ID: 1060911823

View in Genome Browser
Species Human (GRCh38)
Location 9:127357346-127357368
Sequence CTCCACGTGGTGCAGCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060911823_1060911832 6 Left 1060911823 9:127357346-127357368 CCTTCAGGCTGCACCACGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1060911832 9:127357375-127357397 AGGGTAAGCCAGCGGTTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1060911823_1060911830 4 Left 1060911823 9:127357346-127357368 CCTTCAGGCTGCACCACGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1060911830 9:127357373-127357395 ACAGGGTAAGCCAGCGGTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 91
1060911823_1060911828 -2 Left 1060911823 9:127357346-127357368 CCTTCAGGCTGCACCACGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1060911828 9:127357367-127357389 AGGCCAACAGGGTAAGCCAGCGG 0: 1
1: 0
2: 2
3: 9
4: 169
1060911823_1060911831 5 Left 1060911823 9:127357346-127357368 CCTTCAGGCTGCACCACGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060911823 Original CRISPR CTCCACGTGGTGCAGCCTGA AGG (reversed) Exonic
900589465 1:3453351-3453373 CTCCACCTGGAGCCGCCTGTGGG - Intergenic
900891531 1:5453212-5453234 CTCCACGTTGTGGAGCTGGAAGG + Intergenic
904286862 1:29458656-29458678 CTCGAGGTGATGCAGCCGGAAGG + Intergenic
904794318 1:33047525-33047547 CTGCAGGTGATGCAGGCTGAAGG + Intronic
912493256 1:110074392-110074414 CTTCCTGTGGTGCAGGCTGAGGG - Intronic
915012188 1:152698117-152698139 CTCCACGGGGACCAGCCTGGGGG + Intergenic
918451341 1:184662029-184662051 CTCAAAGTGGTGGAGCCTGCAGG - Intergenic
919926110 1:202192716-202192738 CTCCCCATGGTCCAGCCAGAGGG - Intergenic
921164437 1:212496444-212496466 GTCCACTTGGGGCAGCCAGAGGG + Intergenic
924771703 1:247085604-247085626 CCCCAGGAGGTGCTGCCTGAGGG - Intergenic
1063373669 10:5538725-5538747 CTCCCAGTTCTGCAGCCTGAAGG - Intergenic
1063662802 10:8045556-8045578 CTCCACGTGGAGCGGGCAGAGGG - Intergenic
1063959902 10:11298356-11298378 CAGCAGGTGGTGCAGCCTGAGGG + Intronic
1067057662 10:43061660-43061682 CCCCACGAGGAGGAGCCTGAGGG - Intergenic
1069769840 10:70891251-70891273 CTCCACCATCTGCAGCCTGATGG + Intergenic
1070262800 10:74873721-74873743 CCCCACTTGGTGCACCCTGATGG + Intronic
1073843991 10:107531296-107531318 CTCCACTTGGTGCAGTTTCAAGG - Intergenic
1076547860 10:131257808-131257830 CTCCACGTGGTTTAGCTTAATGG - Intronic
1076717152 10:132371993-132372015 CCCCTAGTGGTGCAGCATGAAGG + Intronic
1079237438 11:18700378-18700400 CTCCACCTGCCCCAGCCTGAAGG - Intronic
1080230796 11:30016632-30016654 CTCCAGCTGTTGCAGCTTGAGGG - Exonic
1084004609 11:66316372-66316394 CTCTGCGTGAAGCAGCCTGAGGG - Exonic
1084319346 11:68364841-68364863 CTACACTTGGGGCAGCATGAGGG + Intronic
1084494126 11:69494345-69494367 CACCACGAGGGGCAGCCCGAGGG + Intergenic
