCTCTGGG - Intronic
997473452 5:134129479-134129501 CTGGGGGTTGCCCAGTCTCAGGG + Intronic
997975830 5:138440774-138440796 CTGGGCCTTTCCCTGCCTCCGGG + Intronic
998392232 5:141794833-141794855 CTGGGTCATGTGCTGCCTCTGGG + Intergenic
999136169 5:149320807-149320829 CTGGGGCAGGTCCTGACTCTGGG + Intronic
999614216 5:153404979-153405001 CTGAGGCCTGCGGTGCCTCTAGG + Intergenic
999862654 5:155665215-155665237 CTTGCGCTGGCCCTGTCTCTTGG - Intergenic
999906775 5:156149728-156149750 GTGGGGCATGCCCTGCCTGAAGG + Intronic
1000302041 5:159965271-159965293 ATGCTCCTTGCCCTGCCTCTTGG - Intronic
1002078325 5:176723060-176723082 CTGGAGCTGGCCCTGCCTGGAGG - Intergenic
1002104821 5:176874834-176874856 CCGGGGCTTGCCCTACCTCTGGG - Intronic
1002561435 5:180084813-180084835 ATGTGGCTTGCCCTGCCCCTGGG + Intergenic
1002640647 5:180629105-180629127 CTGGGGCTGGCCATGCCGCCCGG + Intronic
1002764130 6:225196-225218 CTGGAGTCTGCCCTGGCTCTGGG + Intergenic
1002815346 6:675108-675130 GTGCGGCTTGCCCACCCTCTTGG + Intronic
1003126021 6:3356418-3356440 CTGAGGCTTCCCCTGCCCCTTGG - Intronic
1003201991 6:3969809-3969831 CTGGTGCATGACCTTCCTCTAGG - Intergenic
1003444066 6:6168929-6168951 CAGAGGCTTTCCCAGCCTCTTGG - Intronic
1003656451 6:8015068-8015090 CTGGTGTTTGAGCTGCCTCTTGG - Exonic
1005042273 6:21610122-21610144 CTGGGGCTGGCGCGGCCTCCCGG + Intergenic
1005138429 6:22598626-22598648 CTGGTGTCTGACCTGCCTCTGGG - Intergenic
1005906218 6:30263161-30263183 CTGGGCCTTGTCCTGTCTCTAGG + Intergenic
1006682261 6:35805582-35805604 CTGGGGAGTGACCTGCTTCTAGG + Exonic
1007383362 6:41504355-41504377 TTGGGGCATCCCCTGCCTCTAGG + Intergenic
1007412970 6:41675390-41675412 CTGGGTCAGGCCCTGGCTCTTGG + Intergenic
1007695842 6:43733943-43733965 GTGGGGCTTCTCCTGCCACTGGG - Intergenic
1008684229 6:53906317-53906339 CAGGGGCTTGCCCTACCTCAAGG - Intronic
1011218630 6:85031771-85031793 CTTGGGCATGCTCTGCCTCTAGG - Intergenic
1011254465 6:85406499-85406521 CTGGGGCTTGCCCTGCTTGTAGG - Intergenic
1012052447 6:94361979-94362001 CTGGGACCTGGCCTGCATCTGGG + Intergenic
1014930828 6:127333808-127333830 CTGGAGCTTTCACTGCCTGTGGG - Intronic
1016255352 6:142098182-142098204 CTGGGGTTTGCTGAGCCTCTTGG - Intergenic
1018390927 6:163341484-163341506 CTGGGGTTTGTCCTGCCCATTGG + Intergenic
1018456944 6:163961591-163961613 CTGGGGTTTGCCCAGGCTCAGGG + Intergenic
1019096788 6:169587941-169587963 CCGTGGCTTTCCCTGCTTCTTGG + Intronic
1019346701 7:534465-534487 CAGGGGCTTAACCTGCCTGTTGG + Intergenic
1019594481 7:1852094-1852116 CTGGGTCCTGCCCTGGGTCTCGG - Intronic
1019757909 7:2787115-2787137 CTGGGGCTCGCTCTTCCTCAGGG + Intronic
1023348916 7:39300046-39300068 CGTGGGCTTGGCCTGCCTTTGGG - Intronic
1023393417 7:39731678-39731700 CTGCTGCTGGCCTTGCCTCTTGG - Intergenic
1025207863 7:57003891-57003913 CTGGGCCTTGTCCGGGCTCTTGG - Intergenic
