ID: 1060906619

View in Genome Browser
Species Human (GRCh38)
Location 9:127312978-127313000
Sequence GCCTCTGAATCCCCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906619_1060906622 -1 Left 1060906619 9:127312978-127313000 CCAGGCTTGGGGGATTCAGAGGC 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1060906622 9:127313000-127313022 CCCAGTAATGTCAAGGACCCAGG No data
1060906619_1060906620 -8 Left 1060906619 9:127312978-127313000 CCAGGCTTGGGGGATTCAGAGGC 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906619 Original CRISPR GCCTCTGAATCCCCCAAGCC TGG (reversed) Intronic
900398153 1:2461774-2461796 GCTCCTGGTTCCCCCAAGCCTGG - Intronic
900587651 1:3440871-3440893 ACCTCTCAGTCCCCAAAGCCTGG + Intergenic
900602377 1:3508701-3508723 GGCTCTGAATCCCCCCATCCTGG - Intronic
900954085 1:5876177-5876199 GCCTCTGGAGGCCCCTAGCCTGG - Intronic
902471161 1:16648206-16648228 GGCTCTGTAGCCCCCAAGCTTGG - Intergenic
902487642 1:16759239-16759261 GGCTCTGTAGCCCCCAAGCTTGG + Intronic
904633415 1:31860665-31860687 GCCTCAGATTCTCCTAAGCCAGG - Intergenic
905253633 1:36665884-36665906 GGCTGTGATTCCCCCAGGCCGGG + Intergenic
905425354 1:37879303-37879325 GCCTCTGAATTCCCACTGCCTGG + Intronic
905920917 1:41718080-41718102 GATTCGGAATCCCCCAAGCACGG + Intronic
907110271 1:51920755-51920777 GCCTCTCATTCCCCCTAGGCTGG + Intronic
907289839 1:53406768-53406790 ACCTCTGGGTCCCCTAAGCCTGG - Intergenic
907407826 1:54264494-54264516 GCCTCTGAACCCACAGAGCCAGG - Intronic
912261134 1:108112431-108112453 GCCTTAGAACTCCCCAAGCCTGG + Intergenic
912764132 1:112393706-112393728 GACTCTGAATCCTACAAGGCAGG + Intergenic
913095765 1:115513982-115514004 GCCTCGGAATGCCCGCAGCCTGG - Intergenic
914901143 1:151711768-151711790 GCGTAAGAATCCCCCAACCCTGG - Intronic
915263510 1:154697013-154697035 GCTTTTGAAAACCCCAAGCCAGG - Intergenic
915536777 1:156541158-156541180 GCCTCTGATTCACCCCAGCCTGG + Intronic
915982490 1:160429365-160429387 GCCTTTGCATCCCCAGAGCCTGG - Intergenic
917941062 1:179922080-179922102 GCCTCTAATTCACCCAACCCAGG - Intronic
920026651 1:203003366-203003388 GCCTGTGAAACCCTAAAGCCTGG - Intergenic
920378281 1:205521156-205521178 GCCTCTGAAACCCTCATGCCTGG + Intronic
920926631 1:210347762-210347784 GCCTCTCAGTCCCCAAATCCAGG - Intronic
922368511 1:224887741-224887763 GCCTCAGAATGCCCACAGCCTGG + Intergenic
1063910301 10:10822193-10822215 ACCTCTGCATCCCCAGAGCCTGG + Intergenic
1066185411 10:33005720-33005742 GTCCCTGCAGCCCCCAAGCCCGG - Intronic
1067082255 10:43218383-43218405 AGCTCTGAGTCCCCCATGCCTGG - Intronic
1067082301 10:43218577-43218599 GCCTCTCCATCCTCCAGGCCAGG + Intronic
1067282853 10:44886020-44886042 ACCTCTGTGTCCCCCAAGCCTGG + Intergenic
1069779938 10:70948894-70948916 GACTCAGAATCCCCAAATCCAGG + Intergenic
1070683446 10:78465077-78465099 GCCTTTGAATCCCTCCATCCGGG + Intergenic
1071516895 10:86304041-86304063 GGCTGTGAAGCCCCCAACCCTGG + Intronic
