ID: 1060917960

View in Genome Browser
Species Human (GRCh38)
Location 9:127402605-127402627
Sequence CATGAGAAGCAGCATGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060917960_1060917970 29 Left 1060917960 9:127402605-127402627 CCTCCCTCATGCTGCTTCTCATG 0: 1
1: 1
2: 1
3: 43
4: 322
Right 1060917970 9:127402657-127402679 GCTGACTCAGCACAGGCGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1060917960_1060917968 22 Left 1060917960 9:127402605-127402627 CCTCCCTCATGCTGCTTCTCATG 0: 1
1: 1
2: 1
3: 43
4: 322
Right 1060917968 9:127402650-127402672 GCTTCCTGCTGACTCAGCACAGG 0: 1
1: 0
2: 2
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060917960 Original CRISPR CATGAGAAGCAGCATGAGGG AGG (reversed) Exonic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
901879574 1:12185896-12185918 CATGAGGAGAGCCATGAGGGAGG + Intronic
903036286 1:20494754-20494776 TATGAGAGGCAGCATGGGTGAGG - Intergenic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903744227 1:25575930-25575952 CAAAAGCAGCAGCATGAGGCTGG + Intergenic
904034255 1:27550603-27550625 CTTGAGCAGCAGCCTGAGCGTGG - Exonic
906536086 1:46551682-46551704 AATGAGAGGCAGGGTGAGGGGGG + Intergenic
908206234 1:61852729-61852751 GATGAGAAGCAGCCTGAGTCAGG + Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
912566322 1:110590127-110590149 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
913566774 1:120080401-120080423 CAAGAGACGGAGCAAGAGGGGGG - Intergenic
914287529 1:146241108-146241130 CAAGAGAGGGAGCAAGAGGGGGG - Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916415381 1:164587858-164587880 GATGAGAAGGAGGATCAGGGAGG - Intronic
917191862 1:172426517-172426539 AATGAGAGGCAGGGTGAGGGTGG - Intronic
919658793 1:200222944-200222966 CATGGGAAGAAGTATGAGAGTGG + Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921006642 1:211100318-211100340 CATGAGAAGTAATATGAGGTTGG - Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1063309674 10:4940515-4940537 CATGAGAATGTGCATGAGTGAGG - Intronic
1063317617 10:5021586-5021608 CATGAGAATGTGCATGAGTGAGG + Intronic
1064233971 10:13556163-13556185 CAAGAGAAGCAGCTTGGAGGTGG + Intergenic
1064883706 10:20085744-20085766 CAAGAGAATCATCTTGAGGGAGG - Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065852312 10:29801041-29801063 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
1066001885 10:31112252-31112274 CATGACAGGAAGCATGAGGCTGG + Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1069490640 10:68857677-68857699 CATTAGAAGCAGGATGGGTGTGG + Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074324337 10:112433570-112433592 CCTGAGAAGCTTCATGAGGGCGG - Intronic
1074639056 10:115358073-115358095 CAAGAGAAGCAGGATCATGGAGG - Intronic
1074778794 10:116785635-116785657 CATGAACAGCAGCATGCGGTGGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075895858 10:125994064-125994086 CATAAGGAGCAGGAAGAGGGAGG + Intronic
1076214681 10:128683942-128683964 CTTGAGAAGGGGGATGAGGGAGG - Intergenic
1076523834 10:131098124-131098146 CATGACAGGCAGCATGATAGAGG + Intronic
1077204635 11:1336629-1336651 CCTGAGAAGCAGCGGGACGGCGG + Intergenic
1078102463 11:8337877-8337899 CCTGAGAAGCTGCATTTGGGTGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079592129 11:22193442-22193464 CCTGAGAGGCAGCAGGAGAGGGG - Exonic
1079810010 11:24985949-24985971 CATGAGAAGTAACATGAGTATGG + Intronic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1080646444 11:34191611-34191633 CAAGACAAGCAGCATGGGAGGGG + Intronic
