ID: 1060906610

View in Genome Browser
Species Human (GRCh38)
Location 9:127312960-127312982
Sequence CCTGGGGCTTGCCCTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906610_1060906620 10 Left 1060906610 9:127312960-127312982 CCAGAGGCAGGGCAAGCCCCAGG 0: 1
1: 0
2: 5
3: 55
4: 484
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906610_1060906618 -6 Left 1060906610 9:127312960-127312982 CCAGAGGCAGGGCAAGCCCCAGG 0: 1
1: 0
2: 5
3: 55
4: 484
Right 1060906618 9:127312977-127312999 CCCAGGCTTGGGGGATTCAGAGG No data
1060906610_1060906622 17 Left 1060906610 9:127312960-127312982 CCAGAGGCAGGGCAAGCCCCAGG 0: 1
1: 0
2: 5
3: 55
4: 484
Right 1060906622 9:127313000-127313022 CCCAGTAATGTCAAGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906610 Original CRISPR CCTGGGGCTTGCCCTGCCTC TGG (reversed) Intronic
900250254 1:1665185-1665207 CTTGAGGCTTGCGATGCCTCTGG + Exonic
900339370 1:2180818-2180840 CCTGGGCCCAGCCCTGCATCCGG + Intronic
900346969 1:2214691-2214713 ACTGGGTCCAGCCCTGCCTCAGG - Intergenic
900374664 1:2347993-2348015 CCCGAGGCGTGCCCTGCCCCGGG - Intronic
900609569 1:3538856-3538878 CGTGGGGCTGGCCTTGCCTGGGG - Intronic
900869494 1:5291903-5291925 CCGTGGGCTTGCCCTGCCTTTGG - Intergenic
900992884 1:6106107-6106129 CCTGGAGCTTTTACTGCCTCCGG - Intronic
901055112 1:6445716-6445738 CCCGGAGCTGGGCCTGCCTCGGG + Exonic
901666931 1:10831384-10831406 CTCTGGGCCTGCCCTGCCTCAGG - Intergenic
901680175 1:10908503-10908525 CCTCGGTCTGGCCCTGCCTCGGG + Intergenic
901913688 1:12481185-12481207 CCTGGGCCTCCCCGTGCCTCTGG - Intronic
902118057 1:14138212-14138234 CCTGAGGCTCACCCTGCCTCAGG - Intergenic
902184967 1:14718078-14718100 CTTTGTGCTTGCCCTGCCGCTGG - Intronic
902388675 1:16090315-16090337 GCTTGGGCTTGCACTGGCTCTGG - Intergenic
902531244 1:17092079-17092101 GGTGGTGCCTGCCCTGCCTCAGG + Intronic
902689788 1:18103419-18103441 CCTGGGGCAGGGCCTGCCTGGGG + Intergenic
902728051 1:18350342-18350364 CCTTGGCCTTGCCCTGACCCAGG - Intronic
903178808 1:21595298-21595320 CCTGGGGCTCCCCCTGCCCTTGG + Intergenic
903191097 1:21656592-21656614 CCTGGGGGTTCCCCAGCCCCTGG + Intronic
903383851 1:22914284-22914306 CCTGGGGGTTGCCCATCCTCAGG - Intronic
903546389 1:24126226-24126248 CATGGGGCATGCCCTTCCTGGGG - Intronic
903563860 1:24249556-24249578 CCTGAGGCCTGCCCGCCCTCTGG + Intergenic
903811549 1:26037595-26037617 CCTGGGGCCTGCCATGGCTTGGG + Intronic
903850101 1:26300854-26300876 CCTAGGCCTTGCCCCGTCTCTGG + Intronic
904451032 1:30611840-30611862 CCTGGGGGTTGTCCAGCATCAGG - Intergenic
905425220 1:37878377-37878399 CCTGGCGAGTGCCCTGGCTCAGG + Intronic
907049212 1:51318360-51318382 GCTGCGGCTGGGCCTGCCTCAGG + Intronic
907441468 1:54481170-54481192 CCTAGGACTGGCCCTGTCTCAGG + Intergenic
907491853 1:54813661-54813683 CTTGAGGCTGGCCCGGCCTCCGG + Intronic
908794485 1:67817540-67817562 CCAGTGCCTTGCCCTGGCTCAGG + Intronic
910214587 1:84830322-84830344 CCTTTGGCTTGCCCTGTCTCTGG - Intronic
912681537 1:111732258-111732280 CCCCGGGCTTCCCTTGCCTCAGG + Intronic
913958327 1:143322084-143322106 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
914052642 1:144147459-144147481 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
914126555 1:144819082-144819104 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
914379042 1:147100014-147100036 CCTGAGGCTTACCCTGCAGCTGG - Intergenic
915111008 1:153564705-153564727 CCCAGGGCATGCCCTGCCTCTGG - Intronic
915592896 1:156880592-156880614 CCTGGGGCCTGCTCTGGCTGTGG - Intronic
917969697 1:180198754-180198776 CCTTGGGCTGGCCCTGGCTGGGG + Exonic
918392720 1:184083191-184083213 GCTGGTCCTTGCCCTGCCACTGG - Intergenic
920100963 1:203516795-203516817 TCTGGGGCTTGGCCTGTTTCTGG - Intergenic
920298538 1:204974604-204974626 CCTTGGGCTGGTCCTGTCTCAGG + Intronic
920600798 1:207321878-207321900 CCAGGGGCTTCCCCGGCCGCCGG - Intronic
920664611 1:207953409-207953431 ACTGGGACTTTCACTGCCTCTGG + Intergenic
921399079 1:214700582-214700604 CCAGGGGCTTGACCTGCCTGAGG - Intergenic
922010014 1:221573917-221573939 CCTGAGGTTGGCCCTGCCCCAGG - Intergenic
922545501 1:226453586-226453608 CCTGGGCCAGGCCCTGACTCTGG + Intergenic
922695295 1:227728382-227728404 CCTGGGGCTTCCCTGGCTTCAGG - Intergenic
923085987 1:230703928-230703950 GCTTGGCCTTGCCTTGCCTCAGG - Intronic
924192339 1:241566880-241566902 CTTGGGGCTTGGCGTGCCACAGG + Intronic
924775932 1:247114505-247114527 ACTGGGGCGTGGGCTGCCTCGGG + Intergenic
1062768471 10:82371-82393 CTTGGGGCTCTCACTGCCTCTGG - Intergenic
1064008402 10:11715743-11715765 CCAGGGGCTTCCACAGCCTCCGG - Intergenic
1065004115 10:21363877-21363899 CCTGGGGCTTGTTCTGTGTCAGG - Intergenic
1065201722 10:23318789-23318811 CCCTGGACTTGCCCTGCCTCTGG - Exonic
1065528353 10:26644504-26644526 TCAGTGGCTTGCACTGCCTCAGG - Intergenic
1066759339 10:38738483-38738505 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1066759774 10:38739959-38739981 CCTGGTCCTTGTCCTGCCCCAGG + Intergenic
