ID: 1060914975

View in Genome Browser
Species Human (GRCh38)
Location 9:127382912-127382934
Sequence GAGAATGCCCTCCTGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060914975_1060914979 -2 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1060914979 9:127382933-127382955 TCCACCCAAGGGCTGCCGTCAGG No data
1060914975_1060914987 28 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1060914987 9:127382963-127382985 TCTTGACCGTTCACAAGTGTGGG No data
1060914975_1060914986 27 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1060914986 9:127382962-127382984 TTCTTGACCGTTCACAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060914975 Original CRISPR GAGAATGCCCTCCTGCAAGG TGG (reversed) Intronic
901821772 1:11834953-11834975 CAGAATGCCCTACTGCCAGCCGG + Intronic
903028889 1:20448783-20448805 GAGAATGCCCTCCTGGGCCGGGG - Intergenic
903297843 1:22356610-22356632 GAAACTGCCCTCCAGCAAGCAGG - Intergenic
903682078 1:25103758-25103780 GAGAAGCCCCTCATGCAGGGAGG - Intergenic
903739662 1:25551456-25551478 GAGAATGCCTGCTTGCAAGGTGG + Intronic
904132672 1:28286841-28286863 GAAAAGGCTCTCCTGCTAGGTGG - Intergenic
904923164 1:34024711-34024733 GCCAATGCCCTCCTCCAGGGAGG - Intronic
910471975 1:87563542-87563564 AATTATTCCCTCCTGCAAGGGGG + Intergenic
915948999 1:160175235-160175257 GAGAATGCCCTCCTGCGAACAGG + Intronic
918183057 1:182101826-182101848 GAGAATTTCCTCTTGCAAAGAGG + Intergenic
918662554 1:187107216-187107238 GATAATGGCCTCCAGCAAGCAGG + Intergenic
920125882 1:203693370-203693392 CAGTATGCCCTGCAGCAAGGCGG - Intronic
920979078 1:210815268-210815290 TATAATGCCCTCCCTCAAGGAGG + Intronic
921211221 1:212900301-212900323 AAGAATCCCCTGCTGCAAGTGGG + Intergenic
1064166008 10:12986968-12986990 AAGATTGCCCTCCAGCAAGGAGG - Intronic
1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG + Intronic
1067495088 10:46754406-46754428 CAAAATGCCCTCCTGGAAGCTGG - Intergenic
1067599567 10:47585990-47586012 CAAAATGCCCTCCTGGAAGCTGG + Intergenic
1070081572 10:73193918-73193940 GAGAATCCCCACCAGCAAGAAGG - Intronic
1071651097 10:87393874-87393896 CAAAATGCCCTCCTGGAAGCTGG + Intergenic
1072694014 10:97589865-97589887 GGGACTGCCCTCTTGCTAGGAGG + Exonic
1073573285 10:104599044-104599066 GAGAAGGGCCTTCTGCAAAGAGG - Intergenic
1077792897 11:5461041-5461063 GAGATTGCCCTACGGCATGGTGG + Intronic
1083153370 11:60807901-60807923 GAAAAGGCCCTTCTGCAAGATGG + Intergenic
1083291993 11:61695623-61695645 CAGAATGTCCTGCTGTAAGGAGG + Intronic
1087038600 11:93777090-93777112 GTTATTGCCCTCATGCAAGGGGG - Intronic
1091644391 12:2262918-2262940 GACAATTCCTACCTGCAAGGAGG + Intronic
1093163790 12:15781787-15781809 GAGAGTCCCCACCAGCAAGGAGG - Intronic
1094534351 12:31307781-31307803 GATATTGCCCTCATACAAGGGGG + Intronic
1095129526 12:38522884-38522906 GATAATTTCCTCCTGAAAGGAGG - Intergenic
1098673824 12:73264767-73264789 GAGAGTCCCCTCCAGCAAGAAGG - Intergenic
1099002306 12:77193138-77193160 GAGAATTCCCTTCTGAAAGAAGG - Intergenic
1099094186 12:78352741-78352763 TAGCATGCCCAGCTGCAAGGAGG + Intergenic
1104933771 12:132353854-132353876 GTGAATGCACACCTGCAAGAAGG + Intergenic
1106095259 13:26637787-26637809 GAGGATGCCATCCTGATAGGAGG - Intronic