1072904698 10:99442131-99442153 GCCTCTGGTTCCCCCAAGGGAGG + Intergenic
1074127322 10:110539465-110539487 GCCTGTGACTCCCCCCAGCCTGG - Intergenic
1076318721 10:129563254-129563276 GCCTCTGCATCCCGCAGGCCTGG - Intronic
1076716861 10:132370442-132370464 TCCTCTGGCTCTCCCAAGCCAGG - Intronic
1078699368 11:13666890-13666912 GCTCCTGAATCCCCCATGCTGGG + Intergenic
1078929480 11:15902123-15902145 GCCTGTGAAACCCCCCAGCTTGG + Intergenic
1079077645 11:17393814-17393836 GGCTCCACATCCCCCAAGCCAGG - Intronic
1079503216 11:21125851-21125873 GGCTCTGAATCAGCCAGGCCTGG + Intronic
1080612371 11:33915571-33915593 GCCGCTGAATCCCCATTGCCTGG - Intergenic
1081616494 11:44594533-44594555 GCCTCTGCATCCTCTAAGGCAGG + Intronic
1081717199 11:45258774-45258796 GACTTTTACTCCCCCAAGCCCGG - Intronic
1082867198 11:57910932-57910954 GACTCTAAATCCCCTAAGCTGGG + Intergenic
1083920194 11:65778293-65778315 GCCTCTGCAGCCCCGATGCCCGG - Exonic
1084453064 11:69251523-69251545 GTCTCTGAAACTCCAAAGCCTGG - Intergenic
1084514673 11:69630162-69630184 GCCTTTTAATGCCCCAACCCAGG + Intergenic
1085770720 11:79323431-79323453 GCTGCTGAGTCCCCCAACCCAGG - Intronic
1088755683 11:112883316-112883338 GCCTCTCTAACCCCCAAGCACGG - Intergenic
1096616529 12:52836191-52836213 GCCTCTCACTCCCACCAGCCTGG - Intergenic
1097490938 12:60269855-60269877 GCCTCTTAATTCCCCGGGCCGGG - Intergenic
1101032677 12:100675990-100676012 GCTTCTGGATCCACCAAGCCAGG + Intergenic
1101914696 12:108887127-108887149 GGCTCATAATCCCCAAAGCCAGG + Intronic
1102604484 12:114058137-114058159 GCCTCAGAATGCCCAGAGCCCGG + Intergenic
1104595366 12:130116860-130116882 GGCTCTGAATCCACCCAGCCAGG + Intergenic
1109197807 13:59398034-59398056 ATCTCTGACTCCCCCAATCCGGG + Intergenic
1110628607 13:77679515-77679537 GCCTCTGGATCCCCCCAGCAGGG + Intergenic
1113942010 13:114023289-114023311 GCCTGGGATGCCCCCAAGCCTGG - Intronic
1115896161 14:38089994-38090016 ACCTCTGCAGCCCCAAAGCCTGG - Intergenic
1119560272 14:75584090-75584112 GCCTCAGAATGCCCGCAGCCCGG - Intronic
1120553450 14:85900912-85900934 TCTGCTGAAGCCCCCAAGCCAGG + Intergenic
1121415236 14:93774723-93774745 ACCTCTTTATCCCCCAAGTCTGG + Intronic
1122044795 14:99015946-99015968 GCCCCTGGATCCCACAACCCCGG + Intergenic
1122842207 14:104471445-104471467 GCCACTGAGTACCCCCAGCCAGG - Intergenic
1122967396 14:105137787-105137809 GCCCCTGAATCCACCAGGGCTGG + Intergenic
1128215639 15:65932481-65932503 GCCTCTGAAGCCTCCATTCCTGG - Intronic
1128219432 15:65957781-65957803 CCCTCTGTCTACCCCAAGCCTGG + Intronic
1130225228 15:82052190-82052212 TCCTCTGTCTCCCCCAAGCAGGG - Intergenic
1130285381 15:82550250-82550272 GCCTCTGAATCTCCTGAACCTGG + Intronic
1133773266 16:8880134-8880156 ACCTCTTCATCCCCCAGGCCGGG - Intergenic
1134854932 16:17510572-17510594 GCCTGTAAATCCGCAAAGCCAGG + Intergenic
1134871187 16:17653806-17653828 GCCTCTGAATTCCCAATTCCAGG + Intergenic
1136451132 16:30354920-30354942 CCCTCTGGATCCCCCGACCCTGG + Intronic