1089293073 11:117450103-117450125 CTCCACATGGAGCAAGCTGAGGG - Intronic
1091831828 12:3555564-3555586 CTCCAGGTGCTGCAGTCTGTTGG + Intronic
1094372103 12:29749995-29750017 CTCTTCGTGGTGCAGGCTGTTGG - Intronic
1101724694 12:107379189-107379211 CTCCACCTGGTGCAGAGTAAGGG + Intronic
1102261939 12:111448181-111448203 CTCCAGGTGCTGCAGGCTGTTGG - Exonic
1104919869 12:132285165-132285187 CTCCTCCTGGAGCTGCCTGAGGG - Intronic
1107441624 13:40432833-40432855 CACCATGTTGTGCTGCCTGACGG + Intergenic
1107707078 13:43118821-43118843 CTCCTTAAGGTGCAGCCTGATGG + Intergenic
1114661643 14:24349898-24349920 AGCCACGTGCTGCAGCCTCAAGG + Intergenic
1114912716 14:27220507-27220529 TTCCGCGTGGAGAAGCCTGACGG - Intergenic
1126432171 15:48597932-48597954 CTCCCCTTGGTGCTCCCTGAGGG - Intronic
1129245431 15:74276292-74276314 CTTCACCTGGTCCAGCCTGCTGG + Intronic
1129607244 15:77030935-77030957 CTCGGTGTGGTGCAGCCTGAAGG + Intronic
1130104890 15:80921840-80921862 CTCCATGTGGTCCAGTCTGGGGG - Intronic
1131501265 15:92969263-92969285 CTGCATGTTGTGCAGCCTGAAGG - Intronic
1132756574 16:1488164-1488186 CCCCACGTGGTGCAGCTGCATGG - Intronic
1140470204 16:75209474-75209496 CCCCACGTGCTGCAGCCTCCTGG + Intergenic
1142426567 16:90004749-90004771 CTCCAGCTGCAGCAGCCTGAGGG - Intergenic
1142695482 17:1630354-1630376 CTCCTCTTTGAGCAGCCTGACGG + Intergenic
1146629464 17:34459461-34459483 CTCCATCTGGGGCAGCCTGGTGG - Intergenic
1146970428 17:37067617-37067639 CTGCACGTGGTGCTGCCTGGAGG - Intergenic
1147375964 17:40022670-40022692 CTCCAAGTGGCACAGCCTCATGG - Exonic
1148523877 17:48311032-48311054 CTCAACGTGGCTCAGCCTGGGGG - Intronic
1151357266 17:73567280-73567302 TTCCACATGGTGAAGCCTGCAGG + Intronic
1152007271 17:77690485-77690507 CTCCTCGAGCTGCAGCCTGGGGG - Intergenic
1152325167 17:79631805-79631827 TTCCAGGGGGAGCAGCCTGAGGG - Intergenic
1152569283 17:81114509-81114531 CTCAACGTGCTGGAGCCTCAGGG - Intronic
1152650674 17:81491188-81491210 GTCCACTTGGAGCAGACTGAGGG - Intergenic
1161035734 19:2083398-2083420 CTGCAGGTGGTGTGGCCTGAGGG - Intronic
1161237379 19:3204688-3204710 CTCCAGGTGGGACAGCGTGAAGG - Exonic
1162789501 19:13055601-13055623 CTCCACTTGGAGCAGCCTCAGGG + Intronic
1163250756 19:16125136-16125158 CACGGGGTGGTGCAGCCTGACGG - Intronic
1163658911 19:18564862-18564884 CTCAAAGCGGTCCAGCCTGATGG - Exonic
1163795912 19:19337915-19337937 CCCCACGTGGTGGAGCCTGCCGG - Intronic
1166046260 19:40232829-40232851 CCCCACGTTCTGCAGCCTTAAGG - Exonic
1167448732 19:49554956-49554978 CCCCACCTGTGGCAGCCTGAGGG - Intergenic
1168701239 19:58440727-58440749 CTCCGCGCGGTGCAACCTGAGGG - Intergenic
931202464 2:60111537-60111559 CTCCATGTGGTGGAGACCGAAGG - Intergenic
932405919 2:71512613-71512635 CTCCATGTGGTCCAGCCTGCTGG + Intronic
935145285 2:100391247-100391269 CTCCACATGGTGGTGCCTCAGGG + Intergenic
936525917 2:113241626-113241648 CTCGAGGTGGTGCTGGCTGAAGG + Exonic
937098200 2:119249257-119249279 CCCCACCTGGTGTGGCCTGAAGG - Intronic
937443119 2:121933762-121933784 ATCCACGTAGTTCTGCCTGATGG + Intergenic
938422454 2:131155628-131155650 GTCCACGTGGAGCCTCCTGAGGG - Intronic
947317715 2:228879569-228879591 CTCTTCGTGTTGCAGACTGATGG + Intronic
947412059 2:229851117-229851139 CTGCACGTGGAGCTGCCTGCCGG - Intronic
948475875 2:238219011-238219033 CTCCACGTTGCCCAGCCTGGTGG - Intergenic
948921656 2:241068756-241068778 CTCCACGAGGGGCAGACTCATGG - Intronic
1170740421 20:19051033-19051055 CTGCTCGTGGTGCATACTGAGGG + Intergenic
1175415195 20:58796369-58796391 ATCCACGTGGCTGAGCCTGACGG + Intergenic
1176662506 21:9651451-9651473 CTCCAAGTGGTTCAGCCTGTGGG + Intergenic
1179391003 21:40990836-40990858 CTCCATGTTGTGCTGCCTGGGGG + Intergenic
1180232817 21:46437493-46437515 CTCCACCTGGCCCAGCCTGCTGG + Intronic
1181591056 22:23884804-23884826 CCCCACGTGGAGGAGCCTGGAGG + Exonic
1182288191 22:29260222-29260244 CTCCAGCTGCTGCAGCCTGTTGG + Exonic
1183359175 22:37374620-37374642 CGTGACGTGGTGCAGCTTGATGG + Exonic
1183519287 22:38287180-38287202 GTCCAGGAGGTGCTGCCTGATGG + Intergenic
1184242901 22:43220784-43220806 CTCCACCTGCAGCAGCGTGATGG - Intronic
1184660611 22:45963948-45963970 CTCCAGGAGCTGCAGCCTGGAGG + Intronic
950162402 3:10770534-10770556 CTCCACGTGGACAAGCCAGAGGG + Intergenic
950638769 3:14334419-14334441 CTCCTGGGGGGGCAGCCTGAGGG - Intergenic
952963157 3:38605331-38605353 CCCCACATGGTGGAGCCTGGAGG - Intronic
954305556 3:49723610-49723632 CTCCACTTGGTGCAGCAAGATGG + Exonic
956587958 3:70884165-70884187 CTCCAGGTGGTGCAGCCCTGTGG + Intergenic
958466233 3:94462683-94462705 CTACACATGGTGTAGCTTGATGG - Intergenic
967773274 3:193358035-193358057 CTCCAGGTGGTAAAGACTGAAGG + Intronic
968442685 4:632385-632407 ATCCATGTGGTGCCGTCTGAGGG + Intronic
968866149 4:3213267-3213289 CTCCACGTGGTTCAGAATAAGGG - Intronic
968976653 4:3825597-3825619 CCCCACGTGGCCCAGCCTCAGGG - Intergenic
969105373 4:4803479-4803501 CTCCACGTGGTGCTCAGTGATGG + Intergenic
969183109 4:5456884-5456906 CTCCACGTGGTGCAAGGGGATGG + Exonic
969240812 4:5896111-5896133 CGCCACGTGGGGCTGCCTGAGGG - Intergenic
969968432 4:11021139-11021161 TTCAAGGTGGTGCAGACTGATGG - Intergenic
978436643 4:108692772-108692794 CTCCATGTGCTGCAGCTTGGCGG + Intergenic
978763852 4:112384228-112384250 CTTCACTTGGTGCTTCCTGATGG - Intronic
978852478 4:113355254-113355276 CTCTCCGTGTGGCAGCCTGATGG + Exonic
982319920 4:154067292-154067314 GCCCACGAGGGGCAGCCTGAAGG + Intergenic
983585673 4:169351970-169351992 CCCCAAGTTGTGCAGTCTGATGG - Intergenic
985158949 4:187024200-187024222 CTCCAGGTGGTGCTCCCTGTTGG - Intergenic