1080740347 11:35058051-35058073 GATGAGAAACACTATGAGGGAGG + Intergenic
1082283608 11:50298060-50298082 AATGAGAGGCAGCCTGAGAGGGG + Intergenic
1083205334 11:61145424-61145446 CCTGAGATGCTGTATGAGGGCGG - Intronic
1083684850 11:64369950-64369972 GATGTGCAGCAGCACGAGGGAGG + Intronic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086145064 11:83542659-83542681 TATGAGTGGCAGCATGAGGGAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1088097368 11:106116327-106116349 CATGTGAAACACCATGATGGTGG - Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089925978 11:122258181-122258203 CATGATTAGCAGCATCAGAGGGG - Intergenic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1091399911 12:175402-175424 CTTGGGCAGCAGCATGAGGCTGG + Exonic
1091909030 12:4213933-4213955 CATGAGAAGGATCACCAGGGAGG - Intergenic
1092679900 12:10967465-10967487 CTTGAAAAGCAGCATGGAGGTGG - Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094304140 12:28998769-28998791 CATGAGAAGCCACGTGTGGGCGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097274003 12:57799114-57799136 TATGGGAAGCAGTATTAGGGTGG + Intronic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097909691 12:64956735-64956757 CATGACAAGTAGTGTGAGGGTGG - Intergenic
1098182356 12:67861345-67861367 CATGAGATTCAGCCAGAGGGAGG - Intergenic
1099510441 12:83529288-83529310 CACTAGTAGCAGGATGAGGGAGG - Intergenic
1100713659 12:97283591-97283613 CATCAGCAGTGGCATGAGGGTGG + Intergenic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1101552205 12:105773498-105773520 CAAGAGAAGCAGGATGAGAGAGG + Intergenic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1104178138 12:126352164-126352186 CATCAGAACCACCATGAGGTGGG - Intergenic
1104529412 12:129554745-129554767 CATCAGATGCTGCAGGAGGGAGG + Intronic
1105005787 12:132719758-132719780 CTCGGGAAGCAGCGTGAGGGTGG + Intronic
1107286996 13:38804756-38804778 CATGAGAGAAAGCTTGAGGGAGG + Intronic
1107527902 13:41251529-41251551 CCTGAGCAGCAGCATGCTGGTGG - Intronic
1108151677 13:47542427-47542449 CATGAGAAGAAGAATTATGGGGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1113612206 13:111655077-111655099 CATGAAAAGCAGCAAGATGTAGG + Intronic
1113838006 13:113342033-113342055 CACAAGAATCAGCTTGAGGGAGG - Intronic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1118524519 14:66623937-66623959 TATCAGAAGCTACATGAGGGAGG + Intronic
1119543725 14:75457073-75457095 CATGAGATGCGGGCTGAGGGTGG - Intronic
1120095022 14:80378779-80378801 CATGAGAAGCAGAATGCAAGAGG + Intronic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1121026614 14:90620979-90621001 CAAGAGGAACAGCATGAGAGAGG + Intronic
1121224291 14:92309879-92309901 CATGAGTAGCAGAATCAGGTAGG - Intergenic
1121290026 14:92766587-92766609 AATGAGAACCAGCCTGAGAGGGG + Intergenic
1121434179 14:93908044-93908066 CATGAGAAACACCATGGGCGAGG - Intergenic
1122326453 14:100883547-100883569 CATGAGCAGCAGGAAGAGGTGGG + Exonic
1122562972 14:102630238-102630260 CCAGAGAAGCAGCAAGAGAGAGG - Intronic
1122846554 14:104503220-104503242 CAAGAGAAGAAGCAAGATGGGGG - Intronic
1125446169 15:39759731-39759753 CATCAGAAGCTGGAAGAGGGAGG - Intronic
1126421705 15:48480519-48480541 TATGAGAAGAAGCATGAAGCTGG - Intronic
1126727900 15:51651601-51651623 CTTGAGATGCAGCATGAGTGAGG + Intergenic
