ID: 1060906617

View in Genome Browser
Species Human (GRCh38)
Location 9:127312977-127312999
Sequence CCTCTGAATCCCCCAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906617_1060906620 -7 Left 1060906617 9:127312977-127312999 CCCAGGCTTGGGGGATTCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 252
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906617_1060906622 0 Left 1060906617 9:127312977-127312999 CCCAGGCTTGGGGGATTCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 252
Right 1060906622 9:127313000-127313022 CCCAGTAATGTCAAGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906617 Original CRISPR CCTCTGAATCCCCCAAGCCT GGG (reversed) Intronic
900398152 1:2461773-2461795 CTCCTGGTTCCCCCAAGCCTGGG - Intronic
901322594 1:8348796-8348818 CCGCTGCATCCCCCAAGGCTTGG - Intergenic
902163334 1:14550164-14550186 CCTCTGTATCCCCAGATCCTAGG - Intergenic
902376728 1:16033350-16033372 CCTCTGAATCCCCCCAGGTTTGG - Intronic
902381892 1:16056608-16056630 CCTCTGAATCCCCCCAGGTTTGG - Intronic
902471160 1:16648205-16648227 GCTCTGTAGCCCCCAAGCTTGGG - Intergenic
902487643 1:16759240-16759262 GCTCTGTAGCCCCCAAGCTTGGG + Intronic
902561470 1:17280208-17280230 CCTCTGACTTTCCCAGGCCTTGG - Intronic
904491680 1:30864385-30864407 CCTCCCCACCCCCCAAGCCTTGG - Intergenic
904950864 1:34237626-34237648 CCTCTGGATCCAGAAAGCCTAGG - Intergenic
905037684 1:34928654-34928676 ACTCTGAATCACCCACACCTGGG - Intronic
905425356 1:37879304-37879326 CCTCTGAATTCCCACTGCCTGGG + Intronic
906656690 1:47553408-47553430 CTTCTGTATCCCCCAAGCCTAGG + Intergenic
907299054 1:53474802-53474824 CCTTTGCTTCTCCCAAGCCTAGG + Intergenic
907299155 1:53475681-53475703 CCTCTCAATCCCCCAAACAGCGG - Intergenic
908219252 1:61987584-61987606 CCTCTCAACCCCCCATCCCTGGG + Intronic
910930534 1:92438902-92438924 GCTCTGAATCCCTCAGGCCTAGG + Intergenic
913095763 1:115513981-115514003 CCTCGGAATGCCCGCAGCCTGGG - Intergenic
913699440 1:121360524-121360546 CCCCTGAACCCCCAGAGCCTCGG + Intronic
914138105 1:144919512-144919534 CCCCTGAACCCCCAGAGCCTCGG - Intronic
915167635 1:153957502-153957524 CCTCTGAAGCCCCCCTGGCTTGG - Intronic
915536779 1:156541159-156541181 CCTCTGATTCACCCCAGCCTGGG + Intronic
915545805 1:156596870-156596892 ACTCTGAATCCCCAACTCCTTGG - Intronic
920026649 1:203003365-203003387 CCTGTGAAACCCTAAAGCCTGGG - Intergenic
920486849 1:206379232-206379254 CCCCTGAACCCCCAGAGCCTCGG + Intronic
922046436 1:221950231-221950253 CCTCGGAATGCCCGCAGCCTAGG + Intergenic
922368513 1:224887742-224887764 CCTCAGAATGCCCACAGCCTGGG + Intergenic
