ID: 1060913895

View in Genome Browser
Species Human (GRCh38)
Location 9:127372898-127372920
Sequence AGGTAGGCCCCTGTATCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060913895 Original CRISPR AGGTAGGCCCCTGTATCTTC TGG (reversed) Intronic
902982714 1:20137434-20137456 AGGTTGGAGGCTGTATCTTCAGG + Intergenic
904288447 1:29468760-29468782 ATGTAGGCCCCTGTCTCGGCAGG + Intergenic
904974914 1:34448625-34448647 AAGCAGACCCCTGTGTCTTCTGG - Intergenic
905307616 1:37030431-37030453 TGCTGGGCCCCTGTATATTCAGG + Intronic
911369074 1:96974724-96974746 AGTTGGCCCCCTGTATCTTCAGG + Intergenic
911722504 1:101206707-101206729 ATGTAGGCACCTGTTTCTTGAGG - Intergenic
913370880 1:118097535-118097557 AGCTAGGCTCTTTTATCTTCAGG - Intronic
913666121 1:121050405-121050427 AGGTAAAGCCCTGTCTCTTCAGG + Intergenic
915070535 1:153261852-153261874 AGGTAGGCGCCTGCTTCTGCTGG - Exonic
918878178 1:190078040-190078062 AGGTATGCCTCTGTGTCTTCAGG + Intergenic
922842915 1:228658802-228658824 AGTAAGGCCTCTGTATCCTCAGG + Intergenic
924424313 1:243936858-243936880 AGGTAGCCCCTTGTATCTGTGGG - Intergenic
1065504497 10:26415742-26415764 AGCTATGCCCCGGTGTCTTCAGG + Intergenic
1073103787 10:101020889-101020911 AGGAAGGCCCCTGTATCTCAGGG - Intronic
1081428246 11:42948986-42949008 AGGTAGGGCCCTGAATTTGCTGG + Intergenic
1081571780 11:44295876-44295898 GGCTAGGCCCCTGGATATTCGGG - Intronic
1085930550 11:81077664-81077686 ATGTAGGCACCTGTATGTTGTGG - Intergenic
1091874039 12:3918947-3918969 AGGTAGATCCCTGTGCCTTCGGG + Intergenic
1093502515 12:19828395-19828417 AGGAAGCCCCCTGTCTCTGCAGG - Intergenic
1100076857 12:90795586-90795608 AGGTAGGCCTCTACATCTTCAGG - Intergenic
1102955227 12:117054592-117054614 AGGAAGGCCCCTGCAACTCCAGG + Intronic
1103560057 12:121788919-121788941 TGGGAGGCCCCTGAAGCTTCTGG - Intronic
1106058214 13:26259230-26259252 AGTTAGTCCCCTGTGTCTGCAGG + Intronic
1112266482 13:97928466-97928488 AGGTTGGCCTCTGACTCTTCAGG - Intergenic
1115594420 14:34895414-34895436 GGTAGGGCCCCTGTATCTTCTGG + Intergenic
1122229346 14:100297844-100297866 GGGCAGGTCCCTGTATCTTTGGG - Intronic
1125032720 15:35088691-35088713 AGGTAGCCCCTTGCATCTTCTGG - Intergenic
1132952252 16:2569896-2569918 AGGGTGGCCCCCGTATCTGCAGG + Intronic
1132962099 16:2630274-2630296 AGGGTGGCCCCCGTATCTGCAGG - Intergenic
1138167992 16:54820534-54820556 AGATAGGCCCCTCCACCTTCAGG - Intergenic
1143225008 17:5294085-5294107 AGTTAGCCCTCTGTATCTGCGGG + Intronic
1149566683 17:57645293-57645315 AGTTAGCCCCCTGTATTCTCAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151599625 17:75098251-75098273 AGGCAGGCCTCTTAATCTTCTGG + Intronic
1154293623 18:13131402-13131424 AGGGAGGCCTCTGTGTCTTTAGG + Intergenic
1165735285 19:38171960-38171982 TGGTAGGGCCCTGAATGTTCTGG - Intronic
1166610402 19:44188324-44188346 ACGTAGCCCTCTGTATCTGCAGG + Intergenic
924981028 2:221808-221830 AGATAGGCTCCTGGATCTGCTGG - Intronic
