ID: 1060906620

View in Genome Browser
Species Human (GRCh38)
Location 9:127312993-127313015
Sequence TCAGAGGCCCAGTAATGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060906609_1060906620 11 Left 1060906609 9:127312959-127312981 CCCAGAGGCAGGGCAAGCCCCAG 0: 1
1: 0
2: 4
3: 55
4: 418
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906616_1060906620 -6 Left 1060906616 9:127312976-127312998 CCCCAGGCTTGGGGGATTCAGAG 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906617_1060906620 -7 Left 1060906617 9:127312977-127312999 CCCAGGCTTGGGGGATTCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 252
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906619_1060906620 -8 Left 1060906619 9:127312978-127313000 CCAGGCTTGGGGGATTCAGAGGC 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data
1060906610_1060906620 10 Left 1060906610 9:127312960-127312982 CCAGAGGCAGGGCAAGCCCCAGG 0: 1
1: 0
2: 5
3: 55
4: 484
Right 1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060906620 Original CRISPR TCAGAGGCCCAGTAATGTCA AGG Intronic
No off target data available for this crispr