1063586963 10:7361118-7361140 TCTCTGCTTCCCTCAAGCCTGGG + Intronic
1066021898 10:31312248-31312270 CGTCCTAATCCCCCAAACCTGGG + Intergenic
1066199394 10:33130561-33130583 TCTATGAATCCCCCAAGACCTGG - Intergenic
1067082254 10:43218382-43218404 GCTCTGAGTCCCCCATGCCTGGG - Intronic
1068503059 10:57864615-57864637 CTTGAGAATCCCCCAATCCTGGG - Intergenic
1069082907 10:64107222-64107244 CCTCAAAATGCCCTAAGCCTCGG - Intergenic
1070682425 10:78457711-78457733 CCACTGAAACCCCAAAGCCCAGG - Intergenic
1070769063 10:79071661-79071683 TTTGTGAATACCCCAAGCCTTGG + Intronic
1073223159 10:101893467-101893489 CCTCTGTATTCTCCAAACCTAGG - Intronic
1073720638 10:106167378-106167400 CCACTTAATCCCCCAAACATGGG - Intergenic
1075077806 10:119362802-119362824 CATCTGTATCTCCCAAGCCACGG + Intronic
1076253009 10:128997769-128997791 CGTCTGCCTCCCCAAAGCCTGGG + Intergenic
1076318719 10:129563253-129563275 CCTCTGCATCCCGCAGGCCTGGG - Intronic
1076469737 10:130710129-130710151 CCTCTGCAGACCCCAAGCCCAGG - Intergenic
1077297706 11:1833909-1833931 CCTCTGCAGCCCCCCAGTCTGGG - Intronic
1077631866 11:3816573-3816595 CCTCAGATTCCCCCAAACCTTGG + Intronic
1078489679 11:11757438-11757460 CCTCTATAATCCCCAAGCCTAGG + Intergenic
1079256269 11:18834172-18834194 CCACTGCACCCCCCAAGTCTGGG - Intergenic
1079503217 11:21125852-21125874 GCTCTGAATCAGCCAGGCCTGGG + Intronic
1080612369 11:33915570-33915592 CCGCTGAATCCCCATTGCCTGGG - Intergenic
1081850715 11:46273335-46273357 CCTCTGATGGCCCCAGGCCTTGG + Intergenic
1083668139 11:64286205-64286227 CCTCTGCATCCCCCCATCCTTGG + Intronic
1083727874 11:64637759-64637781 CCTCCAAATCCCCCAGGTCTAGG + Intronic
1084453063 11:69251522-69251544 TCTCTGAAACTCCAAAGCCTGGG - Intergenic
1084515475 11:69636044-69636066 CCTCTGACTTATCCAAGCCTGGG + Intergenic
1085270385 11:75266665-75266687 GTTCTGAATCCCCCAAGAATAGG + Intronic
1085793532 11:79516680-79516702 CCTGTGAGTCCCCCCACCCTAGG - Intergenic
1092122322 12:6053125-6053147 TCTCTGAATTCTCAAAGCCTAGG + Intronic
1093141852 12:15518206-15518228 CCTCTGAAGCCACCAAGCCTTGG + Intronic
1100556220 12:95696521-95696543 TCGCTGTATCCCCCAAACCTAGG + Intronic
1101070977 12:101075849-101075871 CCTCTGAATACTCACAGCCTTGG - Intronic
1101300113 12:103470826-103470848 CCTTTGAATCACCCCAGCCCAGG + Intronic
1103010928 12:117457624-117457646 CCTCATAAAGCCCCAAGCCTTGG - Exonic
1103393107 12:120588472-120588494 CCTCTGAACCCTCCAAGCCCAGG - Intergenic
1104044210 12:125150304-125150326 CCTCTGTATCTCCCACCCCTTGG + Intergenic
1105239229 13:18595626-18595648 CCTCTGCCTCTCCCCAGCCTTGG + Intergenic