1066760355 10:38742449-38742471 CCTTTGGCCTGCCCTGGCTCTGG + Intergenic
1066962290 10:42234296-42234318 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1067686122 10:48466783-48466805 CCTGGGCCTTCCCTCGCCTCAGG - Intronic
1067837193 10:49648918-49648940 CGTGGGCCTGGCCCTGACTCAGG - Intronic
1067837472 10:49650651-49650673 CCTAGAGCCTGCCCTGCCACTGG + Intronic
1069749771 10:70737622-70737644 TCTGGGGCTTGTCCTGTCACAGG + Intronic
1069895766 10:71679240-71679262 CCTGGGTCTTGTCCTGGCCCAGG - Intronic
1070813773 10:79311212-79311234 CCTGGGGCTAGGCCTGGCGCCGG + Intronic
1072434747 10:95404876-95404898 CCTGGGTCTGGTGCTGCCTCAGG - Intronic
1072782821 10:98261832-98261854 CCTCTGGCCTGCCTTGCCTCAGG + Intronic
1072861828 10:99014095-99014117 CCTGGGTTTTGGCCTCCCTCTGG - Intronic
1073064485 10:100750116-100750138 CCCAGTGCTTGCCCTGCCCCTGG + Intronic
1073323197 10:102628035-102628057 CCTGGGCCCTGCCCTGCCTGTGG + Intronic
1073368861 10:102968630-102968652 ACAGGGTCTTGCTCTGCCTCAGG + Intronic
1075226829 10:120637127-120637149 GCTGGTACTTGCCCTGACTCAGG + Intergenic
1075727160 10:124616550-124616572 CCTGCGGGGTGCCCTGTCTCTGG + Intronic
1076795223 10:132794985-132795007 CCTGGGGCATCCCCTGCATGGGG + Intergenic
1076814315 10:132907124-132907146 CCTGGGGCGCTCCTTGCCTCCGG + Intronic
1077042672 11:531465-531487 CAAGGGGCTTGCCCTGCCTTGGG - Intergenic
1077158271 11:1101151-1101173 CCAGCGGCTAGCCCTGCCTCCGG + Intergenic
1077158275 11:1101167-1101189 CCTCCGGCTAGCCCTGCCTCTGG + Intergenic
1077197491 11:1288698-1288720 CCTCCACCTTGCCCTGCCTCAGG + Exonic
1077217061 11:1399338-1399360 CCAGGGCCTGGCCCTGCCACTGG + Intronic
1077224417 11:1433872-1433894 CCTGCAGCTCCCCCTGCCTCTGG + Intronic
1077455426 11:2675660-2675682 CCCAGGGCCTGCCCTGACTCTGG + Intronic
1078357538 11:10643384-10643406 CCAAGGGCCTGCTCTGCCTCTGG + Intronic
1079130269 11:17743333-17743355 CCTGTGGCTTGCTGTGCCCCAGG + Intronic
1081533496 11:43981361-43981383 CCTGGGGCCTTCTCTGCCTGGGG - Intergenic
1081621282 11:44620389-44620411 CCTGGGTCCTCCCCTGCCCCAGG - Intergenic
1081665656 11:44915667-44915689 CCTGAGCCTCGCCCTGCATCAGG + Intronic
1081742816 11:45452776-45452798 CCTGGGGGTTGACCTGCATAGGG + Intergenic
1081989418 11:47329755-47329777 CCTGTGGCCTGCCATGCCTTCGG + Exonic
1082243318 11:49892553-49892575 CCTCGGGCTTCCCCGCCCTCTGG + Intergenic
1083261055 11:61523384-61523406 CCTGGGTCTTTCCTTGCCTCTGG - Intronic
1083265253 11:61543794-61543816 CCTGGCTCTGGCCCTGCCTGTGG - Intronic
1083274382 11:61588424-61588446 CCTGGGGCGTGGCCTGCCAGAGG + Intergenic
1083745758 11:64735694-64735716 CTCTGGGCTTCCCCTGCCTCTGG - Intronic
1083764402 11:64835164-64835186 CCTGGGGCTGACCTTTCCTCTGG - Intronic
1083815429 11:65130052-65130074 CCAGAGGCTGGCCCTGCCCCTGG - Exonic
1083962211 11:66020794-66020816 CCTGGGGCCTGCCCTACCCTGGG + Exonic
1083994244 11:66264356-66264378 CCTGGTACTTGCCCTGCTTCAGG - Exonic
1084043442 11:66555658-66555680 CCTGGGGCACGTCCTGCCTGTGG + Intronic
1084605890 11:70171389-70171411 CGTTGGTCTTGCCCTGGCTCTGG - Intronic
1085025072 11:73231638-73231660 CTTGGGCCTTGAACTGCCTCCGG + Intronic
1089446614 11:118557866-118557888 CCTGTGGCATGCCCTCCCTTAGG + Exonic
1090402945 11:126460645-126460667 ACTGGGTCTTGCCAGGCCTCTGG - Intronic
1090405040 11:126471454-126471476 CCTGGGGCCTCCCCTTCCTCTGG - Intronic
1091194540 11:133719990-133720012 CCTGGAGAATGCCCTCCCTCGGG + Intergenic
1091582730 12:1798917-1798939 CTTGGGGCTTCCTCTGCCCCTGG - Intronic
1091690937 12:2597025-2597047 CCTGAGGCTAGCCCCGCCTCAGG + Intronic
1091791178 12:3273111-3273133 TCTGGGCCGTGCCCTGACTCCGG - Intronic
1092961655 12:13601987-13602009 CCTGGGGCTAGCCAAGCCCCAGG + Intronic
1092961654 12:13601987-13602009 CCTGGGGCTTGGCTAGCCCCAGG - Intronic
1093069698 12:14696007-14696029 TCTGGGACTAGCCCTGACTCAGG - Intronic
1093293388 12:17357485-17357507 CCTGATGCATGCCCTTCCTCTGG - Intergenic
1096217927 12:49808768-49808790 CCTGGGGTTTTCCCTGCCCCAGG - Intronic
1096399301 12:51291825-51291847 CCTGGGGCTTGCAGTGGCTCTGG + Exonic
1096527001 12:52216036-52216058 CCTAGAGCTTGCCCAGCCTGGGG + Intergenic
1096677909 12:53235359-53235381 GCTGGTGCCAGCCCTGCCTCTGG + Intergenic
1097107906 12:56635986-56636008 ACTGGGGCTTGCCCATACTCAGG + Intronic
1097696672 12:62781384-62781406 CCAGGAGCTTGCCCTGCGTGTGG + Intronic
1100468861 12:94873245-94873267 CCTGGGGCTGGCTCCGTCTCTGG + Intergenic
1101150335 12:101877622-101877644 CCTCGCGCTTCCCCTCCCTCCGG + Exonic
1102578037 12:113869365-113869387 CCAAGGGCTTGCCCTGCCCAAGG - Intronic
1103728343 12:123010172-123010194 TCTGGGCCTTGCCCTGCCAGAGG + Intronic
1103741703 12:123095719-123095741 CATGGGGCTCCTCCTGCCTCGGG + Intronic
1103919786 12:124393330-124393352 CCTGGGGCTTGTGCTGCCTGAGG - Intronic
1104671528 12:130683861-130683883 CCTCGGGGTTGTCCTGCCTATGG + Intronic
1104814938 12:131640173-131640195 CCTCGGGCTTTCACTGCCTGGGG + Intergenic
1104885315 12:132104069-132104091 CCTGGGGCCTGCCCCGGCGCGGG + Exonic
1104960671 12:132487309-132487331 CCTGGGGCTTGCCAGGGCCCTGG - Intergenic