1136456314 16:30381772-30381794 TCCACTGAGTCCCCAAAGCCAGG + Exonic
1137377889 16:47969693-47969715 GCCTCTGAATTACCAAGGCCAGG - Intergenic
1138048919 16:53755339-53755361 GCCTCTGACTCCCACAGACCTGG - Intronic
1138655421 16:58488510-58488532 GCCTCAGAATCCAACAAGCAGGG - Intronic
1139484663 16:67248875-67248897 GGCTCCGATACCCCCAAGCCAGG - Intronic
1139698494 16:68692406-68692428 ACCACTGTATCCCCAAAGCCTGG - Intronic
1141650267 16:85389065-85389087 GGCTCTGAGGCCCCCCAGCCAGG + Intergenic
1141731433 16:85825526-85825548 GACTCAGCATCCCCCAGGCCAGG + Intergenic
1144079201 17:11747299-11747321 ACATCTGAATCCCCCTCGCCTGG + Intronic
1144667552 17:17112307-17112329 ACATCTGAATCCTCCAAACCCGG + Intronic
1145325398 17:21818597-21818619 GCTACTGAATGCACCAAGCCAGG + Intergenic
1146282490 17:31553845-31553867 GCCTCTGATTCCCCCAGGTAAGG + Intergenic
1148513007 17:48189164-48189186 ACCTCTGTATCCCCAATGCCTGG - Intronic
1149607705 17:57936454-57936476 GCCTCTCAAGCCCCCAGCCCAGG + Intronic
1150338177 17:64344976-64344998 GCCTCTGCTTCACCCAATCCTGG + Intronic
1151272383 17:73006994-73007016 GCCTCTGCATCCCCAGCGCCTGG - Intronic
1151490132 17:74427864-74427886 GCCTCTCCATGCCCAAAGCCGGG + Intronic
1152462818 17:80450274-80450296 GCCGCTGAGTCCCCGAGGCCAGG + Intergenic
1152588347 17:81199052-81199074 GCCTCCGCCTCCCCCATGCCTGG - Intronic
1153829888 18:8912751-8912773 GCCACAGAATGCACCAAGCCAGG + Intergenic
1155904273 18:31430145-31430167 GCCTATGATTCCCCCAAGGGTGG - Intergenic
1156938183 18:42736282-42736304 GCCCCAGAACCCTCCAAGCCTGG - Intergenic
1157426532 18:47589023-47589045 GCCTCTGCAGCCTCCAAACCTGG + Intergenic
1159900808 18:74043833-74043855 ACCTCTACATCCCTCAAGCCTGG + Intergenic
1160115784 18:76078176-76078198 GCCACTGAATTTCCCAATCCTGG - Intergenic
1160861659 19:1239823-1239845 TCCTCTGCACCCCCCGAGCCAGG + Intergenic
1161229162 19:3163908-3163930 GGCTGTGAGTCCCGCAAGCCGGG + Intergenic
1161672985 19:5624417-5624439 CCCTTTGAATCCCCCAAGGGAGG - Intronic
1161714496 19:5867583-5867605 GCCACTGGATCCCCTAGGCCAGG - Exonic
1162140172 19:8580722-8580744 CCCTCTCCATCCCCCCAGCCAGG + Exonic
1163304828 19:16471625-16471647 GCCGCTGAAGCTCCCAGGCCGGG - Intronic
1167818387 19:51904473-51904495 GCCTCTGAGCCCCACATGCCTGG + Intronic
1168059330 19:53882510-53882532 CCCTCTGAATCGCCTACGCCGGG - Exonic
1168232448 19:55041809-55041831 GCCTCTGAATCACGCCAGGCAGG + Intronic
1168327938 19:55547413-55547435 GCCTCTGAGTCACACAGGCCTGG - Intergenic
1202703556 1_KI270713v1_random:5001-5023 GGCTCTGTAGCCCCCAAGCTTGG - Intergenic
925110860 2:1335458-1335480 GCCTGTGAATCCCCAAAGCCAGG - Intronic
925170038 2:1744600-1744622 CCCTCTGAATCCCCGAGGGCGGG + Intronic
925915917 2:8606226-8606248 GCCTATGAATTACTCAAGCCGGG - Intergenic
927190843 2:20515926-20515948 ACCTCTGAACCCCCCGTGCCTGG - Intergenic
927213723 2:20654042-20654064 GGCTCTGTAGCCCCCAGGCCTGG - Intergenic