1106356220 13:28986146-28986168 CCTCCCAACCACCCAAGCCTGGG - Intronic
1106994936 13:35470722-35470744 CCTCCGAATCCCCCAACGCTCGG - Intronic
1108577087 13:51799922-51799944 CCTCTGACTGCCCCGATCCTGGG + Intronic
1110764000 13:79262157-79262179 CCTCTGTATCCCCAGTGCCTAGG - Intergenic
1113942008 13:114023288-114023310 CCTGGGATGCCCCCAAGCCTGGG - Intronic
1114273079 14:21116122-21116144 TCACTGTATCCCCCAAGCCATGG - Intergenic
1114619046 14:24084073-24084095 CTTCTAGATGCCCCAAGCCTAGG + Intronic
1114666234 14:24378622-24378644 CCTCTGGATCCTCCACTCCTGGG + Exonic
1115292799 14:31791694-31791716 CCTTTGAAACCCCATAGCCTGGG - Intronic
1119193567 14:72701194-72701216 CCTCTGAAGCCACCACCCCTGGG + Intronic
1121407273 14:93726990-93727012 CCTCAGACTTCCCCAAACCTGGG + Intronic
1121518871 14:94572002-94572024 CCCCTGAATCCCAGAGGCCTTGG - Intronic
1122246382 14:100406084-100406106 CTTCTGAAGCCTCTAAGCCTTGG - Intronic
1122809557 14:104281276-104281298 CCTCTGAAGCCCCCAACCAGAGG - Intergenic
1122882734 14:104697282-104697304 CCACTGAAGCCCCCAGGCCTCGG - Intronic
1122967398 14:105137788-105137810 CCCCTGAATCCACCAGGGCTGGG + Intergenic
1202904343 14_GL000194v1_random:59823-59845 CATCGGAGTCCCCCAAACCTGGG + Intergenic
1125434557 15:39630970-39630992 CCTCTGTGTCTCCCAAACCTGGG + Intronic
1125664825 15:41421938-41421960 CCTGAGAATCACCCAAGCCCAGG - Intronic
1125838656 15:42777178-42777200 CTTCTCAATGCTCCAAGCCTTGG - Exonic
1127262309 15:57335299-57335321 CCTCAGAATCCTCCAAGCAGAGG + Intergenic
1127370074 15:58331068-58331090 TCTCTGAATCCTCCCAGCCTTGG + Intronic
1129394027 15:75234619-75234641 CCTCTGGGAGCCCCAAGCCTGGG + Intergenic
1129941428 15:79500451-79500473 ACTCTGAATCCCTCAATACTGGG - Intergenic
1132016765 15:98324684-98324706 CCTTTGAATCTCCAAACCCTTGG + Intergenic
1132265176 15:100463875-100463897 CCTCTGAAGGCCTGAAGCCTTGG - Intronic
1134686688 16:16163861-16163883 CTGCTGAATCCCCCGAGCCTTGG - Intronic
1139337082 16:66240352-66240374 CCTCTAGGTCCCCAAAGCCTTGG + Intergenic
1141441229 16:84030923-84030945 CCTCTGAAGCCACCAGGTCTGGG + Intronic
1142030426 16:87835814-87835836 CCTCTGTGTTCCCGAAGCCTGGG - Intronic
1142978075 17:3656953-3656975 CCTCAGAGCCCCCCAAGTCTGGG + Intronic
1143368863 17:6425946-6425968 TCTCTGTATCCCCCATCCCTCGG + Intronic
1144306816 17:13976221-13976243 CCTCTAAAACACCCAAGCCAAGG + Intergenic
1145982113 17:29019032-29019054 CCTCTGGAGCCCACAGGCCTAGG - Intronic
1146113582 17:30114074-30114096 CCTCCAAATCCCCCAGTCCTAGG - Intergenic
1146950081 17:36899781-36899803 CCTCTGCATCCTCCCAGCCCAGG - Intergenic