1127238243 15:57080589-57080611 CAAGAGAAACAGCATGATAGGGG - Intronic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129465242 15:75721166-75721188 CAGGAGGGGCAGCATGAGTGAGG + Intergenic
1130200238 15:81819276-81819298 AATGAAGAGGAGCATGAGGGAGG - Intergenic
1130982749 15:88823941-88823963 CATAAGAAGCCCCAGGAGGGAGG - Intronic
1132084689 15:98898152-98898174 CATCAGAAGTACCATGAGAGTGG - Intronic
1132147694 15:99438187-99438209 CATGTGGACCAGCAGGAGGGCGG - Intergenic
1132408567 15:101560091-101560113 CATGAGAGCCAGCATTTGGGTGG + Intergenic
1134004647 16:10810265-10810287 CATGAGCCACTGCATGAGGGTGG - Intronic
1134229306 16:12416724-12416746 CAAGAGAAGGAGCAAGAGAGAGG + Intronic
1136170349 16:28485726-28485748 GATTAGAAGTAGGATGAGGGTGG - Intronic
1137570506 16:49563289-49563311 CAAGAGAGGGAGCAAGAGGGAGG - Intronic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1140300020 16:73748534-73748556 CATGAGCAACAGCATAAGGGAGG - Intergenic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141489643 16:84363484-84363506 CATGAGAAGCTGGAAGAGGCAGG - Intergenic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1143610376 17:8014517-8014539 CATGAGAGGGCCCATGAGGGGGG + Intronic
1144188163 17:12815762-12815784 CTTGAGAAGCTTCATGGGGGAGG + Intronic
1146274586 17:31508627-31508649 CCTGGGAAGCACCAAGAGGGAGG - Intronic
1146804553 17:35855011-35855033 CCTGAGAAGCATCTTCAGGGAGG + Exonic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147529026 17:41256036-41256058 CTTGTGAATCAGCTTGAGGGAGG + Exonic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1147530521 17:41271981-41272003 CTTGTGAATCAGCTTGAGGGAGG + Intergenic
1147645152 17:42028870-42028892 CGTGGGAAGCAGCATGAGTGGGG - Exonic
1148212877 17:45818806-45818828 GATCAGATGCAGCAGGAGGGAGG - Intronic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148550381 17:48546769-48546791 TCTGAGTAGAAGCATGAGGGTGG + Intergenic
1148673628 17:49432026-49432048 CATGAGAGGCAGCATGGTGCTGG + Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152732540 17:81979425-81979447 CATGAGAAGCTGGAAGAGGCAGG - Intronic
1152734865 17:81992354-81992376 CCTGAGATCCCGCATGAGGGAGG + Intronic
1152778468 17:82216091-82216113 CAGGAGAAGCCGCATGATGGTGG - Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1158008450 18:52700517-52700539 CATGAAAAGGAGCCTGTGGGGGG - Intronic
1161084903 19:2330483-2330505 CACCAGAAGCAGCATAAGCGGGG + Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1162432592 19:10637912-10637934 CATGAGAAACATCATCAGGTCGG + Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164458608 19:28429076-28429098 TATGGGAACCAGCGTGAGGGAGG + Intergenic
1165046990 19:33112888-33112910 CATGAGCAGCAACAAGAAGGTGG - Intronic
1167087456 19:47320115-47320137 CATGTTGAGCAGGATGAGGGAGG - Exonic
1167105734 19:47429186-47429208 CATGAGAACCAGCTTTGGGGAGG - Exonic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926138814 2:10356414-10356436 CAAGAGGAGAAGCTTGAGGGAGG + Intronic
926997390 2:18751191-18751213 CAAGAGAAGCTGAATGATGGGGG - Intergenic
928305572 2:30167691-30167713 CGTGAGGAGGAGCATGTGGGTGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932024424 2:68119272-68119294 CTTGTGAGGCAGCATGAGTGAGG + Intergenic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
934759741 2:96847764-96847786 CGTGGCAAGCAGCCTGAGGGAGG - Intronic
934988672 2:98905288-98905310 CAAGAGAGGCAGCAAGAGAGAGG - Intronic
935265647 2:101391639-101391661 TATAAGAAGCAGCATCAGGCTGG + Intergenic