927237437 2:20887110-20887132 GATTCTGGATCCCTCAAGCCTGG + Intergenic
928312535 2:30222782-30222804 GCCTCTGAATTCACCCACCCAGG + Intergenic
932705481 2:74021155-74021177 GCCTCTGAGTCTCCCCAGCCAGG + Intronic
933036666 2:77408642-77408664 GCCTCTGAATCCCCCCAGGAAGG + Intronic
934518993 2:95007495-95007517 CCCTCTGGATCATCCAAGCCTGG + Intergenic
934854036 2:97718080-97718102 GCCTGTTCATTCCCCAAGCCTGG - Intronic
934859545 2:97752505-97752527 GCCTCTGAATTTCTCAAGACCGG + Intergenic
934916762 2:98306314-98306336 GCCTCTGAATCCCAGTTGCCAGG + Intronic
935062331 2:99619627-99619649 GCCTCAGAATTACCCAATCCCGG - Intronic
935359858 2:102238101-102238123 GTCTCTAATTCCCTCAAGCCAGG - Intronic
936526353 2:113244328-113244350 GCCTCTGCTCCACCCAAGCCAGG + Intronic
940183693 2:150960608-150960630 GCCTCAGAATGCCCGCAGCCTGG + Intergenic
941754848 2:169173977-169173999 GCCGCTGCATCCCGCAGGCCTGG - Exonic
946305244 2:218853171-218853193 GACTCCGCATCCCCCAAACCGGG - Intergenic
1169075859 20:2759458-2759480 GCTTCTGACTACCCCAAGACAGG - Exonic
1169199037 20:3698788-3698810 CCCTCTGCATCCGCCAAGCGGGG - Intronic
1173231962 20:41205504-41205526 GCCTCTGTCTGTCCCAAGCCAGG + Intronic
1173336570 20:42116921-42116943 GCCTCTGAATCCCTGAATCCTGG + Intronic
1173652042 20:44672657-44672679 GCCTCAGAATGCCCGCAGCCCGG + Intergenic
1175035107 20:55992897-55992919 GCCTCAGAATCACCCATGCCGGG - Intergenic
1175242081 20:57557100-57557122 TCCTCTGGGTCCCCCAGGCCAGG - Intergenic
1175971985 20:62691091-62691113 GCCTCTGCAGACCCCAGGCCGGG + Intergenic
1177374878 21:20257295-20257317 GCCTCTGCATCTCTCAAGCAGGG + Intergenic
1179091676 21:38271698-38271720 GCCACACGATCCCCCAAGCCTGG + Intronic
1179913805 21:44463748-44463770 GACTCTGATTCCAGCAAGCCCGG - Intergenic
1180162720 21:46005579-46005601 GCCCCTGAATCCCAGAATCCGGG + Intergenic
1181441230 22:22936065-22936087 GGCTCTGAAGCCCCCACCCCAGG + Intergenic
1181511863 22:23392907-23392929 GCCAGTGAATCCCCCCTGCCTGG - Intergenic
1182062521 22:27408037-27408059 GCCTCTGGCTACCCCAAACCTGG - Intergenic
1182108745 22:27707675-27707697 GTCTCTAAAGCCCCCAACCCCGG - Intergenic
1182703496 22:32260057-32260079 GCCCCTGAGTCCCCCAGCCCAGG - Intergenic
1184569048 22:45310482-45310504 TCCTCAGAAGCCCCCAGGCCCGG + Intronic
1184653842 22:45931506-45931528 GCCTCTGACTCACCAAAGCGGGG + Intronic
1184712809 22:46263074-46263096 GCCTCTGCTTCCCCCATGGCGGG - Exonic
1185279609 22:49964462-49964484 GTCTCTGTTTCCACCAAGCCAGG - Intergenic
951943144 3:28104129-28104151 GCCTCAGCATCCCACAAACCTGG + Intergenic
952300780 3:32102966-32102988 GCCTGTGGATCTCCCAAGCATGG + Intergenic
952585141 3:34883521-34883543 GCTTTTAAATCCCCCAAGCCTGG + Intergenic
953030315 3:39175642-39175664 GCCACTGCACCCCCCCAGCCTGG + Intergenic
954298271 3:49686032-49686054 GGCTCTGTAGCCCCCAAGCTTGG + Intronic
958731360 3:97963808-97963830 GCCTCTGAATCTGCCAACCGTGG + Intronic
958755542 3:98246283-98246305 GCCTCAGAATGCCCGCAGCCCGG + Intergenic
961429699 3:126872606-126872628 GCCTGTGGATCCCTCATGCCAGG - Intronic
962257726 3:133883887-133883909 CCCTCTGTTTCCCCCAACCCTGG - Intronic
962636017 3:137332166-137332188 GCCTCTGTATCCCCCAACCACGG - Intergenic
964176034 3:153826688-153826710 GCCTCAGAATGCCCACAGCCTGG - Intergenic
964996863 3:162892342-162892364 ACCTGGGAATTCCCCAAGCCAGG + Intergenic
967301860 3:188021984-188022006 GCCTCTGCCTCCCACAAGGCTGG - Intergenic
968347553 3:198023302-198023324 GCCTCAGACTCCCCAGAGCCAGG + Intronic
985585725 5:732799-732821 GCCTCTAATTCCCCTGAGCCTGG + Intronic
985587476 5:748363-748385 GCCCCCGATCCCCCCAAGCCTGG - Intronic
985899401 5:2776897-2776919 CCCACTGAATCCCCCACTCCAGG - Intergenic
989100927 5:37822268-37822290 GCCCCTGCATCAGCCAAGCCCGG - Intronic
989330685 5:40254322-40254344 ACCACTAAATCCCCAAAGCCTGG + Intergenic
991972520 5:72154687-72154709 GCTTCTAAATTTCCCAAGCCTGG - Intronic
994796554 5:104308022-104308044 GACTCTGCATCCCCATAGCCTGG + Intergenic
994851335 5:105057938-105057960 ACCTGGGAATTCCCCAAGCCAGG + Intergenic
995687067 5:114782921-114782943 GCCTCTGGATCTCCCCAGCCAGG + Intergenic
997471432 5:134119589-134119611 GCCTGGGGATGCCCCAAGCCAGG + Intronic
999396546 5:151232813-151232835 GCCTCAGAATCTCCAAAGCAAGG - Intronic
1000898818 5:166888978-166889000 GCTTCTCATTCCCCAAAGCCAGG - Intergenic
1001931988 5:175679715-175679737 GCCTTTGCATCCCCTATGCCTGG - Intronic
1002564434 5:180101837-180101859 GCCTGTGACTCCCCCACGGCTGG - Intronic
1004995114 6:21183777-21183799 GCCACTGACTCCCAAAAGCCAGG + Intronic
1005990033 6:30896918-30896940 GCCTGCGCATCCCCCTAGCCAGG + Intronic
1005990258 6:30897907-30897929 CCCTCTCAATCTCCCAGGCCTGG - Intronic
1006113814 6:31764536-31764558 TCCTCTCACTCCCCTAAGCCTGG + Exonic
1009325089 6:62339196-62339218 GCCTCCGCTTCCCCCAAGCTGGG + Intergenic
1013815042 6:114087505-114087527 GTCTATGAATCCCCAAAGCCTGG + Intronic
1017922826 6:158886446-158886468 GCCTCAGAATGCCCACAGCCTGG - Intronic
1019446886 7:1076013-1076035 GCGGCTGAGTCCACCAAGCCAGG + Intronic
1019532443 7:1510644-1510666 GCCTCTGACTCCCACCATCCCGG + Intergenic
1019545769 7:1574983-1575005 CCCTCTAAATCCCACAAGACAGG - Intergenic
1019716871 7:2543214-2543236 GCTTCAGGATCCCCAAAGCCAGG + Exonic
1019961876 7:4467272-4467294 TCCTCTGAATGCCGAAAGCCAGG + Intergenic
1020406281 7:7839324-7839346 GCCTCAGCCTCCCCCAAGCTGGG + Intronic
1022636372 7:32139986-32140008 GCCTCTGAACCAACCAATCCTGG + Intronic
1023298295 7:38739748-38739770 GCCTGTGAATCCCCCAACCAAGG - Intronic
1024054601 7:45651863-45651885 CACTCAGAATTCCCCAAGCCTGG - Intronic
1024054892 7:45653652-45653674 ACCTGAGTATCCCCCAAGCCAGG - Intronic
1025767744 7:64472499-64472521 GCCTCAGCATCCCCAGAGCCTGG - Intergenic
1026459009 7:70596736-70596758 GCCTTTAAAACCCCCGAGCCTGG + Intronic
1026579036 7:71598737-71598759 ACCTCTGATTACCCCAGGCCTGG - Intronic
1026708805 7:72718876-72718898 GCATCTGAATCCCAGAGGCCAGG - Intronic