1147241801 17:39095374-39095396 CCCCCCAACCCCCCAAGCCTGGG + Intronic
1147377607 17:40032260-40032282 CCCCTGATGCCCCCAGGCCTAGG + Intronic
1147644627 17:42026491-42026513 CCAGTGAAGCCCCAAAGCCTAGG + Intronic
1148559701 17:48598833-48598855 GCTCTGTCTCCTCCAAGCCTCGG + Intronic
1149353202 17:55812821-55812843 GCTGTGAATTCCCAAAGCCTTGG - Intronic
1151403510 17:73871731-73871753 TCTATGCATCCCTCAAGCCTTGG - Intergenic
1151561709 17:74873223-74873245 CCTCCAAATCCCGGAAGCCTAGG + Intergenic
1151665959 17:75545244-75545266 CCTCTGCCACCCCCAGGCCTGGG - Intronic
1152384815 17:79966087-79966109 CCTTTGAGTCCCCCCAGCTTCGG + Intronic
1153922103 18:9800976-9800998 CCTCTACATCCCCCAGCCCTGGG + Intronic
1154180209 18:12130688-12130710 CCACTGCATCCCCCAACCCCAGG - Intergenic
1154449566 18:14463014-14463036 CCTCTGCCTCTCCCCAGCCTTGG - Intergenic
1155095915 18:22556599-22556621 CCTCTGACACCTCCAGGCCTAGG - Intergenic
1155904271 18:31430144-31430166 CCTATGATTCCCCCAAGGGTGGG - Intergenic
1156938181 18:42736281-42736303 CCCCAGAACCCTCCAAGCCTGGG - Intergenic
1157315671 18:46587518-46587540 CCTCTGAAACACCCCAGCCATGG + Intronic
1157426534 18:47589024-47589046 CCTCTGCAGCCTCCAAACCTGGG + Intergenic
1157626432 18:49055002-49055024 TCTGTGAATCCCCTTAGCCTGGG - Intronic
1158448166 18:57539305-57539327 CCTCTGACTCCCACAAACTTCGG + Intergenic
1158542139 18:58366790-58366812 ACTCTGAATCCTCCAAGGGTTGG + Intronic
1159044576 18:63356846-63356868 TCTCTGAAGCCCACAAGCATTGG - Intronic
1159900810 18:74043834-74043856 CCTCTACATCCCTCAAGCCTGGG + Intergenic
1160115782 18:76078175-76078197 CCACTGAATTTCCCAATCCTGGG - Intergenic
1160385250 18:78492940-78492962 CATCTGACGCCCCCACGCCTGGG + Intergenic
1160861661 19:1239824-1239846 CCTCTGCACCCCCCGAGCCAGGG + Intergenic
1161033503 19:2071192-2071214 CCTCTGTCTCCCCCAGGGCTCGG - Exonic
1161112733 19:2479104-2479126 GCCCTGCAGCCCCCAAGCCTGGG + Intergenic
1161290402 19:3490940-3490962 CCTCTGACTCCCCCACCCCGAGG - Exonic
1162140174 19:8580723-8580745 CCTCTCCATCCCCCCAGCCAGGG + Exonic
1163628320 19:18403599-18403621 CCTCTGGATCCCCAGAGCCCAGG - Intergenic
1164916553 19:32057010-32057032 TTTCTGAGTTCCCCAAGCCTTGG + Intergenic
1167375812 19:49110835-49110857 CATCTGAATCACCCCTGCCTGGG - Intergenic
1167492591 19:49801108-49801130 CCTGGGGATCCCCCAAGCCCTGG - Intronic
1167818389 19:51904474-51904496 CCTCTGAGCCCCACATGCCTGGG + Intronic
1168059328 19:53882509-53882531 CCTCTGAATCGCCTACGCCGGGG - Exonic
1202703555 1_KI270713v1_random:5000-5022 GCTCTGTAGCCCCCAAGCTTGGG - Intergenic
925110858 2:1335457-1335479 CCTGTGAATCCCCAAAGCCAGGG - Intronic
