ID: 1060906616

View in Genome Browser
Species Human (GRCh38)
Location 9:127312976-127312998
Sequence CTCTGAATCCCCCAAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906616_1060906620 -6 Left 1060906616 9:127312976-127312998 CCCCAGGCTTGGGGGATTCAGAG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906616_1060906622 1 Left 1060906616 9:127312976-127312998 CCCCAGGCTTGGGGGATTCAGAG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1060906622 9:127313000-127313022 CCCAGTAATGTCAAGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906616 Original CRISPR CTCTGAATCCCCCAAGCCTG GGG (reversed) Intronic
900398151 1:2461772-2461794 TCCTGGTTCCCCCAAGCCTGGGG - Intronic
900707267 1:4088667-4088689 CTCTGAAGCCCCCCAGTTTGGGG - Intergenic
901019231 1:6247568-6247590 CTCTAAATACTCCAATCCTGCGG - Exonic
901322593 1:8348795-8348817 CGCTGCATCCCCCAAGGCTTGGG - Intergenic
901492529 1:9603687-9603709 CTGTGAATCTGCCACGCCTGGGG + Intronic
901843300 1:11966711-11966733 GTCTGCTTCCCCCGAGCCTGGGG + Intronic
903299959 1:22371775-22371797 TGCTGAATCCCCCAGCCCTGAGG + Intergenic
904285152 1:29449214-29449236 CTCTGAGCCCCCCCACCCTGCGG - Intergenic
904536729 1:31204371-31204393 CCCAGAATCCTCCATGCCTGAGG + Intronic
904611696 1:31729342-31729364 ATCTGGATCTCCCAGGCCTGTGG + Intronic
908219253 1:61987585-61987607 CTCTCAACCCCCCATCCCTGGGG + Intronic
909163894 1:72192119-72192141 CTATGAATATCCCAAGCATGTGG - Intronic
909674877 1:78227695-78227717 CTTTTAATCCCACAAGTCTGTGG + Intergenic
910851017 1:91649907-91649929 CTCTTTTTTCCCCAAGCCTGAGG - Intergenic
912414832 1:109500921-109500943 CTCTGCATCTCCAATGCCTGAGG - Intronic
915164156 1:153939345-153939367 CTGTGGCTACCCCAAGCCTGGGG + Intronic
915673416 1:157509609-157509631 CTCTCACACCCCAAAGCCTGAGG + Intergenic
916080438 1:161228847-161228869 CTCTGCATCCCCCATTCCTCAGG - Intronic
916477860 1:165186770-165186792 CTCTAAATCCCACACTCCTGAGG - Intergenic
917796831 1:178538731-178538753 CTCAGCTTCCCCTAAGCCTGGGG - Intronic
919915801 1:202138337-202138359 CTCTGCACCCCCCAAGCTTCTGG + Intronic
923519704 1:234726026-234726048 CTCTGGGGACCCCAAGCCTGTGG - Intergenic
1063208913 10:3861023-3861045 CTCAGAGTCCTCCCAGCCTGTGG + Intergenic
1064966977 10:21024446-21024468 ATGTGAATCCCCCAATCCTCAGG - Intronic
1065885877 10:30076529-30076551 ATCTTAATTCCCCAAGACTGTGG + Intronic
1068860703 10:61845112-61845134 CCCTGATTCCACCAAGCCTGCGG + Intergenic
1069719280 10:70539449-70539471 CCCTGACCCCCCCAAGCCTCAGG - Intronic
1070769064 10:79071662-79071684 TTGTGAATACCCCAAGCCTTGGG + Intronic
1072102298 10:92240206-92240228 CTCAGAGACCCCCAAGCCGGAGG - Exonic
1073468667 10:103709213-103709235 CTCCAAATGCTCCAAGCCTGGGG + Intronic
1073901334 10:108224746-108224768 CTCTGAATTCACTAAGCCAGAGG - Intergenic
1075278930 10:121122238-121122260 CTCAGAAGCCCCCAAGCCAGCGG + Intergenic
1076408691 10:130230870-130230892 CCCTGAATCCTCTCAGCCTGGGG + Intergenic
1076476506 10:130757460-130757482 TTCTGAGGCCACCAAGCCTGTGG - Intergenic
1077026284 11:441462-441484 CTCTGCAGCTCCCAACCCTGGGG + Intronic
1077297705 11:1833908-1833930 CTCTGCAGCCCCCCAGTCTGGGG - Intronic
1077631893 11:3816687-3816709 CTCTGAATGATCCAAGCCTCAGG - Intronic
1078547144 11:12254630-12254652 CTGTGAATGCCCCAGGGCTGGGG + Intronic
1079645684 11:22861413-22861435 CTCTGAATCCACCAACACTCAGG + Intergenic
1080612368 11:33915569-33915591 CGCTGAATCCCCATTGCCTGGGG - Intergenic
1083194724 11:61078933-61078955 CTCAGAATCCCACAAGGCAGAGG - Intergenic
1083952880 11:65966529-65966551 CTCCGAATACCTCACGCCTGAGG + Exonic
1084453062 11:69251521-69251543 CTCTGAAACTCCAAAGCCTGGGG - Intergenic
1084515476 11:69636045-69636067 CTCTGACTTATCCAAGCCTGGGG + Intergenic
1084555712 11:69874701-69874723 CTTTGAACCCCACAACCCTGTGG + Intergenic
1084791319 11:71476965-71476987 CTCTGAATACAGCAGGCCTGTGG - Intronic
1085309807 11:75509485-75509507 ATATTAATCCCCCAAGCCTCTGG - Intronic
1089840457 11:121412920-121412942 CTCTGAATCCTCCAGAACTGGGG - Intergenic
1090271641 11:125390009-125390031 CTCTGAATGCCGCTGGCCTGAGG - Intronic
1090396480 11:126422684-126422706 CTTTGTAGCCCCTAAGCCTGAGG - Intronic
1091294174 11:134461133-134461155 GTCTGAGTCTCCCAAGGCTGTGG + Intergenic
1091876710 12:3940789-3940811 CTGTGAATCCTCAGAGCCTGTGG - Intergenic
1093141853 12:15518207-15518229 CTCTGAAGCCACCAAGCCTTGGG + Intronic
1093404910 12:18792408-18792430 TTCCTAATCCCCCAAACCTGTGG - Intergenic
1097306156 12:58071380-58071402 CTCTTAATCCACTAATCCTGTGG - Intergenic
1099240349 12:80130987-80131009 CTCTGACTCCCCAAACCCTTTGG - Intergenic
1101433941 12:104649101-104649123 CTCTGCTTCCCCCATCCCTGAGG - Intronic
1103393106 12:120588471-120588493 CTCTGAACCCTCCAAGCCCAGGG - Intergenic
1104079054 12:125414544-125414566 CTCTGCTTCCCAGAAGCCTGTGG - Intronic
1104942010 12:132399619-132399641 CACTGAAGCCCCAAATCCTGTGG - Intergenic
1106994935 13:35470721-35470743 CTCCGAATCCCCCAACGCTCGGG - Intronic
1107813393 13:44221107-44221129 CTGTGAATCCCCAGAGCCAGTGG + Intergenic
1108577088 13:51799923-51799945 CTCTGACTGCCCCGATCCTGGGG + Intronic
1108816679 13:54301232-54301254 TACTAAATTCCCCAAGCCTGTGG + Intergenic
1110072637 13:71196144-71196166 CTCAGAATCCCCCATGCCTGTGG - Intergenic
1113317115 13:109192717-109192739 CTCAGAATCCTCCAAGACTCAGG + Intronic
1113636173 13:111920515-111920537 TCCAGAAGCCCCCAAGCCTGCGG + Intergenic