1107474306 13:40720552-40720574 GAGAGTCCCCACCAGCAAGGAGG - Intergenic
1108378231 13:49833456-49833478 GAGAATGCCTTCCTCCTGGGTGG + Intergenic
1108530854 13:51325693-51325715 CAGATTGCCCTCCTGCATGTGGG + Intergenic
1113587068 13:111472878-111472900 GAGAATGAGCTCCTGAAAGGTGG + Intergenic
1113671536 13:112178889-112178911 GAGAAGGTCCTCCTCCTAGGAGG + Intergenic
1114929159 14:27445797-27445819 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1115438307 14:33402412-33402434 GAGAAGCACCTCCTGAAAGGAGG - Intronic
1117002723 14:51387468-51387490 AACCATGCCCTCCAGCAAGGGGG - Intergenic
1117206235 14:53446436-53446458 GATAATGCCATTCTTCAAGGTGG + Intergenic
1119546142 14:75472924-75472946 CAGTGTGCCCTCCTGCCAGGTGG + Intronic
1124341400 15:28891559-28891581 GAGCTTGCCCTCCAGGAAGGTGG + Intronic
1124982340 15:34578267-34578289 GAGCTTGCCCTCCAGGAAGGTGG - Intronic
1126645465 15:50870907-50870929 GATATAGCCCTCATGCAAGGAGG + Intergenic
1127765103 15:62178112-62178134 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1128086343 15:64889173-64889195 GACACTGACCTCCTGCCAGGTGG + Intronic
1128198669 15:65784773-65784795 CAGAAAGCCCTCCTCCAAGCAGG + Intronic
1128234401 15:66057852-66057874 GAGAAGACCCTGCTGAAAGGGGG - Intronic
1131177836 15:90221018-90221040 GGGAATGTCCTCCTGGAAGATGG + Exonic
1132282827 15:100634934-100634956 GAGAATGCCCCCTGGAAAGGAGG + Intronic
1133737827 16:8629331-8629353 GAGCAAGCACTCCAGCAAGGAGG - Intronic
1133929774 16:10222763-10222785 GGGATTCCCCTCCTGCCAGGAGG - Intergenic
1134407636 16:13975885-13975907 GAGAATGCTCTCCTGGCAGAAGG + Intergenic
1138305225 16:55968528-55968550 GAGAATTCCAGCCTGCAATGGGG - Intergenic
1141622421 16:85243525-85243547 GCACATGCCCTCCTGGAAGGCGG + Intergenic
1142890037 17:2937303-2937325 CTGAATGCCTTCCTGCAAAGAGG + Intronic
1147230230 17:39012329-39012351 GTGCTTCCCCTCCTGCAAGGCGG + Intergenic
1147611913 17:41806868-41806890 GAGCATGGCCTCCTGGAAGGAGG + Exonic
1147725875 17:42565922-42565944 GGGAATGCGCTTCTGCAAGAGGG - Exonic
1147766404 17:42839283-42839305 GCGATAGTCCTCCTGCAAGGAGG - Exonic
1148851228 17:50556348-50556370 CAACATGACCTCCTGCAAGGAGG - Intergenic
1152166149 17:78708172-78708194 GAGTCTGCCCTGCTGCCAGGTGG - Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1161353692 19:3807304-3807326 GAGAATGCCCTCGTGAAAGACGG + Intronic
1164678217 19:30117325-30117347 AGGAATGGCCTCCTGCAGGGAGG + Intergenic
926305365 2:11634117-11634139 GAGAACTCCCTGCTCCAAGGAGG - Exonic
927092296 2:19721302-19721324 GAGAATTCCCTCTTGCTTGGGGG - Intergenic
929027115 2:37615534-37615556 GAGAAAGCCAGCCTGCATGGAGG - Intergenic
934756027 2:96825358-96825380 GCGTGAGCCCTCCTGCAAGGGGG - Intronic
935259787 2:101344221-101344243 GGGAAAGCCCTGCTACAAGGAGG + Intergenic
936259845 2:110949277-110949299 GAGAAGGCCCTTCTACTAGGGGG - Intronic
938187477 2:129244484-129244506 GAGAAAGCTGGCCTGCAAGGTGG + Intergenic
942893298 2:181018259-181018281 CAGAATGCATTCCTCCAAGGTGG - Intronic
945578696 2:211565302-211565324 GAGTATGCCCTTCTGAAAGGTGG + Intronic
948395162 2:237640073-237640095 CTGTTTGCCCTCCTGCAAGGAGG + Intronic
949021851 2:241745251-241745273 AAGAATTCCCTCCTGTAATGGGG + Intronic