925170040 2:1744601-1744623 CCTCTGAATCCCCGAGGGCGGGG + Intronic
927213722 2:20654041-20654063 GCTCTGTAGCCCCCAGGCCTGGG - Intergenic
928093497 2:28390728-28390750 CCTTTGCAGCCCCCAAGACTTGG + Intergenic
929625553 2:43403213-43403235 CCTCAAAATCCCCAGAGCCTTGG + Intronic
930125096 2:47789656-47789678 CCTGTGAATACCCAAATCCTTGG + Intronic
932068644 2:68593056-68593078 CTTCAGGATGCCCCAAGCCTTGG - Intronic
932308027 2:70717581-70717603 CCTCTGAAAGCCCCAGGCCCCGG + Intronic
932568322 2:72923529-72923551 CCTCTCTCTCCCCCAGGCCTTGG - Intronic
933789948 2:85875813-85875835 CCTCTGAAACTCCCTAGCCCCGG - Intronic
934518995 2:95007496-95007518 CCTCTGGATCATCCAAGCCTGGG + Intergenic
935811271 2:106799823-106799845 CCTCTAAATCCCCAGAGCCCCGG - Intergenic
936228947 2:110682516-110682538 CCTCTGAATACCCCTAGCACAGG - Intergenic
937673074 2:124559414-124559436 CCTCTTACTCCCCAAAGCCCTGG - Intronic
938108393 2:128548646-128548668 CCTGTGACTTCCCCAAGCCCAGG - Intergenic
939204730 2:139086261-139086283 CCTTCTCATCCCCCAAGCCTTGG + Intergenic
940183695 2:150960609-150960631 CCTCAGAATGCCCGCAGCCTGGG + Intergenic
947378402 2:229521031-229521053 CCTCTGCTTCCGCCAAGGCTGGG - Intronic
948756938 2:240165492-240165514 CCTCAGTCTCCCCTAAGCCTGGG - Intergenic
948907971 2:240988889-240988911 GCTCTGCATACCCCAGGCCTGGG + Intronic
948921881 2:241069665-241069687 CCTGTGAAGCCCCCAGGCCCTGG - Intronic
1169682440 20:8230886-8230908 CCTCTCAAGCCCCCAAACCATGG + Intronic
1169896648 20:10511341-10511363 CTTCTGAATCCTCCATGCCATGG + Intronic
1170932935 20:20785286-20785308 CCTCTGAATCTCCCAGCCCATGG + Intergenic
1172390795 20:34563717-34563739 ACTCTGCATCTCCTAAGCCTAGG + Intronic
1172995039 20:39064379-39064401 CCCCTGAACCCCCTCAGCCTTGG - Intergenic
1173336572 20:42116922-42116944 CCTCTGAATCCCTGAATCCTGGG + Intronic
1175242079 20:57557099-57557121 CCTCTGGGTCCCCCAGGCCAGGG - Intergenic
1175366887 20:58461757-58461779 CCCCTGTATCCCCCGGGCCTTGG + Intronic
1176292868 21:5055493-5055515 CCGATGAATCACCCAGGCCTGGG + Intergenic
1176613813 21:9011183-9011205 ACTCTGTTTCTCCCAAGCCTTGG + Intergenic
1176623711 21:9074590-9074612 CATCAGCATCCCCCAAACCTGGG + Intergenic
1176711381 21:10152706-10152728 ACTCTGTTTCTCCCAAGCCTTGG - Intergenic
1176741347 21:10606321-10606343 CTTCAGAGTCCCCCAAGCTTAGG - Intergenic
1178585282 21:33866252-33866274 CCTCAGAGTGCCCCATGCCTTGG - Intronic
1179091678 21:38271699-38271721 CCACACGATCCCCCAAGCCTGGG + Intronic
1179265142 21:39796390-39796412 CCTCTGAATTCCGAATGCCTTGG + Intronic