985412888 4:189705074-189705096 CTCCAAGTGGTTCAGCCTGTGGG - Intergenic
992155702 5:73953255-73953277 CTCCAGGAGGAGCAGTCTGAAGG + Intergenic
995973099 5:117997119-117997141 TTCCTTGTGGTGCTGCCTGAAGG + Intergenic
1001115065 5:168932598-168932620 CACCCCGTGGGGCAGCCTGGTGG + Intronic
1005131702 6:22516458-22516480 CCCCACCTTGTGCACCCTGAAGG + Intergenic
1006626950 6:35404444-35404466 TGCCACATGGTACAGCCTGATGG - Intronic
1007693995 6:43720083-43720105 CTCCAAGTGGTGAAGCGTGGAGG - Intergenic
1011326496 6:86153979-86154001 CTCCACTTGATGCAGTCTGTCGG - Intergenic
1014390191 6:120852443-120852465 CTCCACAGGGTGCATCCTCATGG - Intergenic
1015811338 6:137164636-137164658 CTCTGCGTGGTGTTGCCTGAGGG - Intronic
1016363011 6:143288091-143288113 CTCCACCTGGTGCAGCCGTCTGG + Intronic
1017881169 6:158563536-158563558 CTCCAGGCAGTGCAGCCTGGTGG - Intronic
1019455884 7:1127274-1127296 CGCCACTTGGTGCAGCCTCAGGG + Exonic
1019709409 7:2511454-2511476 CTCCCCGAGGTGCAGCCTGGGGG + Intergenic
1023516635 7:41008342-41008364 CTCCACTCGGTGGAGCCTGGAGG + Intergenic
1027251284 7:76400383-76400405 CTCCACGTTGTCCAGCAGGATGG + Exonic
1033333808 7:140435652-140435674 CTCATCGTGGTGAAGCCAGATGG - Intergenic
1035269110 7:157709604-157709626 CTCCACGTTGTGCAGCCACATGG + Intronic
1038125782 8:24671372-24671394 CTCAACATGGTGCAGTCTCAGGG - Intergenic
1038201666 8:25418785-25418807 ATCCAAGTGGTGCACACTGAGGG - Intergenic
1041578966 8:59434504-59434526 CTCCACAAGCTGCAGCCAGAGGG + Intergenic
1043566848 8:81558499-81558521 CTTCACGTGGAGCAGGCTCAGGG - Intergenic
1048903172 8:139060044-139060066 CTCCACATGGTGTGGCATGAAGG - Intergenic
1049161512 8:141101283-141101305 TGCCACGTGGTTCTGCCTGAGGG + Intergenic
1049685962 8:143939424-143939446 CTCCGCGTGCCGCAGCCCGAGGG - Intronic
1053173834 9:35908644-35908666 CTCCACATGGAGCAGGCTGTGGG - Intergenic
1056605089 9:88078779-88078801 CTCCACGTGCTCCAACCTGGGGG + Intergenic
1057076344 9:92140175-92140197 CTCCCCATGGTCCAGCCAGAGGG - Intergenic
1057206342 9:93175228-93175250 CAGCAGGTGGTGCAGCCTGGAGG - Intergenic
1059634332 9:116156751-116156773 CTCCACATGGTACAGGCTGTTGG + Intronic
1060222908 9:121773858-121773880 CTCCAGGTGGTTGTGCCTGAAGG - Intronic
1060911823 9:127357346-127357368 CTCCACGTGGTGCAGCCTGAAGG - Exonic
1061021805 9:128020552-128020574 CTCCACAAGGTGCAGTATGAAGG + Intergenic
1062290669 9:135792975-135792997 CTCCACGTGGCCCAGCCCGGAGG - Exonic
1062503820 9:136862745-136862767 CTCCAGGTAGTACAGACTGAGGG - Intronic
1187392993 X:18897778-18897800 CTCCACGTGGTGAAGGCTTCCGG - Intronic
1187611810 X:20951555-20951577 TTCCACATGGGGCAGCTTGAAGG + Intergenic
1189646210 X:43135438-43135460 CTCATTATGGTGCAGCCTGAAGG + Intergenic
1194411683 X:93565708-93565730 CTTCAGGTGGTGCAGCTTCAGGG - Intergenic