1104991098 12:132624303-132624325 CCAGGGGCTTTTCCTCCCTCTGG + Exonic
1105053858 12:133079820-133079842 CCTCGGGGCTGCCCTGCCTATGG + Exonic
1106113968 13:26801341-26801363 CCTTGGGCTTGCTCTGTCCCAGG - Intergenic
1106425540 13:29625278-29625300 CCTGTGGCTGGCCCTTCCCCTGG - Intergenic
1107938270 13:45363117-45363139 GCTGGGGATGGGCCTGCCTCTGG - Intergenic
1114629688 14:24151125-24151147 CCTGCGGCTTCCCCTTCCTAAGG - Exonic
1114633092 14:24172120-24172142 CCTGGGCCTTGCACTGGCTTGGG - Exonic
1115491078 14:33958784-33958806 CCTGGAGCCTGTCCTACCTCTGG + Intronic
1116582810 14:46663622-46663644 GCTGTGGCTTGCCCTGCACCAGG + Intergenic
1117095027 14:52288436-52288458 CCTTGGGCATGCCATGCCACAGG - Intergenic
1117584240 14:57183871-57183893 CCTAGGGCTGGCTCTGACTCAGG - Intergenic
1117666144 14:58058393-58058415 CCTTGGGCCTGCTCTGCCTATGG - Intronic
1118456407 14:65948824-65948846 TGTGGGGGCTGCCCTGCCTCAGG - Intergenic
1119926955 14:78503681-78503703 CCTGGGACTAGCCCTGCCTCTGG - Intronic
1121464052 14:94102816-94102838 CCTGGGGCCAGACCTGGCTCCGG - Intronic
1121505181 14:94471851-94471873 GCTGGGGCTTGCGATGTCTCGGG - Intronic
1121834558 14:97080154-97080176 CCTGGAACCTGCCCTGCCTCTGG + Intergenic
1122088455 14:99322704-99322726 CCAGGGGCTGGCCTTGTCTCAGG - Intergenic
1122104016 14:99437408-99437430 TCTGCTGCTTTCCCTGCCTCTGG + Intronic
1122787774 14:104171844-104171866 CCGGGGGCCTGCGCTGCCTGGGG - Exonic
1123031004 14:105451029-105451051 CCTAGGGCTTGGCCTCCCACGGG + Intronic
1202930082 14_KI270725v1_random:28100-28122 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1123442780 15:20303209-20303231 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1123443764 15:20307012-20307034 CCTTTGGCCTGCCCTGGCTCTGG + Intergenic
1123507630 15:20960713-20960735 TCTTGGGCTTCCCCTGCCGCTGG + Intergenic
1123564852 15:21534456-21534478 TCTTGGGCTTCCCCTGCCGCAGG + Intergenic
1123601110 15:21971747-21971769 TCTTGGGCTTCCCCTGCCGCTGG + Intergenic
1123982015 15:25613098-25613120 CCTGCGGCTGGCCCTGGCTGGGG - Intergenic
1126357415 15:47811297-47811319 CTTGTGGCTGGCCCTGCCTGTGG - Intergenic
1128310844 15:66631099-66631121 GCAGGGGCTGGCCCAGCCTCAGG + Intronic
1129269195 15:74410596-74410618 CCTGAGGCATGCCCAGCCTCGGG + Exonic
1129316755 15:74749872-74749894 CATGGGGCTGGCCCTTGCTCGGG + Exonic
1129382924 15:75178968-75178990 CCTGGGACTGGCCCTGGCCCTGG - Intergenic
1129656754 15:77529690-77529712 CCTTGGGCCTGCCTTTCCTCAGG + Intergenic
1130297555 15:82657837-82657859 CCAGGGGACAGCCCTGCCTCTGG - Intergenic
1131509963 15:93044468-93044490 CCCCGGGGTTGCCCTGCCTGGGG + Intronic
1131996615 15:98139148-98139170 CCTGAGGCTTGCTCAGACTCAGG - Intergenic
1132320768 15:100923572-100923594 CATGGGTCTTACCCTCCCTCTGG + Intronic
1132406217 15:101543060-101543082 CCTTGGGCATGCGCTGCCTGTGG + Intergenic
1202973218 15_KI270727v1_random:261566-261588 TCTTGGGCTTCCCCTGCCGCTGG + Intergenic
1132457342 16:31395-31417 CTTGGGGCTCTCACTGCCTCTGG - Intergenic
1132499730 16:280136-280158 CCGGGGGCCTGCCCAGCCTTGGG - Intronic
1132678515 16:1130468-1130490 CCCGGGGCAAGCACTGCCTCAGG + Intergenic
1132714182 16:1282599-1282621 CCTGCCGCAGGCCCTGCCTCGGG + Intergenic
1132779530 16:1614849-1614871 CCTGGGGGCTGCCCTGCGGCGGG - Exonic
1132890614 16:2202609-2202631 CCTGGGCCTGGCCCTGGCCCTGG - Intergenic
1133104922 16:3501174-3501196 CCTGAGGCTTGCGCTGCCGGAGG + Intronic
1133256191 16:4517872-4517894 CATGGGGCTTTACCTGCGTCTGG + Intronic
1133271307 16:4612016-4612038 CCTGGGGCCTGCCCTCGATCAGG + Intronic
1133304299 16:4800168-4800190 CCAGGGACTTGCCATGGCTCTGG - Intronic
1133313770 16:4869271-4869293 CCTCGGGCCTGCTCTGCCTTGGG + Intronic
1134105735 16:11484964-11484986 CCTGGGGGTTCCTCTGGCTCAGG + Exonic
1134626246 16:15724836-15724858 CCTGGGGGGTGGCCTTCCTCGGG - Exonic
1136723444 16:32340680-32340702 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1136773486 16:32859633-32859655 TCTGGCGCTTGCCCTGACTCTGG + Intergenic
1136840757 16:33542820-33542842 CCTTTGGCCTGCCCTGGCTCTGG - Intergenic
1136841788 16:33546758-33546780 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1136862531 16:33712217-33712239 TCTGGCGCTTGCCCTGACTCTGG + Intergenic
1136897126 16:34001886-34001908 TCTGGCGCTTGCCCTGACTCTGG - Intergenic
1137675895 16:50303787-50303809 CCTGGGGGTTGGCTGGCCTCTGG + Intronic
1137725402 16:50653469-50653491 CCTGGAACTGGCCCTGGCTCAGG - Intergenic
1138261523 16:55626928-55626950 CCTGGCCCTTGGCCTCCCTCAGG + Intergenic
1138381661 16:56607180-56607202 CCTGGCGCTTTCCGTGCCTGTGG - Intergenic
1138536602 16:57663648-57663670 CCTGGGGCTGGGCCGGGCTCGGG - Exonic
1139311654 16:66032896-66032918 CCAGGGGCTCCCCCTGGCTCCGG - Intergenic
1139391786 16:66610040-66610062 ACAGGGGCCTGCCCTCCCTCGGG + Intronic
1139635840 16:68257945-68257967 CTAGGGGCTTTCCTTGCCTCAGG + Intronic
1141169965 16:81684955-81684977 CCTCGGGACTGCCCTGGCTCTGG - Intronic
1141487284 16:84349156-84349178 CCAGAGGGTTGCCCAGCCTCTGG - Intergenic