1179416421 21:41202318-41202340 CCTCGAAATCCTCCAAGCATTGG - Intronic
1179493569 21:41757132-41757154 TCTCTGAGACCCCCAAGCCTTGG - Intronic
1179864392 21:44208157-44208179 CCGATGAATCACCCAGGCCTGGG - Intergenic
1180566419 22:16670800-16670822 CCACTGCACCCCCCAACCCTGGG + Intergenic
1181456160 22:23061299-23061321 CCTCTAAGTCACCCAACCCTGGG - Intronic
1181511861 22:23392906-23392928 CCAGTGAATCCCCCCTGCCTGGG - Intergenic
1181782343 22:25202233-25202255 CCTCTGCCTGCCCCAAGCCTAGG - Intronic
1181925807 22:26357692-26357714 TCCTTGAATCCCCCAAGCCCAGG + Intronic
1182082965 22:27542351-27542373 CCTCAGACTCACCCCAGCCTGGG + Intergenic
1182435124 22:30325639-30325661 CCACAGAATCCCCCGAGCCCAGG - Intronic
1184569050 22:45310483-45310505 CCTCAGAAGCCCCCAGGCCCGGG + Intronic
1185238713 22:49729184-49729206 CCTCTAGATCCCCCAAGCCATGG + Intergenic
1185266439 22:49906652-49906674 CCTCTCAATGCCCCAGGCCGCGG + Intronic
949654954 3:6207213-6207235 CTTCTGAATCCCCCCAACTTAGG + Intergenic
949895424 3:8764667-8764689 CCCCTGCATCCCCGAGGCCTAGG + Intronic
950469884 3:13177936-13177958 CCCCTGCATCCCCTAGGCCTGGG + Intergenic
950623144 3:14224034-14224056 CCACTGAATCCCCTGAGCTTTGG - Intergenic
951593390 3:24290981-24291003 CCTCTGTAGTCCCAAAGCCTGGG - Intronic
953030317 3:39175643-39175665 CCACTGCACCCCCCCAGCCTGGG + Intergenic
954298272 3:49686033-49686055 GCTCTGTAGCCCCCAAGCTTGGG + Intronic
954430813 3:50470081-50470103 ACTCAGAATCCCAGAAGCCTTGG + Intronic
959618956 3:108379535-108379557 TCTCTGCTTCCCCCTAGCCTTGG + Intergenic
961043830 3:123695245-123695267 CCCCCTAATCCCCCAGGCCTAGG + Intronic
961600189 3:128054459-128054481 CCTGTGAATGCCCCCAGCTTTGG + Intronic
962023751 3:131526730-131526752 CCTCTGAGTCCCCTCGGCCTTGG + Intergenic
962257724 3:133883886-133883908 CCTCTGTTTCCCCCAACCCTGGG - Intronic
964176032 3:153826687-153826709 CCTCAGAATGCCCACAGCCTGGG - Intergenic
964996865 3:162892343-162892365 CCTGGGAATTCCCCAAGCCAGGG + Intergenic
965612771 3:170562431-170562453 CCTTTGCATCCCCAAAGCTTAGG - Intronic
967266792 3:187698615-187698637 CCTCTGAAGCCTCCAAGCCGAGG - Exonic
967301858 3:188021983-188022005 CCTCTGCCTCCCACAAGGCTGGG - Intergenic
968579032 4:1381163-1381185 CCTCTGGAGCCCCCAAACCCAGG - Intronic
971040521 4:22746880-22746902 CCTCTGGATCTCCAAATCCTGGG - Intergenic
971870584 4:32232337-32232359 CCTTTGAATTCACCAAGGCTCGG + Intergenic
973705466 4:53576057-53576079 ACTCTGCATCCCCCAAGACCTGG + Intronic
976613230 4:87050946-87050968 CATCTCAATGCCCCCAGCCTCGG - Intronic
981822078 4:148898198-148898220 GGTGTAAATCCCCCAAGCCTTGG - Intergenic