1114554352 14:23552985-23553007 CTCTCAATACCTCAAGCATGAGG + Intronic
1114666235 14:24378623-24378645 CTCTGGATCCTCCACTCCTGGGG + Exonic
1115425758 14:33257276-33257298 CTGAGACTCCCCTAAGCCTGAGG - Intronic
1116757284 14:48963475-48963497 CTCTGAATCTCCCAGGCTTCAGG + Intergenic
1118863926 14:69687495-69687517 CTCTTAACTCCCCAAACCTGGGG - Intronic
1120665376 14:87300247-87300269 CTCACAATCCCACAAGGCTGGGG - Intergenic
1120667973 14:87329736-87329758 CTCTGAATCCCACACAACTGGGG - Intergenic
1120839784 14:89075342-89075364 CTCTGGATGCACCAACCCTGAGG + Intergenic
1121049708 14:90812454-90812476 CTCTGAGTCCCCCAAACCCCTGG + Intronic
1121455399 14:94035650-94035672 CCCTGAATCCCCCATGTCGGGGG + Intronic
1121601526 14:95208256-95208278 TTCTGAGTCCCCTAAGCCAGGGG + Intronic
1122153271 14:99735933-99735955 CTCTGACTTCCCCAGCCCTGAGG + Intergenic
1122264064 14:100538557-100538579 CCCTGATGCCCCCAAACCTGTGG - Exonic
1122967400 14:105137789-105137811 CCCTGAATCCACCAGGGCTGGGG + Intergenic
1202904344 14_GL000194v1_random:59824-59846 ATCGGAGTCCCCCAAACCTGGGG + Intergenic
1124721744 15:32116659-32116681 GTCTGAATCCCGCAACTCTGCGG + Intronic
1125424834 15:39538198-39538220 TTCTGAATCCCCAAAGGCTTTGG - Intergenic
1125434558 15:39630971-39630993 CTCTGTGTCTCCCAAACCTGGGG + Intronic
1125686198 15:41564720-41564742 CCTTGTATCTCCCAAGCCTGAGG + Intronic
1125892855 15:43279060-43279082 CTCTGACTCACCCAATCCAGGGG - Intronic
1126562130 15:50055488-50055510 CTATGAATCCCACAAGCCCCAGG + Intronic
1129394028 15:75234620-75234642 CTCTGGGAGCCCCAAGCCTGGGG + Intergenic
1129680950 15:77658047-77658069 CTCTGGATGCCCCCAACCTGGGG + Intronic
1130413754 15:83670412-83670434 CTCTTAATCCCCTAAGTCAGTGG + Intronic
1137253659 16:46758089-46758111 CACAGAGTCCCCAAAGCCTGGGG + Intronic
1137609301 16:49808472-49808494 ACCTGAATCCCACAAGCCTCCGG + Intronic
1138657959 16:58501484-58501506 CTCTGAGGCCCCCAACCCTCAGG - Intronic
1140518016 16:75558372-75558394 CTCTGAATCTGCCAATTCTGTGG - Intergenic
1141679203 16:85534521-85534543 CTCAGAGTCCCTCCAGCCTGTGG + Intergenic
1141731435 16:85825528-85825550 CTCAGCATCCCCCAGGCCAGGGG + Intergenic
1141896794 16:86963509-86963531 TGTTGAAGCCCCCAAGCCTGTGG - Intergenic
1141965377 16:87438745-87438767 CTGTGAATGCCCCAAGCAGGAGG - Intronic
1142030425 16:87835813-87835835 CTCTGTGTTCCCGAAGCCTGGGG - Intronic
1203015440 16_KI270728v1_random:351841-351863 CTCTCACACCACCAAGCCTGCGG - Intergenic
1203033775 16_KI270728v1_random:624999-625021 CTCTCACACCACCAAGCCTGCGG - Intergenic
1142978076 17:3656954-3656976 CTCAGAGCCCCCCAAGTCTGGGG + Intronic
1143139294 17:4731957-4731979 CCCTGGATCACCCAAGCCTGAGG - Intronic