938063425 2:128268900-128268922 GCTGTGACGCAGCATGAGGGGGG + Intronic
938508846 2:131918302-131918324 CATGAGAAGCATCACGTGGATGG - Intergenic
942765821 2:179455383-179455405 CATGAGAACCAGCAGCATGGAGG - Intronic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943724553 2:191239447-191239469 CATGAGAAACTCCATGAGGGTGG - Intergenic
946242334 2:218364362-218364384 GATGAGAAGCGGTATGCGGGGGG - Intronic
946252306 2:218421178-218421200 GGTGAGAGGCAGCATGGGGGTGG + Intronic
947535236 2:230935969-230935991 CATCAGTATCAGCATGAGGGAGG + Intronic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1169270905 20:4198798-4198820 TATGACAAGGGGCATGAGGGAGG - Intergenic
1169677669 20:8172831-8172853 CCAGAGAAGCAGCATGGGGCAGG + Intronic
1169942302 20:10950444-10950466 CATGAGGAGCAGGATGAATGGGG - Intergenic
1170547704 20:17449222-17449244 CATGAGCTGCAGGATTAGGGTGG + Intronic
1172474321 20:35226297-35226319 CCTGAGAGGCAGCCTGGGGGAGG - Intergenic
1172838045 20:37885604-37885626 CCTGGGAAGCAGCATGGGGTGGG - Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173911228 20:46672486-46672508 GATGGGAAGCCGCATGAAGGAGG - Intronic
1174498578 20:50967343-50967365 GATGGGAAAGAGCATGAGGGAGG - Intergenic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1176784646 21:13240246-13240268 CATGAGAAGCATCACGTGGATGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177982694 21:27934091-27934113 CATGAGAAGCATCACGTGGACGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179142861 21:38742003-38742025 TATGAGAAGTAGCTTGAGGGTGG - Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1182358230 22:29732164-29732186 CTGGAGAAGCAGCATGCGTGGGG - Intronic
1183565158 22:38609149-38609171 CATTACAGGCAGCAGGAGGGAGG + Intronic
1183655137 22:39180094-39180116 CCTGAGAAACAGCATCGGGGAGG + Intergenic
949895948 3:8767789-8767811 CATGAGCAGCAGCAGGTAGGTGG + Exonic
949977503 3:9474503-9474525 CCTCCGAAGCAGCGTGAGGGTGG + Exonic
950160488 3:10757094-10757116 GAAGAGAAACAGCATGAGTGTGG - Intergenic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950847591 3:16030010-16030032 CATGAGAAGCTGCATGGGCAGGG + Intergenic
953764749 3:45729703-45729725 CCTGAAAAGCAGCAAGAGAGAGG - Intronic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955618899 3:60839968-60839990 TCTGAGAGGCAGCATGAAGGTGG - Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
957117960 3:76050599-76050621 CACGAGAACCAGCCTGTGGGTGG - Intronic
957345403 3:78954597-78954619 CATGAAAAACAGCATTTGGGTGG + Intronic
959468127 3:106715508-106715530 CATGGGAAGGACCTTGAGGGAGG + Intergenic
959694174 3:109231790-109231812 GGTGAGAAGCAGCTTGATGGTGG + Intergenic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961311841 3:126007343-126007365 CAAGAGAAGCTGGATGAAGGAGG - Intronic
961392157 3:126558549-126558571 CTTGGGAAGCAGCAACAGGGTGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962539292 3:136362253-136362275 CATGAGAAGAGGCATTAGGCTGG - Intronic
962865552 3:139445610-139445632 CATGAGAGGGACCATGCGGGAGG - Intergenic
962978462 3:140466744-140466766 CATGAGTAGCAGCAGGTGTGAGG - Intronic
963025265 3:140913093-140913115 CAAGAGGAGCAGTTTGAGGGAGG - Intergenic
964407161 3:156361139-156361161 GATGAGAAGAATGATGAGGGCGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966963502 3:184966157-184966179 CATGAGAGGGAGCAAGAGTGGGG + Intronic
967201842 3:187078937-187078959 CTTGAGAAGGAGCATGAGTTAGG + Intergenic
967865597 3:194187439-194187461 CATGGGAGGCAGCTAGAGGGTGG + Intergenic