1141694730 16:85614006-85614028 CCCGGGGCGCGCCCTTCCTCGGG - Intronic
1141987781 16:87591058-87591080 CCTGGGACCAGCCCTTCCTCCGG + Intergenic
1142230255 16:88896797-88896819 CCTGGGCCTGGCCCTCCCTTAGG + Intronic
1142274940 16:89113446-89113468 CTTGGGGCCTGCCCAGCCCCAGG - Intronic
1142284810 16:89167383-89167405 CCTGGGGCATGCCTGGCCGCTGG + Intergenic
1142302883 16:89268896-89268918 CCTGGGGCTCACCCTGGCCCGGG + Intronic
1203002988 16_KI270728v1_random:177085-177107 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1203075902 16_KI270728v1_random:1121744-1121766 TCTGGCGCTTGCCCTGACTCTGG + Intergenic
1203124013 16_KI270728v1_random:1560377-1560399 TCTGGCGCTTGCCCTGACTCTGG + Intergenic
1203134593 16_KI270728v1_random:1713491-1713513 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1203150922 16_KI270728v1_random:1843117-1843139 CCTTTGGCCTGCCCTGGCTCTGG - Intergenic
1203151953 16_KI270728v1_random:1847055-1847077 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1142627368 17:1200874-1200896 CCTGGGGCTCTTCCTTCCTCTGG + Intronic
1142982257 17:3679015-3679037 TCTGGGGCTGCCCCGGCCTCAGG - Intronic
1143117238 17:4587970-4587992 CCTGGGGCCTCCGCTGCCTCGGG - Intronic
1143186403 17:5012959-5012981 CCTGGGGCTGTCCCTGCCTAAGG - Intronic
1143387979 17:6543418-6543440 CCTGGGGCTGGGGCTGCCTTGGG - Intronic
1143408027 17:6690933-6690955 CCTGGTGCTTCCCAGGCCTCGGG - Exonic
1143609894 17:8012179-8012201 CCTGGGGCTTTTCCTGGCTCGGG + Exonic
1144734371 17:17546685-17546707 CCTGGGGCTGGCCTAGCCTATGG + Intronic
1144769814 17:17753184-17753206 CCAGGGGCTGGCCCTGCCTCAGG + Intronic
1144829859 17:18125238-18125260 CCTGGGGCTGGCCCTGCCCTGGG + Intronic
1144849780 17:18238253-18238275 CCTGTGCCTTGGCCTGGCTCTGG + Intronic
1144945236 17:18966334-18966356 CCTGGGAGTGGCCCTTCCTCGGG + Intronic
1145793924 17:27644751-27644773 CCTGGCGCTGGCCCTGGCTCTGG + Intronic
1145797235 17:27662801-27662823 CCTGGGGCTTGCACCACTTCAGG - Intergenic
1146400617 17:32497630-32497652 CCTGGGGGAGGCCCTTCCTCAGG + Intronic
1146901564 17:36592406-36592428 CCTCCGGCTTCCCCTTCCTCGGG - Intronic
1147391263 17:40110732-40110754 CCTATGGCATCCCCTGCCTCAGG - Intergenic
1147715869 17:42507912-42507934 GCTGAGGCCTGCTCTGCCTCAGG - Intronic
1147925931 17:43945871-43945893 CCTGGGGGCTGCTCTGCCTATGG + Intergenic
1148088640 17:45009465-45009487 CCTGGGGCTTAGCATGCCCCAGG - Intergenic
1149175692 17:53867715-53867737 CCTGTGGCTTTTCCAGCCTCAGG + Intergenic
1149867987 17:60161288-60161310 CCTGGGGCCTGACCTGGCTTGGG - Intronic
1150107513 17:62473145-62473167 CCTGGAGCCAGCCCTGCCTGGGG - Intronic
1150226919 17:63529352-63529374 CCTGGGCCCAGCCCTGCCTTGGG + Intronic
1150609378 17:66721425-66721447 CTTGGGGGTTGCTCTGCCTATGG - Intronic
1150632832 17:66892146-66892168 CCTGGGGCTTCCACCTCCTCAGG - Intergenic
1151682177 17:75628070-75628092 CCTGGGGCCTGCCTTGCCGTTGG - Intronic
1151730910 17:75910533-75910555 CCCGGGGCAGCCCCTGCCTCTGG - Exonic
1152099143 17:78290970-78290992 CCTGGAGCTGGCCCTGCAGCAGG - Intergenic
1152541189 17:80976846-80976868 CCTGGGGACTGCCCAGTCTCTGG + Intergenic
1152789680 17:82272653-82272675 AGTGGGGCTTGCCCTCCCGCTGG - Intronic
1152905080 17:82965547-82965569 CCTCCGCCTTGCCATGCCTCCGG - Intronic
1152939470 17:83160622-83160644 TGTGGGGCTTCCCATGCCTCCGG + Intergenic
1152961359 18:82204-82226 CTTGGGGCTCTCACTGCCTCTGG - Intergenic
1154414946 18:14171540-14171562 CCTGGCCCTGGCCCTGCCCCTGG - Intergenic
1154415303 18:14172793-14172815 TCTGGTCCTTGCCCTGACTCTGG - Intergenic
1155083012 18:22429373-22429395 CCTGGGCTTCACCCTGCCTCTGG + Intergenic
1156716839 18:40022425-40022447 CATGCAGCCTGCCCTGCCTCAGG - Intergenic
1157293160 18:46424282-46424304 CCAGGGGCCTTGCCTGCCTCTGG - Intronic
1157654671 18:49373302-49373324 CCTGGGGACTGCTCTGTCTCTGG - Intronic
1160192031 18:76722551-76722573 CCTGGGGCCTGCAGAGCCTCTGG + Intergenic
1160246322 18:77162993-77163015 ACTGAGGTTTTCCCTGCCTCTGG + Intergenic
1160910911 19:1473449-1473471 CCTGGAGCCTGCCCTCCCTTGGG - Exonic
1161361096 19:3850200-3850222 CCCGGGGCTTTTCCAGCCTCTGG - Intronic
1161430397 19:4229190-4229212 CCTGGGGTTTCCCCCGCTTCAGG + Intergenic
1161447851 19:4328183-4328205 CCTGAGGCTGGCCTTGCCCCAGG - Intronic
1161447852 19:4328183-4328205 CCTGGGGCAAGGCCAGCCTCAGG + Intronic
1162829552 19:13275926-13275948 CCTGGGGCTCGTCCTGCATCAGG - Exonic
1162840686 19:13354412-13354434 CCTTGGGCTAGCCCTGCCCTGGG - Intronic
1163702159 19:18791338-18791360 CCTGGGGCCGGCCGTGCCTTGGG - Intergenic
1164157669 19:22606323-22606345 CCTGGGGCCTGCCCAGCCACGGG - Intergenic
1164675038 19:30095236-30095258 GCTGGGGCTGGGCCTGCATCAGG - Intergenic
1166069570 19:40379222-40379244 CCTGGGGCTTGGACTGGCCCTGG - Intronic
1166109036 19:40611631-40611653 CATGTTGCCTGCCCTGCCTCAGG - Intronic
1166313824 19:41977785-41977807 CCTGGGTCTGGCCCTCCCTCCGG - Intronic
1167071790 19:47226335-47226357 CCTGGCCCTGGCCCTGGCTCGGG + Intronic