983966496 4:173819285-173819307 CCTGTGGATCCCCAAATCCTGGG - Intergenic
984933254 4:184867119-184867141 CATCCTAATCCCCCAAACCTGGG + Intergenic
985090440 4:186357642-186357664 CCTCACAATCCCCAAAACCTGGG + Intergenic
985585727 5:732800-732822 CCTCTAATTCCCCTGAGCCTGGG + Intronic
985647585 5:1092322-1092344 CCCCTGCATCCTCCCAGCCTGGG - Intronic
985710990 5:1429839-1429861 CCTATGAACACCCCAGGCCTGGG - Intronic
986718129 5:10538659-10538681 TCTCTGCAGCCCCCGAGCCTGGG + Intergenic
988606048 5:32679193-32679215 CCTAAGAATACCCCAAGACTAGG - Intergenic
991131837 5:63131690-63131712 CCTCTGAATCTCCCCAGCCCAGG - Intergenic
994851337 5:105057939-105057961 CCTGGGAATTCCCCAAGCCAGGG + Intergenic
997104161 5:130999278-130999300 AATCTTAATCCCTCAAGCCTGGG - Intergenic
997590965 5:135071975-135071997 TCTCTGATCCCCACAAGCCTGGG + Intronic
997718086 5:136056998-136057020 CCTCCCATTCCCCCAGGCCTAGG - Intronic
999316669 5:150588563-150588585 TCTCTGACTCCCACAATCCTGGG - Intergenic
1002158892 5:177303508-177303530 CCTTCGAAGACCCCAAGCCTCGG + Exonic
1002590302 5:180286676-180286698 CCTCTCAATCCCCCACTCCCAGG + Intronic
1004285163 6:14314851-14314873 CCTCTGAGTGCCCCCCGCCTAGG - Intergenic
1004475184 6:15964996-15965018 CCACTGAATCAACCAAGCCAAGG - Intergenic
1004542138 6:16561132-16561154 TCTCTGAATCCCTGATGCCTTGG + Intronic
1004686510 6:17951620-17951642 CCCCCAATTCCCCCAAGCCTAGG + Intronic
1005116699 6:22346407-22346429 ACTCTGAAACCCCGAAGCCCTGG - Intergenic
1006378107 6:33683044-33683066 CCTCTCAGTCCCTCAAGCATAGG + Intronic
1007371560 6:41429589-41429611 CATTTGACTCCCACAAGCCTAGG + Intergenic
1007927054 6:45658247-45658269 CCACTGACACCCCCCAGCCTGGG - Intronic
1007955290 6:45912418-45912440 CAAATGAATCTCCCAAGCCTTGG - Intronic
1008055258 6:46939101-46939123 CCTCGTGATCCCCCCAGCCTGGG + Intronic
1009011951 6:57853741-57853763 ACTCTGCATCCCCAGAGCCTAGG - Intergenic
1011829961 6:91359618-91359640 TATCTGAAACACCCAAGCCTGGG - Intergenic
1013230884 6:108161410-108161432 CCTCTGAATCTCCAAACCTTGGG - Intronic
1017922824 6:158886445-158886467 CCTCAGAATGCCCACAGCCTGGG - Intronic
1017964573 6:159253034-159253056 CTTCTGAAACACCCATGCCTAGG + Intronic
1018131724 6:160738306-160738328 CCTGTGCCTCCCCCAAGCATCGG + Intronic
1022222622 7:28328847-28328869 CCTCTCAATACCCTAAGCCGTGG - Intronic
1023298293 7:38739747-38739769 CCTGTGAATCCCCCAACCAAGGG - Intronic
1024518468 7:50282296-50282318 CCTCTGAAGTCCCCAAGGATAGG + Intergenic
1025767742 7:64472498-64472520 CCTCAGCATCCCCAGAGCCTGGG - Intergenic
1029456919 7:100676161-100676183 GCCCTGCATCCCCCAGGCCTCGG + Exonic