1028260073 7:88653157-88653179 GCCTCTGACTCCCCCACTACTGG - Intergenic
1029483618 7:100826873-100826895 GCCTCTGACTACCCCTACCCGGG - Intronic
1030193488 7:106831938-106831960 GCCTCGGAATGCCCACAGCCCGG + Intergenic
1032088459 7:128896276-128896298 GCCTCTAATTCCCCTAAGCTGGG - Intronic
1033626175 7:143111793-143111815 GCCTCTCCATCCTCCTAGCCTGG - Intergenic
1035185928 7:157125769-157125791 CCCTCAGACTCCCCCGAGCCCGG - Intergenic
1035291426 7:157841640-157841662 GCCTCAGAGTCCGCCAGGCCAGG - Intronic
1035408503 7:158617915-158617937 ACCTCTGCATCCCACAAACCTGG - Intergenic
1038536120 8:28353817-28353839 GCCTCTGCAGCCTCCAGGCCTGG + Intronic
1041029299 8:53719547-53719569 GCCTCTGAATCCTCTGTGCCAGG + Intronic
1043489685 8:80736637-80736659 GCCTTTGCATCCCCATAGCCAGG - Intronic
1043672254 8:82901649-82901671 GCCTCTGAGTCCTCAGAGCCAGG - Intergenic
1046548985 8:115688735-115688757 GCCACTGACTCCCCCAATCCAGG + Intronic
1048985015 8:139730579-139730601 GCCTTGGAATCCCCCAAGGCTGG - Exonic
1048992850 8:139771469-139771491 GCCTCTGAAGCCTGCAACCCTGG + Intronic
1053368019 9:37537540-37537562 GCCTCTAGCTCCCCAAAGCCAGG - Exonic
1055304044 9:74910361-74910383 GCCACTGAATCACCTCAGCCTGG + Intergenic
1055787150 9:79883482-79883504 GCCTCTGCATCCCACAACCATGG - Intergenic
1056047128 9:82730518-82730540 TCCTATGACTTCCCCAAGCCTGG + Intergenic
1060034332 9:120242195-120242217 GCCCCCGAATCCCTCAAGGCAGG - Intergenic
1060903916 9:127287608-127287630 GTCTCAGTGTCCCCCAAGCCCGG - Intronic
1060906619 9:127312978-127313000 GCCTCTGAATCCCCCAAGCCTGG - Intronic
1061160759 9:128892583-128892605 GCCTCTGACTCACCCCAGCTGGG + Intronic
1061540387 9:131275151-131275173 TCCTCTGCAGCCCCAAAGCCCGG - Intronic
1061955747 9:133960462-133960484 GCCTCTGACTCCCACATGCATGG + Intronic
1062289852 9:135789601-135789623 CCGCCTGAATCCCCCACGCCAGG - Intronic
1186257491 X:7738307-7738329 GCATCTGAAGCCCCCCTGCCTGG + Intergenic
1186760968 X:12721210-12721232 GCTTCTGAATCGCCACAGCCAGG - Exonic
1187900740 X:24025307-24025329 GCCTCGGGATCACCCACGCCGGG + Intronic
1188444056 X:30238257-30238279 GGCTCTGGATCCCCCAGCCCAGG - Intergenic
1188891101 X:35611749-35611771 GCCTCAGAATGCCCACAGCCCGG + Intergenic
1189152417 X:38721774-38721796 GCATCTGAATTCCCCAAGGCAGG - Intergenic
1190873499 X:54444200-54444222 ACATCTGTATCCCCCAACCCAGG - Intronic
1192177696 X:68896041-68896063 GCCTCTGAGTCCCCAGGGCCTGG - Intergenic
1192509923 X:71715616-71715638 GCCTGTCCATCCCCCAAGACCGG - Exonic
1192516774 X:71765937-71765959 GCCTGTCCATCCCCCAAGACCGG + Exonic
1195105613 X:101599584-101599606 GCCCCTGAATCAGCAAAGCCAGG + Intergenic
1195107269 X:101614183-101614205 GCCCCTGAATCAGCAAAGCCAGG - Intergenic
1197252438 X:124229708-124229730 CCCTCTGCATCCCCCAAGGGTGG - Intronic
1199690183 X:150303779-150303801 CCCTATGAATCCCCCTAACCAGG + Intergenic
1199855028 X:151753007-151753029 GCCTCTGATTCCACCACTCCAGG - Intergenic