1167311616 19:48740509-48740531 CCTGGCTCTTACCCTGCTTCGGG + Exonic
1167334438 19:48875786-48875808 CCTGAGGCGTGCCCAGGCTCTGG - Exonic
1167348437 19:48961184-48961206 CCTGGAGCCTCCACTGCCTCTGG + Exonic
1167441602 19:49512591-49512613 CCTGGGGTGTGCCCTGCAACTGG + Exonic
1167769867 19:51508475-51508497 CCTGGGGGCTGCCTGGCCTCGGG - Intergenic
1168701058 19:58439831-58439853 CCCAGGGCTAGCCCTGCCGCTGG + Exonic
1202692039 1_KI270712v1_random:99883-99905 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
925455865 2:4016123-4016145 CCTGGGTCTTCTCCTGCCTGTGG - Intergenic
926697494 2:15780881-15780903 CCTGGGACCTGCCCAGTCTCCGG - Intergenic
927137958 2:20111282-20111304 CCTGGGGCTTCGGCTGACTCAGG - Intergenic
927140223 2:20125145-20125167 CCTGGGGCTGGTCTTGGCTCAGG - Intergenic
927683712 2:25156617-25156639 CCTGGGCCCTGCCCTCACTCAGG - Exonic
928381284 2:30821062-30821084 CCTTGGGCTTGCCCTGGTTGTGG + Intergenic
929217062 2:39425499-39425521 CCTGAGGCCTTCCCTACCTCAGG - Intronic
929572675 2:43032441-43032463 GGTGGGGCTTTCCCTGCCTCAGG + Intergenic
929802690 2:45117695-45117717 CCTGGGGGTTGCAGTGCCTTGGG + Intergenic
930117133 2:47727815-47727837 CCTTGGGGCTGCTCTGCCTCTGG - Intronic
931361980 2:61585574-61585596 CCTGGGGTTTTCCCTGCCACTGG + Intergenic
932330568 2:70896317-70896339 CCTGGGGCCTGGCCTCTCTCCGG - Intergenic
933954358 2:87354089-87354111 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
934238554 2:90250309-90250331 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
934322664 2:91982834-91982856 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
934323671 2:91986773-91986795 CCTTTGGCCTGCCCTGGCTCTGG + Intergenic
934460971 2:94213640-94213662 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
934746642 2:96763795-96763817 CCTGGGGCTCTCCCAGACTCTGG - Intronic
935145424 2:100392069-100392091 GCTGCGGCTTGCCCTGCACCAGG + Exonic
935452099 2:103221801-103221823 TCTGGGGCTCACCCTGCCTCTGG - Intergenic
935941087 2:108239999-108240021 CCTGGAGCTGGACCTGGCTCTGG + Intergenic
937228743 2:120384674-120384696 CCTGGGGCTTGCCAGGCCCCTGG + Intergenic
937241541 2:120465415-120465437 CCAGGGGCTAGCCCTTCCTTCGG - Intergenic
937466764 2:122139701-122139723 CCTGGGTCTTGCCCAGGGTCTGG + Intergenic
937857460 2:126682840-126682862 CCTGGGGCTTGGTCAGCATCTGG - Intronic
939141103 2:138355518-138355540 CCTGGTACTTCTCCTGCCTCTGG + Intergenic
939539492 2:143475690-143475712 CCTGGGCTATGCCCTTCCTCTGG - Intronic
940206141 2:151203764-151203786 CCTGGTGATTGTCATGCCTCTGG - Intergenic
940748545 2:157597545-157597567 CCTGGGGGTTGCGCTGCCGTCGG - Intronic
942133958 2:172906996-172907018 CCTGGGGCTGCTCCTGCCTGGGG - Intronic
942168297 2:173264283-173264305 CCTGGAGCCTGCCCTACCTCTGG - Intronic
942835513 2:180291992-180292014 CCTGGTGCATGGCCTGACTCAGG + Intergenic
945102656 2:206275407-206275429 CCTAGGCCTTTCCCAGCCTCGGG + Intronic
945724840 2:213463570-213463592 CTTGGGGCTTGCACTGTCTGAGG - Intronic
946415797 2:219539080-219539102 CCTGACGCCAGCCCTGCCTCTGG - Exonic
946416869 2:219544124-219544146 CCTGCGCCTTCCCCTTCCTCAGG + Exonic
948205207 2:236159785-236159807 CCCGGGCCCGGCCCTGCCTCAGG + Intergenic
948396525 2:237649077-237649099 CCTGGGTCTTGGCCGGCCCCTGG + Intronic
948456576 2:238107250-238107272 CTTGAGGCCAGCCCTGCCTCTGG - Intronic
948495387 2:238345468-238345490 CCTGGCTCTGGCCCTTCCTCTGG - Intronic
948541924 2:238697382-238697404 CGTGGGGCTGGGCCTGCCTTTGG + Intergenic
948668863 2:239553619-239553641 CCTGGGTCCTCTCCTGCCTCTGG + Intergenic
948798638 2:240420168-240420190 GCTGGGGCTTGGCCTGGCTATGG - Intergenic
948942089 2:241201703-241201725 CCTTGGGCCTGCCCCGCCTGGGG - Intronic
1169328965 20:4701613-4701635 CCTGGTGCTTGCCCTGTGTTGGG + Intergenic
1169718664 20:8648131-8648153 CCCGGGGCTTCCCTTTCCTCTGG + Intronic
1172585811 20:36083653-36083675 CCTGGGGGTTGCTCTGTCTAAGG + Intergenic
1173495633 20:43515270-43515292 CCTAAGGCTGGCCCTTCCTCAGG + Exonic
1173595793 20:44257831-44257853 TCTGGGCCTTCCCCTGTCTCAGG - Intronic
1175078040 20:56392408-56392430 CCTGGGGCTGGGACTGCCACAGG - Exonic
1175173224 20:57094026-57094048 CCTGGGTCTTGCTGTGTCTCCGG + Intergenic
1175334361 20:58185422-58185444 CCTGGGGCTTTGCTTGCCCCAGG - Intergenic
1175541626 20:59751503-59751525 CCTGGAGCTTGCCCTGAAGCAGG + Intronic
1175762595 20:61571617-61571639 GCTGGGGCTTGCCAGGCTTCTGG - Intronic
1175835771 20:61993413-61993435 CCTGGGGTGTGTCCTGCGTCAGG - Intronic
1175988483 20:62776148-62776170 CCTGGGGCTCCCTCTGTCTCTGG + Intergenic
1176592097 21:8656682-8656704 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1176858015 21:13986471-13986493 TCTGGTCCTTGCCCTGACTCTGG + Intergenic
1176866078 21:14055938-14055960 CCTGGTCCTGGCCCTGCCCCTGG - Intergenic
1177773241 21:25539916-25539938 CCTGGGCCTGGGCTTGCCTCAGG - Intergenic
1178251746 21:31009953-31009975 ACTGGGGCTTTTCCTGACTCAGG + Intergenic
1178906296 21:36639779-36639801 CCTGGGGCTTTCTGGGCCTCAGG - Intergenic
1179354749 21:40648983-40649005 CCTGGGCCTTGCTCAGCCCCGGG - Intronic
1179522577 21:41954434-41954456 CCAGGGGCTGGGCCTGCCTTAGG + Intergenic
1180091627 21:45536500-45536522 ACAGGGTCTTGCCCTGGCTCCGG - Intronic
1180149215 21:45939161-45939183 TCTGGGGCTTTCTCTGCCACAGG + Intronic
1180274948 22:10633811-10633833 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1180549420 22:16528738-16528760 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1180550435 22:16532626-16532648 CCTTTGGCCTGCCCTGGCTCTGG + Intergenic
1180945377 22:19689526-19689548 ACAGGGGCTGGCCCTGCCACGGG - Intergenic
1181168451 22:20995391-20995413 CCTGGGGCTTGTGCTGACCCCGG + Intronic
1181181454 22:21071378-21071400 TCTGGGGCATGACCTGCCTTTGG - Intergenic
1181354234 22:22289185-22289207 CCTTTGGCCTGCCCTGGCTCTGG - Intergenic
1181355273 22:22293098-22293120 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1181719411 22:24762452-24762474 CCTGCGGCGGGCTCTGCCTCGGG + Exonic
1182455637 22:30448445-30448467 CCTGGGGTTTGGCCTGGCTGGGG - Intronic
1183228027 22:36563553-36563575 CTTGGGGCTTGCCTGGCCCCAGG - Intergenic
1183273126 22:36874349-36874371 CTGGGGGCTGACCCTGCCTCTGG - Intronic
1183688713 22:39376276-39376298 CCTGGGACCCGCTCTGCCTCTGG + Intronic
1183824847 22:40378019-40378041 CCTGTGGATAGCCCTGCCTTAGG - Intronic
1184448913 22:44571258-44571280 CCTGGAGCTTGGCCTGCCTCGGG + Intergenic
1184518957 22:44981080-44981102 CGTGGGGGTTGCCGTGTCTCTGG + Intronic
1185141760 22:49106561-49106583 CCTGGGGCTTGGCATGACTTGGG + Intergenic
1185228316 22:49666346-49666368 CATGAGGCTGGCCCTGCTTCTGG - Intergenic
1185318656 22:50190235-50190257 CTGGGGGCTGGCACTGCCTCTGG + Intronic
1185334415 22:50265245-50265267 ACTGGGGCATTTCCTGCCTCTGG + Intronic
949347857 3:3093729-3093751 CCTTGGGGTTGCCCTCCCACAGG - Intronic
949769251 3:7560663-7560685 CCTGGAGCTTTTCCTGCTTCAGG + Intronic
949898896 3:8793497-8793519 CCTGGAGCTTGCCGTGACACAGG - Intronic
950088319 3:10277312-10277334 CCTGGGCTTTGGCTTGCCTCTGG + Intronic
950090976 3:10294237-10294259 ACTGGGGCTTCCCTAGCCTCCGG + Intronic
950573444 3:13816393-13816415 TCTGGGGCCTGCCCTCTCTCGGG - Exonic
951321245 3:21248643-21248665 CCTGTGATTTGCCCTGCCACTGG + Intergenic
952158799 3:30672374-30672396 CTTTGGGCTTTCCCTGCGTCTGG + Exonic
952761687 3:36920790-36920812 CCTGAGGCCTGCCCTATCTCTGG + Intronic
954325068 3:49859101-49859123 GCTGGGGCCGGCCCTGCCACTGG + Exonic
954435122 3:50491844-50491866 CCTGGGCTTTGTCCTGCTTCTGG - Intronic
954447424 3:50554125-50554147 CTTCAGGCTTGCCCTGCCTGAGG - Intergenic
954577565 3:51685012-51685034 CCTGGGGCCTGCCCAGACACTGG - Intronic
954660997 3:52226714-52226736 CCTGGGCATTCTCCTGCCTCAGG + Intergenic
954716871 3:52531364-52531386 CCTGGGCCTTGCCCTTCCCATGG + Intronic
954807192 3:53227355-53227377 CCTGGGTCTCCCCCTGCCTGGGG + Intronic
955225055 3:57053400-57053422 CCTCCAGCCTGCCCTGCCTCTGG + Intronic
955699590 3:61670888-61670910 CCGGAGGCTTGCCCTGACTTGGG + Intronic
957752899 3:84445748-84445770 CTTGGAGCCTGCACTGCCTCAGG + Intergenic
959067826 3:101676345-101676367 CCCGCGGCTGGCCCGGCCTCCGG + Intronic
960844613 3:121994342-121994364 TGTGGGGCTTGCCCTGGCTGAGG - Intronic
960944339 3:122956072-122956094 CCAGTGCCTTGCCCTGCCTCGGG + Intronic
961460797 3:127049282-127049304 CCTGGGTACTGCCCTGCCTGCGG - Intergenic
961554948 3:127691095-127691117 CCTGGGCCTGGGCCTGCCTATGG - Exonic
963504716 3:146169803-146169825 CCTGGGGACTTCCCTGTCTCTGG - Intergenic
964195520 3:154059783-154059805 CCTTGGGTGGGCCCTGCCTCAGG + Intergenic
964753083 3:160070032-160070054 CCTGGGCAATGCCCTCCCTCTGG + Intergenic
964817748 3:160735117-160735139 CCTGGAGCCTGCCCTGCCTCTGG - Intergenic
966724825 3:183099696-183099718 CCTGGGGCCTGCTCTGACTAAGG + Intronic
966884515 3:184369119-184369141 CCTGGCACTGGCCCTGGCTCTGG - Intronic
967171196 3:186824926-186824948 GCTGGGGGTTGGCCTGGCTCAGG - Intergenic
967224206 3:187275357-187275379 CCAGGACCTTGCCCTGACTCAGG + Intronic
968343066 3:197974927-197974949 CCTTGGGCCTGCTCTGCCTATGG - Intronic
968446908 4:656819-656841 CCTGAGGCTGGCCCTGGCCCGGG - Intronic
968933465 4:3597074-3597096 TCTGGGGCTGGCCTTGCCCCTGG - Intergenic
969297638 4:6279155-6279177 CCTGGGCCCTGCCCTCCCTGCGG - Intronic
969643105 4:8411043-8411065 GCTGGGGCTGGGCCTGCCCCAGG + Intronic
970611144 4:17726316-17726338 CCTGGAGCTAGCCCTGGCTTCGG - Intronic
972457946 4:39272543-39272565 CCTGGTCCTTGCCCAGTCTCAGG + Intronic
973942846 4:55927681-55927703 CCTTGGGCCTGCTCTGCCTATGG + Intergenic
976168083 4:82276164-82276186 CCTGGGGCTTGCAGTGGCTCTGG - Intergenic
979610335 4:122682794-122682816 CCTTGGGGTTGCTCTGCCTATGG - Intergenic
981803046 4:148680447-148680469 CCTGGGGTTTCTCCTCCCTCAGG + Intergenic
983187287 4:164714749-164714771 CCTTGGGTCTGCCCTGCTTCAGG - Intergenic
984176347 4:176422865-176422887 CCTGGGGCTTCTCCCGTCTCAGG - Intergenic
984846266 4:184110528-184110550 CCTGAGTCTGGCCCTGGCTCTGG + Intronic
985127373 4:186708181-186708203 ACTGGGGCTTGCCGTACCGCCGG - Exonic