1143367959 17:6420708-6420730 ATTTGAATCCCCAGAGCCTGTGG + Intronic
1143908041 17:10225470-10225492 CTCTGTCTCTCCCCAGCCTGTGG - Intergenic
1143939950 17:10530048-10530070 CTCTGCATCAGCCAAGCCTTCGG + Exonic
1145260163 17:21349800-21349822 CTGTGAGGGCCCCAAGCCTGTGG - Intergenic
1145316460 17:21738138-21738160 CTGTGAGGGCCCCAAGCCTGTGG + Intergenic
1148830497 17:50427602-50427624 CTCAGAGTCCTCCCAGCCTGAGG - Intronic
1151561489 17:74872300-74872322 ATCTGAACCCCCAAAGGCTGTGG + Intronic
1152070798 17:78132698-78132720 CTCTATAACCCCCAACCCTGGGG - Intronic
1153825261 18:8868893-8868915 TTCTAAATCCCCCAAGTCAGAGG - Intergenic
1154033226 18:10772323-10772345 CTCTCAATCCCTCATGTCTGTGG - Intronic
1158542140 18:58366791-58366813 CTCTGAATCCTCCAAGGGTTGGG + Intronic
1159935200 18:74360238-74360260 CTCTCAAATCCCCAAGCCCGTGG - Intergenic
1160385251 18:78492941-78492963 ATCTGACGCCCCCACGCCTGGGG + Intergenic
1160843379 19:1156207-1156229 CTCTGAGCCCCCCACGTCTGTGG + Intronic
1160928695 19:1559598-1559620 CTCTGCTTCCCCAGAGCCTGAGG - Intronic
1161041826 19:2114530-2114552 CTCTGAAGTCTCCAGGCCTGGGG - Intronic
1163687434 19:18719740-18719762 CTCAGAATCCCAGAGGCCTGCGG + Intronic
1165003899 19:32788757-32788779 CTCTGAGTGTGCCAAGCCTGTGG + Intronic
1165894066 19:39131154-39131176 CACTGAAGCCCCAAGGCCTGGGG - Intronic
1166253469 19:41586568-41586590 CCCTGAAGCCCCCAGCCCTGGGG + Intronic
1166930186 19:46297480-46297502 CTCTGAACCCCCCAAAATTGAGG + Intronic
925445754 2:3925338-3925360 ATCCCAATCCCCCAAACCTGTGG - Intergenic
925750954 2:7090272-7090294 CTCAGAAGCCGCCCAGCCTGCGG - Intergenic
927089827 2:19701853-19701875 ATCTGGAGCCCCCATGCCTGGGG + Intergenic
927213721 2:20654040-20654062 CTCTGTAGCCCCCAGGCCTGGGG - Intergenic
927872402 2:26631916-26631938 CCCTGACTGCCCCAGGCCTGAGG - Intronic
929044899 2:37779862-37779884 CACTGAGTCCCCAGAGCCTGTGG + Intergenic
930022601 2:47010544-47010566 GTCTGAGTCCCTGAAGCCTGGGG + Intronic
931141941 2:59469114-59469136 CTCTGCATCCAGCAAGTCTGTGG - Intergenic
932338135 2:70942721-70942743 CTCTGCATCCTGCCAGCCTGTGG + Intronic
933285542 2:80381092-80381114 CCCTGATTCACCTAAGCCTGAGG + Intronic
933627049 2:84612842-84612864 GTCCTAATCCCCCAAACCTGTGG - Intronic
933841926 2:86294133-86294155 CCCTATATCCCCCCAGCCTGTGG - Intronic
934307837 2:91841104-91841126 CTCTCACACCACCAAGCCTGCGG - Intergenic
937121199 2:119440985-119441007 CTCTGTATGCCCAGAGCCTGGGG + Intronic
938383316 2:130848597-130848619 CTCTGAATCCCCAGCTCCTGAGG + Intronic
943365794 2:186966631-186966653 CTCTGAGGCCCCCAGGCCTAAGG + Intergenic
946128086 2:217581904-217581926 CTCAGCATCCCTCAAGGCTGGGG + Intronic
947378401 2:229521030-229521052 CTCTGCTTCCGCCAAGGCTGGGG - Intronic
948759608 2:240182599-240182621 GACTGAGTCCCCTAAGCCTGTGG - Intergenic
948907972 2:240988890-240988912 CTCTGCATACCCCAGGCCTGGGG + Intronic
1170411421 20:16096269-16096291 CTCCCAATCCCCCAACACTGAGG - Intergenic
1172192791 20:33071979-33072001 CTCAGCCTCCCCCAAGCCTGAGG - Intronic
1172390796 20:34563718-34563740 CTCTGCATCTCCTAAGCCTAGGG + Intronic
1174500847 20:50982869-50982891 ATCTGAAATCTCCAAGCCTGAGG - Intergenic
1175001499 20:55634028-55634050 CTGTGCCTCCTCCAAGCCTGGGG + Intergenic
1176623712 21:9074591-9074613 ATCAGCATCCCCCAAACCTGGGG + Intergenic
1178380585 21:32104315-32104337 GTTTGAAGCCCCCAAGTCTGTGG + Intergenic
1182300845 22:29335992-29336014 CTCTCAGTCGCCCAAGGCTGGGG + Intronic
1182427652 22:30283432-30283454 CTCTGACTCACACAGGCCTGAGG - Intergenic
1184396951 22:44247909-44247931 CCTTGAAACCACCAAGCCTGTGG + Exonic
1184569051 22:45310484-45310506 CTCAGAAGCCCCCAGGCCCGGGG + Intronic
1185044477 22:48522350-48522372 GTCTGCATCCCCCCAGCCTGTGG - Intronic
950469886 3:13177937-13177959 CCCTGCATCCCCTAGGCCTGGGG + Intergenic
950475135 3:13210234-13210256 CACTGGGTCCCCCCAGCCTGGGG - Intergenic
950564380 3:13758306-13758328 CTCAGACTCACCCATGCCTGTGG - Intergenic
950849680 3:16050854-16050876 CACGGATTCCCCCAGGCCTGCGG - Intergenic
951151523 3:19295901-19295923 CTCAAAATCCCCCAAAACTGGGG - Intronic
952683640 3:36124266-36124288 CACTGAATTCCCTAAGTCTGTGG + Intergenic
952898747 3:38096054-38096076 CTCTCACTCCCCAAAGCCTGCGG - Intronic
955342091 3:58132802-58132824 CACTGGCTCCACCAAGCCTGAGG - Exonic
955406831 3:58630914-58630936 TCCTGGATCCCCCAAGGCTGGGG + Intergenic
957221888 3:77392699-77392721 CTCAGAACCCCTCAAGCCTGAGG - Intronic
960866383 3:122204235-122204257 CTCTTCATCCCCCAAGCCTCTGG + Intronic
961058302 3:123807630-123807652 ATTTGAATCCCTCATGCCTGAGG + Intronic
961788327 3:129360623-129360645 CACTGGGTCCCCCCAGCCTGGGG + Intergenic
962257723 3:133883885-133883907 CTCTGTTTCCCCCAACCCTGGGG - Intronic
967266791 3:187698614-187698636 CTCTGAAGCCTCCAAGCCGAGGG - Exonic
967882368 3:194310813-194310835 TTCTGGCTCCCCCAAGCCAGTGG + Intergenic
968008833 3:195260134-195260156 GGCTGCAGCCCCCAAGCCTGAGG - Intronic
968994176 4:3935381-3935403 CTCTGAGTCCTCCATTCCTGAGG + Intergenic
969056322 4:4405032-4405054 CTCTGAGTCCCCCCAGTTTGTGG - Intronic
969705493 4:8789160-8789182 CTCTCCCTCCCCCCAGCCTGCGG - Intergenic
978379531 4:108112329-108112351 CGCTGCATGCCCCATGCCTGGGG + Intronic
978425470 4:108577482-108577504 CACTGACTCTCCCAAGCCAGAGG - Intergenic
979174947 4:117651690-117651712 CTATGGGTCCCCCAAGCCAGGGG + Intergenic