968332701 3:197885176-197885198 TCTGAGGAGCAGCAGGAGGGCGG - Intronic
969305731 4:6325370-6325392 CAAGGGAAGCAGCATGCGAGGGG + Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969695191 4:8730257-8730279 CATGAGAAGGAGCAGGGGTGGGG + Intergenic
969964702 4:10982372-10982394 CATGAGTAGCACGTTGAGGGAGG + Intergenic
970058136 4:11999105-11999127 CAAGAGAGGAAGCAAGAGGGAGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971455382 4:26839510-26839532 TGTGGGAAGGAGCATGAGGGAGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
978379093 4:108107785-108107807 AGTGAGAAGCAGCATGTTGGGGG - Intronic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983381013 4:166993487-166993509 AAAGAGAAATAGCATGAGGGTGG - Intronic
984088404 4:175340401-175340423 CCTGAGAAGCAGCAGCAGAGAGG - Intergenic
984103839 4:175519584-175519606 GATGAGAAGCAGCAAAAAGGTGG - Intergenic
985810310 5:2078275-2078297 CATGTGAGGCAGCCTGAGAGAGG + Intergenic
986801998 5:11270635-11270657 CATGAGAAGCAGCATTAGAAAGG + Intronic
987093174 5:14525448-14525470 CATGGGAAGAAGGATGAGGCAGG - Intronic
988523437 5:31966011-31966033 CATGATGAGCAGCATTAGGATGG + Intronic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
989166267 5:38436339-38436361 CCTGAGATGGAGCATGAGGGAGG + Intronic
989220372 5:38953694-38953716 CTTGAGAAGCAGCATAGGGCAGG + Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
998133146 5:139661075-139661097 CATGGGGAAGAGCATGAGGGCGG - Intronic
998392672 5:141797422-141797444 TGTGAGAAGAAGCAGGAGGGAGG - Intergenic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999273221 5:150310381-150310403 GATGAGAAGCAGGTTGAGAGAGG - Intronic
999495414 5:152091671-152091693 TTTGGGAAGCAGCATGATGGAGG + Intergenic
1000610527 5:163368604-163368626 CAAGAGAAGAAGCAAGAGAGAGG - Intergenic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001680258 5:173551784-173551806 CATCAGAGGAAGCATGAGAGAGG + Intergenic
1001750993 5:174131312-174131334 CATAAGAATCAGCAGGAAGGTGG + Intronic
1002579386 5:180198553-180198575 CATGTGAAGATGCAGGAGGGAGG - Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1004075963 6:12344417-12344439 CATCAGAAACAGCTTGAGTGAGG + Intergenic
1004425252 6:15502676-15502698 CATGAGATGCAGCCTGAGGCGGG - Intronic
1005526624 6:26657843-26657865 CAAGAGAAGCATCCTGAAGGAGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009723834 6:67510404-67510426 CAAGTGAAGAAGCATGAGGTAGG - Intergenic
1010334684 6:74666651-74666673 CATCAGTAGTAACATGAGGGAGG - Intergenic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1011702892 6:89971987-89972009 AATGAGCTGCAGCCTGAGGGAGG + Intronic
1014009191 6:116457636-116457658 CTTGGAAAGCAGCCTGAGGGAGG - Intergenic
1014730278 6:125024280-125024302 CATGATAAGGAACATGAAGGAGG + Intronic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1017190987 6:151652380-151652402 CATGAGAGGGAGCAAGAGTGGGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1018000265 6:159572630-159572652 CATGAGGAACTGGATGAGGGAGG - Intergenic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018719483 6:166561873-166561895 CATACCAAACAGCATGAGGGAGG + Intronic
1019048829 6:169167932-169167954 CCTGAGAACCAGCCTGAGGCTGG - Intergenic
1019828764 7:3304930-3304952 CATGAGAATCACCTGGAGGGAGG - Intronic
1021789886 7:24194275-24194297 TAAGAGAAGGAGCAAGAGGGAGG + Intergenic
1022892542 7:34715835-34715857 CATGAGGAGCAGCACCTGGGTGG + Intronic