985656018 5:1131684-1131706 TCTGGGGATTGGCCTGACTCAGG - Intergenic
985783279 5:1881771-1881793 CCTAGCCCTTGCCCTGCCCCTGG - Intronic
986721578 5:10564273-10564295 CCAGGGGCTCGCTCAGCCTCCGG + Intergenic
986910415 5:12548916-12548938 CCTGTGGCTTCTCCAGCCTCAGG - Intergenic
991587533 5:68215705-68215727 CCCGGCGCTAGCCCCGCCTCCGG - Exonic
992233289 5:74684389-74684411 CCTTGGGCATGCTCTGCCCCAGG + Intronic
992352501 5:75944824-75944846 GCTGGGGCTGGCCCTGGGTCAGG - Intergenic
992476032 5:77102521-77102543 CCTAGCTCCTGCCCTGCCTCAGG - Intergenic
994293859 5:98065150-98065172 CCTGAAGCTTGCCCTACCCCTGG - Intergenic
995048005 5:107671549-107671571 CCGGGGGCTGGCCGAGCCTCGGG + Intergenic
997267295 5:132502303-132502325 CCGGGGCCTTGCCCTACCCCAGG + Intergenic
997473451 5:134129478-134129500 GCTGGGGGTTGCCCAGTCTCAGG + Intronic
997975829 5:138440773-138440795 TCTGGGCCTTTCCCTGCCTCCGG + Intronic
998463839 5:142327462-142327484 AGTGGGGCCTGCCCTGACTCTGG + Intergenic
998848658 5:146334472-146334494 CCTGGAGCCTGGCCAGCCTCCGG + Intronic
998856956 5:146403092-146403114 CCTGGGGCTCAGGCTGCCTCTGG + Intergenic
1000115592 5:158150477-158150499 TCTGGGGCTGACCCTGCCTATGG - Intergenic
1000298962 5:159937896-159937918 CCTGGGGTTTGCCTGGCCTCAGG + Intronic
1002104823 5:176874835-176874857 GCCGGGGCTTGCCCTACCTCTGG - Intronic
1002161463 5:177316205-177316227 CTTGGTGCTTGCCTTGCCTGGGG + Intergenic
1002199820 5:177521429-177521451 CATGGAGCTTGCCCTGCTTTGGG + Intronic
1002561434 5:180084812-180084834 GATGTGGCTTGCCCTGCCCCTGG + Intergenic
1002681724 5:180970238-180970260 CCTGGGGCATTCCCTGCTCCTGG + Intergenic
1002928931 6:1620378-1620400 GCTGGGGCATGCACTGCCACGGG - Intergenic
1003062649 6:2875349-2875371 CCCGGGGCCTGCCCTGACCCCGG - Intergenic
1003081732 6:3026669-3026691 CCAGGTGCTGACCCTGCCTCGGG + Intergenic
1003429116 6:6022751-6022773 CCTGGGGCTGGCTATGCCTGGGG - Intergenic
1005911589 6:30314786-30314808 CATGAAGCTAGCCCTGCCTCAGG + Intergenic
1006375254 6:33668338-33668360 CCTGGGGCTTTCCCTCCTTGGGG + Intronic
1006556637 6:34872648-34872670 ACTGGGGCTTGCCCTGTGTGTGG + Exonic
1007382978 6:41502680-41502702 CTTGGGGCCAGCCCTGCCTCTGG + Intergenic
1013793642 6:113860279-113860301 CCTGGGGCTTGGCCTCCTGCGGG - Exonic
1016199798 6:141394271-141394293 CCTGGGGTCTGCCCTGCATTGGG + Intergenic
1018061403 6:160092597-160092619 CCTGAGGCTTGCCATTCCTTCGG + Intronic
1018082624 6:160271416-160271438 CCTGGGCCTTGCTCTGACTTTGG + Intronic
1018456943 6:163961590-163961612 GCTGGGGTTTGCCCAGGCTCAGG + Intergenic
1018637015 6:165871686-165871708 CCTGGCACTTACCCTGCCTGGGG - Intronic
1018792716 6:167161786-167161808 CCTTGGGCCTGCTCTGCCTATGG - Intronic
1019412482 7:912328-912350 CCGCGGGCTGGCCCCGCCTCGGG - Intronic
1019634799 7:2069817-2069839 CCTGGAGTTGGCCCTGCCTCTGG - Intronic
1019757908 7:2787114-2787136 CCTGGGGCTCGCTCTTCCTCAGG + Intronic
1020008005 7:4792445-4792467 CCTGCCCCTTGCCCAGCCTCAGG + Intronic
1020642129 7:10768504-10768526 CCTGGGCCTGGCCCTGGCCCTGG - Intergenic
1021779639 7:24090237-24090259 CCTGGGGCCTGCTCTGTCTTGGG + Intergenic
1021848816 7:24788187-24788209 CCTGGCTCTTCCCCTGCCCCAGG + Intergenic
1024945406 7:54802995-54803017 CCTGGGCCTTCCCCTGCATTTGG + Intergenic
1026210973 7:68304753-68304775 CCTGTGACTCACCCTGCCTCGGG + Intergenic
1026467715 7:70668816-70668838 CCAGGGGCTGGCCCAGCCTGTGG + Intronic
1026800100 7:73394883-73394905 CCTGGGGTTTGCTCTGCCTATGG - Intergenic
1027136016 7:75624502-75624524 GGTGGGGCTTACCCTGCCTGGGG - Intronic
1029630368 7:101746443-101746465 CTGGGGGCTTGCCCTGTCTAAGG - Intergenic
1030275918 7:107721671-107721693 CATGTGGCTGGCTCTGCCTCTGG - Intergenic
1030756714 7:113294912-113294934 CCTGGGGATTACCCTGCCCCTGG + Intergenic
1031614069 7:123860216-123860238 CCTGAGGCTTCCCCTGCCATAGG + Intronic
1031923516 7:127618222-127618244 GCTGTGGTTTGCCCTGCCTCAGG - Intergenic
1033262201 7:139853623-139853645 GCTGGGGCTGCCCCTGCCTCTGG - Intronic
1034450980 7:151137200-151137222 CCTGGCGCCTGCCCTTCCCCTGG + Intronic
1034680626 7:152925292-152925314 CATGGGGCTTGCCCTGGGCCTGG + Intergenic
1034700540 7:153091894-153091916 CCTGAGGCTTGCACAGCCTGTGG + Intergenic
1035015669 7:155763853-155763875 CCAGCGGCTTCCCCAGCCTCCGG + Exonic
1035446716 7:158948081-158948103 CCTGGCGCTAGCGATGCCTCCGG + Intronic
1035556251 8:569335-569357 CAGGGGGCGTGCCCTGTCTCAGG + Intergenic
1035577394 8:716452-716474 GGTGGTGCCTGCCCTGCCTCAGG - Intronic
1039391136 8:37181569-37181591 CCTGGGGATTGTGCTGCCTTTGG - Intergenic
1039904395 8:41775399-41775421 CCTGGAGTTTGTCCAGCCTCTGG + Intronic
1039981556 8:42413029-42413051 CCTGAGGCCTGCCCTGGCCCCGG + Intergenic
1041942094 8:63399765-63399787 CCTGGCTGTTGCCATGCCTCTGG + Intergenic
1042228256 8:66532017-66532039 CCTGATGCTTGCTCTGCCTCTGG + Intergenic
1042784917 8:72536780-72536802 CCCGGGGCTTTCCCGGCCCCGGG + Intergenic
1045016718 8:98007004-98007026 CCTGTGGCTTGTTATGCCTCCGG + Intronic
1046751446 8:117931144-117931166 CCTCGGGGCTGCCCTGCCTTTGG + Intronic
1047799945 8:128298454-128298476 CCTGGGTCCTGCCCTGCCCAAGG - Intergenic
1048507423 8:135033976-135033998 CCTGTGGAGAGCCCTGCCTCTGG + Intergenic
1049082107 8:140451474-140451496 CTTGGGGCTTCCCCTGCCTCTGG - Intronic
1049235679 8:141511070-141511092 GCTGGGGCTTTTCCTGCCACAGG + Intergenic
1049379747 8:142306021-142306043 CCTGGCCCCTGCCCTCCCTCGGG - Intronic
1049414172 8:142487876-142487898 GATGGGGGCTGCCCTGCCTCAGG - Intronic
1049668393 8:143858976-143858998 CCTGGGTCTCGCCCTCCCCCTGG + Exonic
1049668812 8:143860584-143860606 CCTGGGTCTCGCCCTCCCCCTGG + Exonic
1049669227 8:143862186-143862208 CCTGGGTCTCGCCCTCCCCCTGG + Exonic
1049669639 8:143863779-143863801 CCTGGGTCTCGCCCTCCCCCTGG + Exonic
1049670054 8:143865387-143865409 CCTGGGTCTCGCCCTCCCCCTGG + Exonic
1049685098 8:143936186-143936208 GCTGGGACTGGCCATGCCTCGGG + Intronic
1050171550 9:2824716-2824738 CCTTGGGCGTGCCATGCCACAGG + Exonic
1050811992 9:9759789-9759811 CCTTGTGATTCCCCTGCCTCGGG + Intronic
1051467528 9:17397320-17397342 CCTGGGGACTGCTCTGCCTATGG - Intronic
1053691470 9:40589338-40589360 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1054273333 9:63048147-63048169 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1054302728 9:63390304-63390326 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1054401502 9:64716809-64716831 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1054435110 9:65201129-65201151 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1054455362 9:65427509-65427531 GCTGGGGCTCGCCAGGCCTCTGG - Intergenic
1054456679 9:65434743-65434765 TCTGGGGCTGGCCTTGCCCCTGG + Intergenic
1054495280 9:65820552-65820574 TCTGGCCCTTGCCCTGACTCTGG - Intergenic
1057334098 9:94142338-94142360 CCTGGAGCTTGTCCTGCCCCAGG + Intergenic
1059400952 9:114070588-114070610 CCTGGGCCCAGCTCTGCCTCAGG - Intronic
1060221348 9:121765687-121765709 ACTGGGGCCTGGCCTGCCCCAGG + Intronic
1060531184 9:124347838-124347860 CCTGGGGCTGGCGAGGCCTCCGG - Intronic
1060906610 9:127312960-127312982 CCTGGGGCTTGCCCTGCCTCTGG - Intronic
1061377963 9:130237181-130237203 CCTGGGCCTCGCCCTGACCCTGG - Exonic
1061431535 9:130534362-130534384 CCTGGGGCTCGGCCTCCTTCAGG + Intergenic
1061478174 9:130883079-130883101 GCTGGGACTTGCCTGGCCTCAGG - Intronic
1061486997 9:130925050-130925072 CCTGTGGCCTCCCCAGCCTCAGG - Intronic
1061742051 9:132714424-132714446 CCTGATGCTTGCCCAGCTTCAGG + Intergenic
1061801132 9:133113985-133114007 CCTGGGGATTGGCCTGCCTGGGG - Intronic
1062125071 9:134855785-134855807 CGTGGAGCCTGCCCTGCCTTGGG - Intergenic
1062289698 9:135788995-135789017 CCCAGGCCTGGCCCTGCCTCCGG - Intronic
1062372929 9:136249400-136249422 CCTGGCCCTGGCCCTGCCCCGGG - Intergenic
1062382465 9:136293052-136293074 CCCAGGGCTGGCCCTACCTCCGG - Intronic
1062453176 9:136623987-136624009 GCTGGGGCTTGTCCTGGCCCTGG + Intergenic
1062522441 9:136963912-136963934 CCAGGGGCTTCCGCTGGCTCCGG - Intergenic
1062534019 9:137013701-137013723 CCCGGTGCGTGCCCAGCCTCAGG + Intronic
1062630193 9:137459861-137459883 ACTGGGGACTGCCCAGCCTCAGG + Intergenic
1062736791 9:138141916-138141938 CTTGGGGCTCTCACTGCCTCTGG + Intergenic
1203622148 Un_KI270749v1:135529-135551 TCTGGCCCTTGCCCTGACTCTGG + Intergenic
1186857888 X:13643110-13643132 ACTGGGGCTTTCCCAGACTCAGG - Intergenic
1187143821 X:16619575-16619597 CCTGGAGCCTGTCCAGCCTCTGG + Intronic
1187557786 X:20368657-20368679 CCTGGAACCTGTCCTGCCTCAGG - Intergenic
1189330371 X:40141128-40141150 CCTGGGGCTTGGGCTTGCTCTGG + Intronic
1190641414 X:52484496-52484518 TAAGGGGCTTGCCCTGCCTTGGG - Intergenic
1190646258 X:52528369-52528391 TAAGGGGCTTGCCCTGCCTTGGG + Intergenic
1191863920 X:65688772-65688794 CTTGGGGCCTGGCCTGACTCTGG + Intronic
1192304381 X:69943941-69943963 CCTGTGGCTACCACTGCCTCAGG + Intronic
1193834698 X:86327318-86327340 TCTGGTGCTTTACCTGCCTCTGG + Intronic
1194744657 X:97615139-97615161 CCTTGGGCCTGGCCTGCCCCAGG + Intergenic
1196682880 X:118486661-118486683 CCTCAGGCTTGCCCGGCTTCTGG + Intergenic
1196742659 X:119039081-119039103 CCTCAGGCTTGCCCGGCTTCTGG + Intergenic
1197969145 X:132096691-132096713 ACAGGGTCTTGCTCTGCCTCAGG - Intronic
1198251838 X:134886670-134886692 CCTGGGGTTTGAGCTGGCTCTGG - Intergenic
1198506806 X:137309220-137309242 CCTGGGGCTATGCCTCCCTCTGG - Intergenic
1199548299 X:149031288-149031310 CCTCTGTCTTGCACTGCCTCTGG - Intergenic
1199761881 X:150911228-150911250 CCTGTGCCTCGCCCTGCCTCTGG + Intergenic
1199790598 X:151151958-151151980 GCCCGGGCTTGCCCTGCCACAGG + Intergenic
1200065430 X:153502279-153502301 CCTGGAGCTTGCCAGGGCTCTGG + Intronic
1200139003 X:153888319-153888341 CCTGGGACTTGCTCTGCCCTTGG - Intronic
1200233815 X:154458783-154458805 CGTGGGGCTGCCCCTTCCTCAGG + Intronic
1200399014 X:156007990-156008012 CTTGGGGCTCTCACTGCCTCTGG + Intronic
1201190161 Y:11438010-11438032 TCTGGTCCTTGCCCTGACTCTGG + Intergenic
1202583467 Y:26403917-26403939 TCTGGTCCTTGCCCTGACTCTGG - Intergenic