983197409 4:164822853-164822875 CTATGAGTCCTCCAAGGCTGTGG + Intergenic
984182508 4:176501392-176501414 CTCTGAGTTCACCAAGCCTTAGG + Intergenic
984862997 4:184256506-184256528 CTCTGCAGCCCCCAAGTCTGTGG - Intergenic
985498527 5:225329-225351 CTCTGAATCCCCCCAGCGGGTGG + Intronic
985585728 5:732801-732823 CTCTAATTCCCCTGAGCCTGGGG + Intronic
985602011 5:840384-840406 CCCTGAGCCCCCCACGCCTGGGG - Intronic
985689337 5:1298468-1298490 TCCTGATTCCCCCAAACCTGTGG - Intergenic
985729203 5:1537738-1537760 TACAGAATCCCCCAACCCTGAGG - Intergenic
986301625 5:6482385-6482407 CTCTGACTCCCGGAAGCCTCAGG + Intronic
986826058 5:11524115-11524137 CTGTGAAGCCCTAAAGCCTGGGG + Intronic
990171260 5:53052625-53052647 CTCTTCATCCCCCAACCCTGTGG + Intronic
990428556 5:55712364-55712386 TTCTGAATGCGCCAAGCCCGCGG + Exonic
990820901 5:59839226-59839248 GTCTGAATGCCACAGGCCTGGGG + Intronic
992210600 5:74475722-74475744 CTCTAATTCCCACAAGCCTTAGG - Intergenic
994099690 5:95879541-95879563 CTGTGTGTCCCCCAAGCTTGAGG - Intergenic
994150225 5:96439435-96439457 CTCAGAATTCCCCATGACTGAGG + Intergenic
994446309 5:99879167-99879189 CTCACACTCCCCCAAGCCTAAGG - Intergenic
994617382 5:102121514-102121536 CTCTGAATGCCACCAGCGTGAGG + Intergenic
997065821 5:130557126-130557148 CCCTGCAACCCCCAAGCTTGAGG + Intergenic
997615530 5:135243764-135243786 CTCCAAATTCCCCAAACCTGAGG - Intronic
999101061 5:149026690-149026712 CTCTGTGTCCCCAAACCCTGAGG - Exonic
999580254 5:153030669-153030691 CTCCAAATCCTACAAGCCTGAGG + Intergenic
1002255896 5:177958492-177958514 CTCTGCATCATCCAACCCTGTGG - Intergenic
1002368127 5:178729248-178729270 CTCCGTAAGCCCCAAGCCTGTGG - Intronic
1002385199 5:178860800-178860822 CTCCGTAAGCCCCAAGCCTGTGG + Intronic
1003047944 6:2752146-2752168 CTCTGGCTCACTCAAGCCTGTGG - Intergenic
1004542139 6:16561133-16561155 CTCTGAATCCCTGATGCCTTGGG + Intronic
1005534017 6:26736387-26736409 CTCTGAATCCTCAAAGCCTTCGG - Intergenic
1005534505 6:26742292-26742314 TTCTGAATCCTCAAAGCCTTCGG + Intergenic
1005536778 6:26765267-26765289 CTCTGAATCCTCAAAGCCTTCGG + Intergenic
1006871782 6:37258032-37258054 CCCTGAATCCCGCGGGCCTGGGG + Intronic
1007662082 6:43492884-43492906 CTCTGAAGTCTGCAAGCCTGTGG - Intronic
1007927053 6:45658246-45658268 CACTGACACCCCCCAGCCTGGGG - Intronic
1007954837 6:45907634-45907656 CTGTGAATCCACCTAGTCTGGGG + Intronic
1009011950 6:57853740-57853762 CTCTGCATCCCCAGAGCCTAGGG - Intergenic
1015281323 6:131437363-131437385 CTCTGAATCCCCCTCATCTGGGG - Intergenic
1018913622 6:168119019-168119041 CTCTGACTCCCTTAGGCCTGTGG + Intergenic
1023298292 7:38739746-38739768 CTGTGAATCCCCCAACCAAGGGG - Intronic