1025664077 7:63572981-63573003 CTGGGCCTTGTCCGGGCTCTTGG + Intergenic
1029436743 7:100568010-100568032 CTGAGGCTTGCCCAGCCCCCAGG + Exonic
1030258694 7:107540551-107540573 CAGGGCCTTGCCCTGTCACTTGG - Intronic
1031923515 7:127618221-127618243 CTGTGGTTTGCCCTGCCTCAGGG - Intergenic
1032790392 7:135238299-135238321 CTGGGGCTGTCCCCGCCCCTAGG + Intronic
1032839697 7:135704176-135704198 TTGGGGCTGCCTCTGCCTCTGGG - Intronic
1034224274 7:149470800-149470822 ATGAGGGTTGCCCTGACTCTTGG + Intergenic
1034383754 7:150720830-150720852 CTGGGCCTGGCCCTGCTGCTGGG + Exonic
1034619577 7:152446498-152446520 CTGGCACTTGCCTGGCCTCTGGG - Intergenic
1034680627 7:152925293-152925315 ATGGGGCTTGCCCTGGGCCTGGG + Intergenic
1034700541 7:153091895-153091917 CTGAGGCTTGCACAGCCTGTGGG + Intergenic
1034869527 7:154671554-154671576 TTGGTACTTGTCCTGCCTCTGGG + Intronic
1035249083 7:157585277-157585299 CTGAGGCTTCCCCTTCCTCCTGG - Intronic
1035249092 7:157585320-157585342 CTGAGGCTTCCCCTTCCTCCTGG - Intronic
1035577393 8:716451-716473 GTGGTGCCTGCCCTGCCTCAGGG - Intronic
1035605285 8:926398-926420 CTGTGGCAGGCCCTGCCTCCAGG + Intergenic
1036088517 8:5639361-5639383 CAGGGGATTTCCCTGCCTTTAGG - Intergenic
1036655268 8:10673685-10673707 CTGGGACTTGCTCTTCTTCTAGG - Intronic
1036690229 8:10940504-10940526 CTAGGGCTTGCTATGCCACTTGG - Intronic
1036705546 8:11043563-11043585 CTGGGTCTTGCACTTCCCCTGGG + Intronic
1037492139 8:19406757-19406779 GAGGGGCTTGCAGTGCCTCTCGG + Intronic
1037950901 8:23018287-23018309 CAGGGCCCTCCCCTGCCTCTGGG + Exonic
1038538205 8:28369688-28369710 GTGGGGCCTGGCCAGCCTCTGGG + Intronic
1038963625 8:32548501-32548523 CGGGCGCTCGCCCTGGCTCTCGG - Intronic
1039391135 8:37181568-37181590 CTGGGGATTGTGCTGCCTTTGGG - Intergenic
1039892077 8:41692616-41692638 CTGGGCCCTGCACCGCCTCTGGG - Intronic
1040943385 8:52855072-52855094 CTGTCCCATGCCCTGCCTCTAGG + Intergenic
1041942095 8:63399766-63399788 CTGGCTGTTGCCATGCCTCTGGG + Intergenic
1042955214 8:74242758-74242780 CTGGGGCTTCCCTTCCCCCTTGG + Intronic
1044315740 8:90748684-90748706 CTGGCTGTTGCCCTTCCTCTAGG - Intronic
1046443942 8:114290882-114290904 CTGATGCTTGCCCTGTCTCTTGG + Intergenic
1046643042 8:116754064-116754086 CTGTGGCTTTCCCTGGCTCATGG - Intronic
1048121662 8:131588367-131588389 TTGGGCCTAGCCCTGCTTCTAGG + Intergenic
1048354426 8:133641680-133641702 CCGGGGCTGGCCCTGCTTCTAGG - Intergenic
1048999035 8:139813139-139813161 CTGGGGCACGCCCTGCTTGTGGG - Intronic
1049082106 8:140451473-140451495 TTGGGGCTTCCCCTGCCTCTGGG - Intronic
1049183164 8:141233862-141233884 CTGCGGCTGGACCTGACTCTGGG + Intronic
1049235680 8:141511071-141511093 CTGGGGCTTTTCCTGCCACAGGG + Intergenic
1049348729 8:142152801-142152823 CCGGTGCTGGCCATGCCTCTGGG - Intergenic
1049414171 8:142487875-142487897 ATGGGGGCTGCCCTGCCTCAGGG - Intronic
1049471282 8:142776069-142776091 GTGGGGCCGGCCCTGCCTCCCGG + Exonic
1049480849 8:142821780-142821802 CTGGGGCTTGTCCTAACACTGGG + Intergenic
1049607416 8:143536207-143536229 CTGGGGCTGGGCCTGCCTGATGG - Intronic
1049685099 8:143936187-143936209 CTGGGACTGGCCATGCCTCGGGG + Intronic
1049893363 9:91795-91817 CTGGGGTTTGCCCTGAGTCTAGG + Intergenic
1049950030 9:634901-634923 CTGAGACTTGCTCTGCCTCTTGG + Intronic
1053734582 9:41091877-41091899 CTGGGGTTTGCCCTGAGTCTAGG + Intergenic
1054455361 9:65427508-65427530 CTGGGGCTCGCCAGGCCTCTGGG - Intergenic
1054693798 9:68339537-68339559 CTGGGGTTTGCCCTGAGTCTAGG - Intronic
1056365825 9:85903711-85903733 CTGAAGCCTGCTCTGCCTCTTGG - Intergenic
1057294999 9:93829735-93829757 CTGGGCCTTAGCCTGGCTCTGGG - Intergenic
1057334099 9:94142339-94142361 CTGGAGCTTGTCCTGCCCCAGGG + Intergenic
1058625849 9:106932096-106932118 GTTGGGCTTGCTCTCCCTCTAGG + Intronic
1060544019 9:124450133-124450155 TTGGGGCTTCCCAGGCCTCTCGG - Intergenic
1060906609 9:127312959-127312981 CTGGGGCTTGCCCTGCCTCTGGG - Intronic
1061451005 9:130666958-130666980 CTGGAGCTCACCCCGCCTCTAGG + Intronic
1061478173 9:130883078-130883100 CTGGGACTTGCCTGGCCTCAGGG - Intronic
1061482635 9:130904551-130904573 CTGGGGCTGCCCCTGGGTCTAGG + Intronic
1061654772 9:132080540-132080562 CTTGGGTTTCCCCTGCCTTTTGG - Intergenic
1061714223 9:132508944-132508966 CAGGGCCTTGCTCTGCCTCCTGG - Intronic
1061971400 9:134047364-134047386 CTGGCACCTGCCCTCCCTCTGGG - Intronic
1062129748 9:134885937-134885959 ATGGGGGTGCCCCTGCCTCTTGG + Intronic
1062200413 9:135299938-135299960 CAGGTGCCTGCCCTGCCTCACGG - Intergenic
1062453177 9:136623988-136624010 CTGGGGCTTGTCCTGGCCCTGGG + Intergenic
1062511594 9:136909370-136909392 CTGGGTCTCTCTCTGCCTCTGGG + Intronic
1062630194 9:137459862-137459884 CTGGGGACTGCCCAGCCTCAGGG + Intergenic
1062736792 9:138141917-138141939 TTGGGGCTCTCACTGCCTCTGGG + Intergenic
1203547331 Un_KI270743v1:138600-138622 CTGGGGTGTGTGCTGCCTCTGGG - Intergenic
1186857887 X:13643109-13643131 CTGGGGCTTTCCCAGACTCAGGG - Intergenic
1187313543 X:18169645-18169667 TTGGGGCTGGCTCTGCCCCTTGG + Intronic
1189330372 X:40141129-40141151 CTGGGGCTTGGGCTTGCTCTGGG + Intronic
1190023804 X:46903831-46903853 CTGGGGCTCCCCCTAGCTCTTGG - Intergenic
1192054503 X:67759319-67759341 GTGGGGCTTACTATGCCTCTGGG + Intergenic
1193449768 X:81651481-81651503 TTGGGGATTTCCCTTCCTCTAGG + Intergenic
1194111671 X:89841645-89841667 ATGTGGCCTGGCCTGCCTCTTGG + Intergenic
1196819161 X:119689289-119689311 TTGGGGCTTGCCCTGTGCCTTGG + Intronic
1198768743 X:140106011-140106033 CAGGGGCTTGCCCAACTTCTGGG - Intergenic
1199548298 X:149031287-149031309 CTCTGTCTTGCACTGCCTCTGGG - Intergenic
1199790600 X:151151959-151151981 CCCGGGCTTGCCCTGCCACAGGG + Intergenic
1200072768 X:153537224-153537246 CTGGGGCTGGGCCTGGCTCCTGG - Intronic
1200399015 X:156007991-156008013 TTGGGGCTCTCACTGCCTCTGGG + Intronic