949077937 2:242073285-242073307 AAGAAGGCCCTGCTGCAGGGTGG + Intergenic
1169100369 20:2942603-2942625 GAGAATTCCCTCTTGCTTGGGGG - Intronic
1169399182 20:5265352-5265374 GAGAAAGCCCTCAGGCAAGGAGG - Intergenic
1170436763 20:16338371-16338393 GTGAATGGCTGCCTGCAAGGAGG - Intronic
1170990762 20:21300080-21300102 GAGAATTCCCTCTTGCTTGGGGG + Intergenic
1171011550 20:21512046-21512068 GGGAATGCCCGCCTGGAAGGTGG + Exonic
1172176750 20:32977108-32977130 GAGGATGAGATCCTGCAAGGGGG - Intergenic
1172486360 20:35300178-35300200 AAGAATCCTCACCTGCAAGGCGG + Intergenic
1174762377 20:53218587-53218609 GTGAATGCCCTGCTGGAAAGAGG - Intronic
1175965121 20:62656536-62656558 GGGGATGCCCTCCTGCTGGGTGG - Exonic
1178156551 21:29860370-29860392 AAGAATGCCCACCTGCAGGGAGG + Intronic
1178400629 21:32282062-32282084 GAGATTGCCCTCCTTCCTGGGGG + Intergenic
1179725160 21:43337890-43337912 GAGCACACCCTCCTGCCAGGTGG + Intergenic
1181118666 22:20650547-20650569 TAGTATGGCCACCTGCAAGGAGG - Intergenic
1181375453 22:22454391-22454413 CTGAACGCCCTCCTGCAAGAAGG + Intergenic
1184734715 22:46391368-46391390 GAGCAGGGCCTCCTGCAGGGAGG - Intronic
949203293 3:1406942-1406964 GATGATGCCCACCTGCAATGAGG + Intergenic
950544793 3:13631920-13631942 GAGAATGCCCTTCTGCACCAGGG - Intronic
950557401 3:13703869-13703891 GAGAGAGCCCTCATGTAAGGAGG + Intergenic
952220725 3:31321532-31321554 GAGAATGGCTTCCTGGAACGTGG - Intergenic
953603603 3:44391672-44391694 GAAGAGGCCCTCCTGGAAGGAGG + Intronic
953928929 3:46996440-46996462 GATGCTGCCCTCCTGCAGGGGGG - Exonic
954558346 3:51535891-51535913 GACAATGCCATCCTGGGAGGAGG + Intergenic
955368310 3:58330558-58330580 ACGAATGCCCTCCAGAAAGGTGG + Intergenic
955518684 3:59753083-59753105 CATAATCCCCTCCTTCAAGGTGG + Intronic
959151963 3:102618584-102618606 GAGTATGACCTCCAGCAAGGTGG - Intergenic
960544850 3:118902462-118902484 TGGAATGCCCTCATACAAGGGGG - Exonic
961162961 3:124745176-124745198 GAGAAAGCCCACATTCAAGGTGG + Exonic
962390181 3:134965323-134965345 GAACATGTCATCCTGCAAGGTGG - Intronic
963285474 3:143430757-143430779 GACCATGCCCACCTGGAAGGTGG - Intronic
966670200 3:182517817-182517839 AAGAATGCCATCCTTTAAGGAGG - Intergenic
968562540 4:1292169-1292191 GAGCAAGTCCTCCTGCAGGGTGG + Intronic
974896255 4:67943019-67943041 TAGAATGATTTCCTGCAAGGGGG + Intronic
975847643 4:78541773-78541795 GAGAACTCCCTCCTACAAAGGGG + Intronic
977928033 4:102723159-102723181 AAGTGTTCCCTCCTGCAAGGAGG - Intronic
978619004 4:110621399-110621421 CAGCATGCCCACCTGCAACGCGG + Intronic
979810488 4:125030150-125030172 AACAATGCCCTCCTGCAATGTGG - Intergenic
980093063 4:128462295-128462317 GTGATTTGCCTCCTGCAAGGAGG + Intergenic
980991863 4:139745148-139745170 GAGAGCGGCCACCTGCAAGGAGG + Intronic
985627210 5:995274-995296 AACAATGCCCTCCTGCAGGCAGG - Intergenic
987001839 5:13667774-13667796 GAGAATGGCCAGCTGCATGGTGG + Intergenic
992102635 5:73422047-73422069 GAGATTGCCTCCCTGGAAGGTGG + Intergenic
992106750 5:73454606-73454628 GAGAATGCCTTCTTGCAAAGGGG - Intergenic
997406918 5:133656443-133656465 GAGAAAGCCCTTGGGCAAGGAGG + Intergenic
1001099997 5:168806451-168806473 GACGATGCCCTCCGGCAAGTTGG + Exonic