1023728499 7:43168027-43168049 CTCTAAATCCCCATAGCCCGTGG + Intronic
1024559717 7:50632711-50632733 CTCACACTCCCCCAACCCTGTGG - Intronic
1024787380 7:52923759-52923781 CACTTAATCGCCCAAGCCTATGG + Intergenic
1026682129 7:72474977-72474999 CTTTGTCCCCCCCAAGCCTGGGG + Intergenic
1028068037 7:86413008-86413030 CTCTGAAACTTCTAAGCCTGTGG + Intergenic
1029456921 7:100676162-100676184 CCCTGCATCCCCCAGGCCTCGGG + Exonic
1029513777 7:101013213-101013235 TACTCAATCCCCCAACCCTGTGG - Intronic
1035029526 7:155848405-155848427 CTCTGGTGCCCCCAGGCCTGGGG + Intergenic
1035392898 7:158517278-158517300 CTCTGCCTCCTCCAAGGCTGTGG - Intronic
1036489305 8:9210315-9210337 TTTTGAATCCCCCATGACTGGGG + Intergenic
1037572638 8:20171610-20171632 CTCTGAATTCCCAGAGCCTCAGG - Intronic
1039071341 8:33651908-33651930 CTCCTAAGCCTCCAAGCCTGTGG - Intergenic
1039834793 8:41247880-41247902 CGCTGAGTCCCCCAACCCTGCGG + Intergenic
1041113196 8:54507000-54507022 GTCTGAGCCCCCCAAGCCTGAGG + Intergenic
1042184255 8:66121274-66121296 TTCTGAGTCCCACCAGCCTGGGG - Intergenic
1047828493 8:128605400-128605422 CTCTGATTCCCCCATCCCAGAGG - Intergenic
1049400832 8:142426519-142426541 CTCTGGGTCCCCCATGCCTCAGG + Intergenic
1049757381 8:144316747-144316769 CCCTGAAGCCCCCAGCCCTGTGG - Intronic
1051474548 9:17490569-17490591 CTCTATATCCCCCCAGCCTCTGG - Intronic
1053381927 9:37655809-37655831 CTCTTAATCCCCCTAGCCTCAGG + Intronic
1055787147 9:79883480-79883502 CTCTGCATCCCACAACCATGGGG - Intergenic
1055903374 9:81266076-81266098 CTCAGGATCCCCCAAGCCCTTGG - Intergenic
1056776448 9:89516396-89516418 CTCTCCTTCCTCCAAGCCTGTGG - Intergenic
1057726609 9:97572587-97572609 CCCTGCCTCCCCCCAGCCTGGGG - Intronic
1060790290 9:126481453-126481475 CTCTGCCACCCCCCAGCCTGAGG + Intronic
1060906616 9:127312976-127312998 CTCTGAATCCCCCAAGCCTGGGG - Intronic
1062502020 9:136855742-136855764 CTTTGAGTCCCCCGAGGCTGGGG + Exonic
1062522665 9:136964754-136964776 CACTGAAACCCCCGAGCTTGCGG - Intergenic
1203563208 Un_KI270744v1:74461-74483 ATCGGAGTCCCCCAAACCTGGGG - Intergenic
1190873497 X:54444198-54444220 ATCTGTATCCCCCAACCCAGGGG - Intronic
1194804214 X:98307293-98307315 CTCAGAATCCTCCCAACCTGAGG - Intergenic
1196311238 X:114168336-114168358 ATCTGAATCCTACATGCCTGGGG - Intergenic
1196859039 X:120010235-120010257 CACTGAAGCCTCCAACCCTGGGG - Intergenic
1200224452 X:154409418-154409440 CTGTGAGTCACTCAAGCCTGGGG + Exonic
1201160223 Y:11160033-11160055 ATCGGCATCCCCCAAACCTGGGG + Intergenic
1201851010 Y:18479790-18479812 CTCTAAATCCCTCAAGTCTCAGG - Intergenic
1201882309 Y:18840588-18840610 CTCTAAATCCCTCAAGTCTCAGG + Intergenic
1202039263 Y:20665676-20665698 ATCTGGATCCTCCAACCCTGTGG + Intergenic