ID: 1060911831

View in Genome Browser
Species Human (GRCh38)
Location 9:127357374-127357396
Sequence CAGGGTAAGCCAGCGGTTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060911823_1060911831 5 Left 1060911823 9:127357346-127357368 CCTTCAGGCTGCACCACGTGGAG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 73
1060911827_1060911831 -8 Left 1060911827 9:127357359-127357381 CCACGTGGAGGCCAACAGGGTAA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060911831 Original CRISPR CAGGGTAAGCCAGCGGTTGT GGG Exonic
900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG + Intergenic
901766389 1:11502517-11502539 CAGGGTCAGAGAGAGGTTGTGGG + Intronic
909610003 1:77541582-77541604 CAGGTTAGGCCAGCGGGAGTTGG - Intronic
912555797 1:110515123-110515145 CATGATAAGCCAGCTGATGTGGG - Intergenic
919772650 1:201172549-201172571 CAGGCTAAGCCAGCTGCAGTTGG - Intergenic
923256319 1:232224459-232224481 CAGGGTCATCCAGAGGTGGTGGG - Intergenic
1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG + Intergenic
1065214502 10:23437713-23437735 AAGGGAAAGCCAGAGGTAGTGGG - Intergenic
1071473722 10:86006887-86006909 CAGGGGAAGCTGGCGGTGGTGGG + Intronic
1075433812 10:122416313-122416335 CAGGGAAAGAGAGCTGTTGTGGG + Intronic
1075631501 10:124003396-124003418 CAGGGAAGGCCAGTGGTTTTTGG - Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG + Intergenic
1096870622 12:54589993-54590015 CAGGGTAAGGCTGGGGTTATGGG + Intergenic
1101558179 12:105830570-105830592 CAAGGTAAGCCAAGGATTGTTGG - Intergenic
1104619776 12:130302263-130302285 CAGGATAAGGCAGATGTTGTGGG + Intergenic
1113106274 13:106775019-106775041 CAGGGCAAGCCAGAGATTTTTGG - Intergenic
1117497429 14:56319546-56319568 CAGGTTAAGCCAGCTGTGGATGG - Intergenic
1119264237 14:73254712-73254734 CAGGGTCAGGCAGCAGGTGTGGG - Intronic
1122321903 14:100860482-100860504 CAGGGTACGCCAGAAGTTGAGGG + Intergenic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131737106 15:95345442-95345464 CAGCATAAGCTAGCGGGTGTTGG - Intergenic
1132389574 15:101428458-101428480 CAGGGTAAGCATGGTGTTGTAGG - Intronic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG + Intergenic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160205507 18:76828139-76828161 CAGTGTAAGCTAGGGGTAGTAGG + Intronic
1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG + Intronic
1166916511 19:46199122-46199144 CAGGGTAGGGCAGCAGTTGGAGG + Intergenic
1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG + Intronic
925015893 2:523858-523880 CAGGGAATGACAGTGGTTGTTGG + Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
937727514 2:125185647-125185669 CAGGGTAAACAAGGTGTTGTAGG + Intergenic
940316271 2:152330799-152330821 CAGGGTAATCCAGTGGTGGTGGG - Intergenic
946731327 2:222712304-222712326 CTGGATAACCCAGCGGATGTTGG - Intergenic
947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG + Intergenic
1170241772 20:14174446-14174468 CAGGGAAAGCTAGCAGTTATAGG + Intronic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1173004748 20:39131368-39131390 TAGGGAAAGACAGCGGGTGTTGG + Intergenic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1174828031 20:53786692-53786714 CAGGGTAAGTTAGAGGTAGTAGG - Intergenic
1175675525 20:60943409-60943431 CAGGGTAGGGCAGCGGTGGTAGG + Intergenic
1175756376 20:61533028-61533050 CAGGGAATGCCAGCTGGTGTGGG + Intronic
1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG + Intronic
955936107 3:64104151-64104173 CAGAGTAAGCAAGCGATTGGAGG - Intronic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
964442740 3:156728775-156728797 CATGGGCAGCCAGCGGCTGTGGG + Intergenic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
969125337 4:4943801-4943823 CAGGCTGAGGCAGGGGTTGTGGG + Intergenic
969375242 4:6759134-6759156 CAGGGTGGTCCAGCGGTAGTTGG - Intergenic
969588251 4:8106980-8107002 CAGGTTAAGGCAGCAGTGGTTGG - Intronic
973045616 4:45532237-45532259 CAGGGTCAACCAACTGTTGTTGG - Intergenic
975267164 4:72383556-72383578 AGGGGTCAGCCAGAGGTTGTTGG - Intronic
977379642 4:96255952-96255974 CAGGGCAATCCAGTGGTGGTGGG - Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
988785540 5:34563130-34563152 CTGGGTAATCTAGAGGTTGTGGG + Intergenic
992892974 5:81221017-81221039 CAGGGTTAGCCTGGGGTTATGGG + Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
999935323 5:156479949-156479971 CAGGGCAAGACAGCAGCTGTTGG - Intronic
1005431536 6:25763174-25763196 CATGGTAGGCCAGATGTTGTAGG - Intronic
1009865774 6:69395912-69395934 CAGGGCAAGCCAGCAGCTGGAGG - Intergenic
1015423829 6:133041270-133041292 CAGGGTAGGCCAGGGGGTGGGGG - Intergenic
1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG + Intronic
1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG + Intergenic
1020093161 7:5352677-5352699 CTGGGGAAGCCAGCAGTGGTGGG - Intronic
1020871777 7:13639624-13639646 CAGGGTAAAGCAGCTGTTCTGGG - Intergenic
1022861219 7:34369114-34369136 CAGGGAGAGCCAGCAGTAGTAGG - Intergenic
1024345277 7:48307037-48307059 CAGGGTGGGCCAGCGGATTTGGG - Intronic
1026808130 7:73440594-73440616 CAGGGGAAGCTGGCGGTGGTGGG + Exonic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1034588753 7:152120484-152120506 GAGGGTCAGCCAGAGGCTGTCGG + Intronic
1034763286 7:153693942-153693964 CAGGGTTTGCCAGGGGCTGTCGG - Intergenic
1048301539 8:133254869-133254891 CAGGGTAAGCTAGCAGTAGCTGG - Intronic
1057048378 9:91903311-91903333 CAGGGGAAGCCAGCGGGTTGGGG - Intronic
1060522574 9:124302005-124302027 CAGGGTGTGGCAGAGGTTGTTGG - Exonic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG + Intergenic
1190108482 X:47574669-47574691 CAGGGTAAGCGAGAGGCTGGCGG - Exonic
1190338382 X:49277141-49277163 CAGAGTAAGCGAGCGGGTGAGGG - Intronic
1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG + Intergenic