926284915 2:11481578-11481600 AGACAGGCCCCTGTGTTTTCAGG - Intergenic
929828009 2:45325078-45325100 TGGTGGGTTCCTGTATCTTCTGG - Intergenic
930715954 2:54594262-54594284 AGTTAGCCCTCTGTATCTGCAGG + Intronic
937287722 2:120763637-120763659 AGGCAGGCCCCTCTGTCTGCAGG - Intronic
937335325 2:121058876-121058898 AGGTGGGCATCTGTTTCTTCTGG - Intergenic
941149241 2:161893344-161893366 AGTTGGCCCTCTGTATCTTCAGG + Intronic
944013195 2:194999571-194999593 AGGTAGCTCCTTCTATCTTCTGG + Intergenic
946263263 2:218514966-218514988 AGGTTGGCTCCTGTGTCTTTCGG + Intronic
948349667 2:237328332-237328354 AGGTAGGCACCTGTGGCTTCTGG - Intronic
1168951766 20:1807038-1807060 AGGTATGCCCATGTAAGTTCTGG - Intergenic
1170468498 20:16644604-16644626 GGATTGGCCACTGTATCTTCAGG - Intergenic
1173016828 20:39233388-39233410 ATGGAGGCCACTGCATCTTCTGG + Intergenic
1175366884 20:58461750-58461772 AGGTCAGCCCCTGTATCCCCCGG + Intronic
1179079546 21:38158227-38158249 AGGCAGGGCCCTGTATCCTATGG + Intronic
1181289290 22:21778575-21778597 AGGGAGAACCCTGTCTCTTCAGG + Intronic
1185382705 22:50517525-50517547 AGGGAGGCCCCTGCAGCTCCTGG + Intronic
949900860 3:8813808-8813830 AGGGAGGCCCCAGTAGCATCAGG - Intronic
953079879 3:39606974-39606996 AAATAGGCCCCAGTAGCTTCTGG + Intergenic
954418765 3:50407495-50407517 AGCTAAGCCCCAGTCTCTTCAGG - Intronic
957407179 3:79787106-79787128 AGGTAAGCACCTGAAACTTCAGG + Intergenic
958776336 3:98487440-98487462 AGGTTGGCCCCTGCAACTTCAGG + Intergenic
959323140 3:104904358-104904380 AGGCTGGCCCCTATAGCTTCAGG - Intergenic
961264047 3:125625964-125625986 AGGATGGACCCTCTATCTTCTGG + Intergenic
963214074 3:142724737-142724759 AGTTAGGCCCCTTTCTCCTCTGG + Intronic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
966083999 3:176044244-176044266 AAGTAGGCCCATGTATCTAGAGG + Intergenic
967043885 3:185718845-185718867 AGGTAAGATCCTGTATCTTTTGG + Intronic
969539042 4:7774411-7774433 AGGATGGCCCCTGTATCCGCAGG - Intronic
969639205 4:8386995-8387017 TGGGAGGCCCCTGGATCCTCGGG - Intronic
970193443 4:13535373-13535395 AGGAAGGTCACTGTATCTTTGGG - Intergenic
974349438 4:60725120-60725142 AGGCAGGCTCCAGTATCTTGAGG + Intergenic
974776537 4:66490344-66490366 TGGGAGACCCCTGTATCTTGTGG + Intergenic
975300181 4:72781090-72781112 TGCTAGGCCCCTGTAACTTGAGG + Intergenic
975601939 4:76110163-76110185 AGTTAGCCCTCTGTATCCTCTGG + Intronic
976850721 4:89541984-89542006 AGGTTGGCCTCTGTAGCTGCAGG + Intergenic
978241303 4:106519969-106519991 ATATAGGCCCCAGTCTCTTCTGG + Intergenic
982228574 4:153187730-153187752 AGGTAGACCCCTGGATGATCCGG + Intronic
983093926 4:163539972-163539994 AGGTATGCCCCTGTGCCTTCAGG - Intronic
984074152 4:175153972-175153994 AGTTAGCCCTCTGTAACTTCAGG + Intergenic
984193456 4:176631504-176631526 AGGAAAGCCCCTGAATCTTCAGG - Intergenic
985725878 5:1515525-1515547 TGGGGGGCCCCTGTATCTGCGGG - Intronic
986124544 5:4873111-4873133 TGGTAGGTCCATGCATCTTCTGG - Intergenic
989099953 5:37814068-37814090 TGGAAGGCCCCTGTGTCTCCCGG + Intronic