1030784317 7:113641145-113641167 CCACTGAAACCTCCAGGCCTGGG + Intergenic
1032192277 7:129771946-129771968 CCCATGGAGCCCCCAAGCCTGGG + Intergenic
1034162384 7:149002901-149002923 CCTCTGAAGCTCCTCAGCCTAGG + Intergenic
1035164861 7:156981030-156981052 CCTCTCAATCCTCCAAAGCTGGG + Intergenic
1035408501 7:158617914-158617936 CCTCTGCATCCCACAAACCTGGG - Intergenic
1036489304 8:9210314-9210336 CTTTTGAATCCCCCATGACTGGG + Intergenic
1037933866 8:22901376-22901398 CAACTGAATCCCCGAGGCCTAGG - Intronic
1040550541 8:48434081-48434103 CCTCAGAAACCCACCAGCCTAGG - Intergenic
1042947363 8:74168666-74168688 CCCCTGAATCCTCCCAGCTTCGG - Intergenic
1043215668 8:77584183-77584205 CCTCAGTACCACCCAAGCCTTGG - Intergenic
1049854120 8:144850972-144850994 GCTCTGCATCCCCCAAGACCTGG - Exonic
1050211333 9:3261302-3261324 CTTCTCAATCCCCCAGGCCTAGG + Intronic
1050850768 9:10283212-10283234 CCTCTGAATTTCCCAAAACTAGG + Intronic
1053385530 9:37684172-37684194 CCACTGCCTCCCCCCAGCCTTGG - Intronic
1053648368 9:40138397-40138419 ACTCTGTTTCTCCCAAGCCTTGG - Intergenic
1053757370 9:41325444-41325466 ACTCTGTTTCTCCCAAGCCTTGG + Intergenic
1054329346 9:63736340-63736362 ACTCTGTGTCTCCCAAGCCTTGG - Intergenic
1054536212 9:66237773-66237795 ACTCTGTTTCTCCCAAGCCTTGG + Intergenic
1055787148 9:79883481-79883503 CCTCTGCATCCCACAACCATGGG - Intergenic
1056047130 9:82730519-82730541 CCTATGACTTCCCCAAGCCTGGG + Intergenic
1058918328 9:109588868-109588890 CCACCGGATCCCACAAGCCTGGG - Intergenic
1060597873 9:124858863-124858885 CCTCAGAATCCCCCATACCATGG - Intronic
1060906617 9:127312977-127312999 CCTCTGAATCCCCCAAGCCTGGG - Intronic
1061955749 9:133960463-133960485 CCTCTGACTCCCACATGCATGGG + Intronic
1062276880 9:135735529-135735551 ACCCTGAATCCCCCCACCCTTGG - Intronic
1202796134 9_KI270719v1_random:121695-121717 ACTCTGTTTCTCCCAAGCCTTGG - Intergenic
1203563209 Un_KI270744v1:74462-74484 CATCGGAGTCCCCCAAACCTGGG - Intergenic
1189237885 X:39502272-39502294 CCTCTGAACCACCCAAGGCCAGG + Intergenic
1190873498 X:54444199-54444221 CATCTGTATCCCCCAACCCAGGG - Intronic
1192874185 X:75210998-75211020 CATCTGGATCCTCCAAGCCCAGG - Intergenic
1195925667 X:110022252-110022274 CCTCTTTATTCCCAAAGCCTTGG + Intronic
1196311239 X:114168337-114168359 CATCTGAATCCTACATGCCTGGG - Intergenic
1198654047 X:138894174-138894196 CCTCCGAATCCCCCGAGACCCGG - Intronic
1199690185 X:150303780-150303802 CCTATGAATCCCCCTAACCAGGG + Intergenic
1200224451 X:154409417-154409439 CCTGTGAGTCACTCAAGCCTGGG + Exonic
1201160222 Y:11160032-11160054 CATCGGCATCCCCCAAACCTGGG + Intergenic