1001440758 5:171741030-171741052 GAGAGTCCCCACCTGCAAGAAGG - Intergenic
1002403620 5:179011016-179011038 GAGAATGCAGCCCTGCATGGTGG + Intergenic
1002427470 5:179184819-179184841 GAGCCAGCCCTCCTGCCAGGAGG + Intronic
1002571675 5:180143183-180143205 CAGAGTGCCCCCCTGCAGGGTGG - Intronic
1003616417 6:7659020-7659042 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1004247757 6:13996446-13996468 GAGAGTGCCCACCAGCAAGCAGG - Intergenic
1004573406 6:16869740-16869762 GCGAAGGACCTCCTGAAAGGAGG + Intergenic
1006402302 6:33824969-33824991 GCCCATGCCCTCCTCCAAGGGGG - Intergenic
1006957622 6:37889158-37889180 GAGCATGCCCTCCTCAAATGAGG + Intronic
1010583131 6:77623892-77623914 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1011704736 6:89989596-89989618 GAGAAGGTCCTCCTGGCAGGTGG + Intronic
1015595133 6:134859310-134859332 GAGAATGCTCTCCTACTTGGGGG - Intergenic
1016545929 6:145224120-145224142 GTCTATGCCCACCTGCAAGGTGG + Intergenic
1017829747 6:158115604-158115626 CAGAAAGGCCTTCTGCAAGGTGG + Intronic
1021183344 7:17533960-17533982 GAAAATGCCCACCAGCAAGAAGG - Intergenic
1025220095 7:57100307-57100329 GAGAATTCCCTCTTGCTTGGGGG + Intergenic
1025630875 7:63271887-63271909 GAGAATTCCCTCTTGCTTGGGGG + Intergenic
1025651595 7:63474727-63474749 GAGAATTCCCTCTTGCTTGGGGG - Intergenic
1030180945 7:106708599-106708621 GAGAATGTCCACCTGCGAGGAGG + Intergenic
1031205178 7:118747362-118747384 CAGAAAGCCCTCCTGGAAGACGG - Intergenic
1032488129 7:132303782-132303804 GAGACAGGCCTCCTGGAAGGCGG - Intronic
1035556220 8:569182-569204 TAGCCGGCCCTCCTGCAAGGCGG + Intergenic
1035657635 8:1322773-1322795 GAGAAGGCCCTGATGCAGGGGGG - Intergenic
1038296989 8:26302045-26302067 GAGAAAGAACTTCTGCAAGGGGG + Intronic
1038672845 8:29596387-29596409 GAGACTTCCCTCCTACAGGGAGG + Intergenic
1039449800 8:37663297-37663319 GAGAATTCCCGCCAGCAAGAAGG - Intergenic
1039613495 8:38937207-38937229 GAGAATGACCTCAGGGAAGGAGG + Intronic
1045362078 8:101442202-101442224 GAGAATGCCATCCTGAGACGAGG + Intergenic
1047037160 8:120952767-120952789 GCCAATCCCTTCCTGCAAGGAGG - Intergenic
1048178630 8:132175280-132175302 CAGAAGACCCTCCTTCAAGGTGG - Intronic
1053830867 9:42079240-42079262 GAGGTTGCCCTGCTGCATGGGGG - Intronic
1054599689 9:67108197-67108219 GAGGTTGCCCTGCTGCATGGGGG + Intergenic
1055754452 9:79543016-79543038 ACGAATGCCCTCTTCCAAGGAGG - Intergenic
1056217574 9:84419502-84419524 GAGAATGAGCCCCTGCAATGTGG - Intergenic
1056600982 9:88046786-88046808 CAGAATTCCCTCCTCCATGGGGG + Intergenic
1059544115 9:115159169-115159191 CAGAATGCCCTCCCCCAAGAAGG - Intronic
1060845636 9:126835026-126835048 GAGAATACACTCTTTCAAGGTGG + Exonic
1060914975 9:127382912-127382934 GAGAATGCCCTCCTGCAAGGTGG - Intronic
1061922666 9:133790783-133790805 GAGAATGCCCTCCGCGAACGTGG - Intronic
1062534136 9:137014164-137014186 GACAATGTCAGCCTGCAAGGTGG - Exonic
1188551201 X:31366416-31366438 GAGAATGGTCTTCTGCCAGGTGG - Intronic
1191676352 X:63795831-63795853 GAGAATGCCTTACTGTGAGGAGG - Intergenic
1192110209 X:68356274-68356296 GAGAATCCCCTCTTGCTTGGGGG - Intronic
1197551498 X:127897962-127897984 GAGAATGCCCACATGGAAGATGG + Intergenic
1199751476 X:150823681-150823703 GAGAGTCCCCACCTGCAAGAAGG - Intronic