1023555828 7:41421914-41421936 GATTAGAAGCATCATGAGGTAGG - Intergenic
1023602180 7:41890959-41890981 CAAGAGTGGGAGCATGAGGGAGG + Intergenic
1023884667 7:44345201-44345223 CATCCAAAGCAGCATGAGGCAGG + Intergenic
1024346198 7:48316772-48316794 CAAGAGAGGAAGCAAGAGGGGGG + Intronic
1024385680 7:48748795-48748817 CAGGCGAAGCAGCATGGGGGAGG + Intergenic
1024617249 7:51126401-51126423 CATGAAGATCAGGATGAGGGTGG - Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1028831133 7:95327602-95327624 AATGAGAAGCCACAAGAGGGAGG - Intergenic
1032331610 7:130985923-130985945 TATAAGAAGCTCCATGAGGGTGG + Intergenic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035117966 7:156540757-156540779 CATGAGAAGCAGGGAGAGGGTGG + Intergenic
1035633888 8:1128909-1128931 CATCAGAAGCTCCATGAGGCAGG + Intergenic
1036227429 8:6971522-6971544 TATGAGAAGGAGGAGGAGGGTGG - Intergenic
1036669788 8:10775350-10775372 TTTGAGAAGCAGCATGCTGGAGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036810485 8:11865032-11865054 CCTGAGAAAGAGCATGTGGGAGG - Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1038351410 8:26779534-26779556 CATGACAAGCAGGATGATGAAGG + Intronic
1038479917 8:27894774-27894796 CATGGGAAGCTGCGTGAAGGGGG + Intronic
1046311426 8:112442124-112442146 CAAGAGAAGGAGCAAGAGAGAGG + Intronic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1046997714 8:120542967-120542989 CATGAGGAGCACCCTGAGTGCGG + Intronic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1048823237 8:138398615-138398637 CATTAGAAGCTGCATGTGGGAGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1050125043 9:2348016-2348038 CAGGAGAAGGAGCAAGAGTGGGG - Intergenic
1051594363 9:18809491-18809513 CATGAAAAGGAGCTTGAGGCCGG + Intronic
1051784786 9:20730553-20730575 CTTTAGAAGCAGCTTGAGAGAGG + Intronic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1057078031 9:92150200-92150222 CATGACAGGCAGCATGATAGAGG + Intergenic
1057108501 9:92444737-92444759 CAGGCAAAGCAGCATGGGGGAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1058636365 9:107042244-107042266 CAAGAGAAGGAGCAAGAGAGAGG - Intergenic
1058899603 9:109430802-109430824 CATGAGGAGCAGCAGGAGAGGGG - Intronic
1059331268 9:113537215-113537237 CATGCCAGGCAGCATCAGGGAGG - Intronic
1059877627 9:118653281-118653303 CATGAGCAGAAGCATGGAGGTGG + Intergenic
1060535868 9:124387541-124387563 CATGGGAAGCAGAATCAGGTTGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061764883 9:132875359-132875381 CATGAGCAGAGGCATGAGGGGGG + Intronic
1062098939 9:134717988-134718010 CATGAGAAGCAGCCTGGGCTGGG + Intronic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1185806117 X:3058915-3058937 CATGAGCAGTTGCATGAAGGTGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1192989857 X:76438829-76438851 CATGAAAGGAAGCATGAGAGAGG - Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1197180050 X:123525133-123525155 CATTAGCAGCAGCAAGAGGGAGG - Intergenic
1197371152 X:125627678-125627700 CATGAGAAGCAGTGTCAGGACGG - Intergenic
1197798525 X:130324085-130324107 CATTATTAGCAGCATGAGAGAGG - Intergenic
1197884970 X:131209027-131209049 CATGAGAAGCTGCCTGAAGTGGG - Intergenic
1197885195 X:131210826-131210848 CATGAGAAGCTGCCTGAAGTGGG - Intergenic
1198471417 X:136950458-136950480 AATGAGAAGCAGCGAAAGGGGGG - Intergenic
1199810826 X:151346939-151346961 AATGGGAAGCAGCATAAGGGAGG + Intergenic
1201462062 Y:14237205-14237227 TATGAGAAAGAGCATGAGAGTGG - Intergenic