990516847 5:56538502-56538524 AGGTCATCCCCTGTTTCTTCAGG + Intronic
993442723 5:87976742-87976764 AAATAGGCCCCAGTGTCTTCTGG + Intergenic
995343075 5:111082176-111082198 AGACAGGCCCCAGTATCTTAGGG + Intergenic
995674964 5:114653302-114653324 AGGTAGGCCAGTGAAGCTTCAGG - Intergenic
996988111 5:129593096-129593118 AGAGAGGCCCCTGTATCATAGGG + Intronic
999586046 5:153090725-153090747 ATGTAGGCCTCTGTCTTTTCTGG - Intergenic
1000746103 5:165035996-165036018 ATTTAGGCCCCAGTCTCTTCAGG + Intergenic
1001286271 5:170426174-170426196 TCTTAGGCCCCTGTATCCTCAGG + Intronic
1001933205 5:175687466-175687488 AGCTTGGCCACTCTATCTTCTGG - Intergenic
1006252947 6:32805986-32806008 ATGTTGGCCCCAGTCTCTTCTGG + Intergenic
1006738564 6:36292111-36292133 AGGTAGGTCCCAGTGTCTTTCGG + Intronic
1006775564 6:36589910-36589932 AGTCAGCCCTCTGTATCTTCAGG - Intergenic
1009042428 6:58194913-58194935 ATGTAGGACTTTGTATCTTCAGG + Intergenic
1009218269 6:60949135-60949157 ATGTAGGACTTTGTATCTTCAGG + Intergenic
1013224117 6:108107431-108107453 AGGTATGCCCCTTTAGATTCTGG - Intronic
1014871852 6:126605678-126605700 AGGTAAGCCCCAATATCTACAGG - Intergenic
1017817101 6:158023651-158023673 GGGTAGGCCCTTCTCTCTTCTGG + Intronic
1018674298 6:166205764-166205786 AGGGAGGCCTGTGTATCTTTAGG + Intergenic
1020775317 7:12446205-12446227 AGGTATGCCCATGTGTCTTTGGG + Intergenic
1020980043 7:15055534-15055556 AGGTCGGCTCCTGAATCTTCAGG - Intergenic
1026259806 7:68745217-68745239 AGGTAGGCCCCTGGTGCCTCTGG - Intergenic
1026945534 7:74313690-74313712 AGGATGGCCCCTGCAGCTTCTGG + Intronic
1028251519 7:88544213-88544235 TGAGAGGACCCTGTATCTTCAGG + Intergenic
1030670073 7:112325921-112325943 AGGTAGGCCACAGTGGCTTCTGG - Intronic
1035395759 7:158533948-158533970 AGGGTAGCCCCTGCATCTTCAGG - Intronic
1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG + Intronic
1037539159 8:19855221-19855243 GGGTAGCCCCCTGCATCCTCAGG + Intergenic
1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG + Intergenic
1040483061 8:47843718-47843740 AAATAGGCCCCAGTCTCTTCTGG - Intronic
1047094792 8:121612986-121613008 AGGTAGGACCCAGTAAATTCAGG + Exonic
1049627631 8:143632971-143632993 AGGAAGGCCACTGTGTCTTCGGG - Intergenic
1055967381 9:81878888-81878910 AGGTGGGCCCTAATATCTTCAGG - Intergenic
1058313521 9:103535213-103535235 ATATAGGCCCCAGTCTCTTCTGG - Intergenic
1058362791 9:104170145-104170167 AGGTAGGCCCATGTACCCTGTGG - Intergenic
1058731001 9:107849850-107849872 TGGTAGGCGCCTGTGGCTTCAGG + Intergenic
1060913895 9:127372898-127372920 AGGTAGGCCCCTGTATCTTCTGG - Intronic
1188950405 X:36365647-36365669 AGGTAGGCCCCAGTGTCTATTGG + Intronic
1189678502 X:43488507-43488529 ATATAGGCCCCAGTCTCTTCTGG - Intergenic
1190283087 X:48944197-48944219 AGGATGGCGCCTGTCTCTTCCGG - Exonic
1190952574 X:55161280-55161302 AGGTCGGCTCCTGTTTCCTCTGG + Intronic
1196206914 X:112950523-112950545 AGGCAGGCCATTGTATCTTTGGG + Intergenic