ID: 1060914975

View in Genome Browser
Species Human (GRCh38)
Location 9:127382912-127382934
Sequence GAGAATGCCCTCCTGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060914975_1060914987 28 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC No data
Right 1060914987 9:127382963-127382985 TCTTGACCGTTCACAAGTGTGGG No data
1060914975_1060914979 -2 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC No data
Right 1060914979 9:127382933-127382955 TCCACCCAAGGGCTGCCGTCAGG No data
1060914975_1060914986 27 Left 1060914975 9:127382912-127382934 CCACCTTGCAGGAGGGCATTCTC No data
Right 1060914986 9:127382962-127382984 TTCTTGACCGTTCACAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060914975 Original CRISPR GAGAATGCCCTCCTGCAAGG TGG (reversed) Intronic