ID: 1060916385

View in Genome Browser
Species Human (GRCh38)
Location 9:127393943-127393965
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060916376_1060916385 30 Left 1060916376 9:127393890-127393912 CCAGAGAACAGCTACTCCTTGTG No data
Right 1060916385 9:127393943-127393965 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1060916378_1060916385 14 Left 1060916378 9:127393906-127393928 CCTTGTGGTTAAAAGTATTCTCA No data
Right 1060916385 9:127393943-127393965 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060916385 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr