ID: 1060918701

View in Genome Browser
Species Human (GRCh38)
Location 9:127405849-127405871
Sequence CTCTTCCCATGTAAGACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060918701_1060918706 8 Left 1060918701 9:127405849-127405871 CCTAAGGTCTTACATGGGAAGAG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1060918706 9:127405880-127405902 GCTGGGCTGCAGCCCCACCCTGG No data
1060918701_1060918705 -9 Left 1060918701 9:127405849-127405871 CCTAAGGTCTTACATGGGAAGAG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1060918705 9:127405863-127405885 TGGGAAGAGTTGACAGGGCTGGG No data
1060918701_1060918704 -10 Left 1060918701 9:127405849-127405871 CCTAAGGTCTTACATGGGAAGAG 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1060918704 9:127405862-127405884 ATGGGAAGAGTTGACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060918701 Original CRISPR CTCTTCCCATGTAAGACCTT AGG (reversed) Intronic
900740035 1:4325443-4325465 CTCTTTCGTTGTGAGACCTTGGG + Intergenic
901978033 1:13010932-13010954 CCCTTGCCTGGTAAGACCTTAGG + Intronic
902004053 1:13218006-13218028 CCCTTGCCTGGTAAGACCTTAGG - Intergenic
902023276 1:13363750-13363772 CCCTTGCCTGGTAAGACCTTAGG - Intergenic
902168009 1:14588041-14588063 CTCTTGAGCTGTAAGACCTTGGG + Intergenic
902654543 1:17858518-17858540 CTCTTGCCATGCCAGACCTTGGG - Intergenic
906967758 1:50475497-50475519 CTCATCCCATGGAAATCCTTTGG + Exonic
907240869 1:53080335-53080357 CTCTGCCCATTTGAGATCTTTGG + Intronic
908120422 1:60980978-60981000 CTCTTCCCAGCTGTGACCTTAGG - Intronic
908543665 1:65145269-65145291 CTCTGCCAATGTATGACCTTTGG - Intergenic
909253953 1:73394017-73394039 CTCTTGCCATGTAAAATTTTGGG + Intergenic
916705208 1:167342137-167342159 CTGTTCCCATTTAGGACCATGGG + Intronic
923758122 1:236812491-236812513 CACTTCCCATGTATGAGCTGAGG - Intronic
1067271276 10:44793316-44793338 CTCTTTCCTGGAAAGACCTTAGG + Intergenic
1070538264 10:77395493-77395515 CTTTCCCCATGTAATACCTGTGG - Intronic
1071917157 10:90306709-90306731 CAATTACCATGTAAGACCCTTGG - Intergenic
1074367222 10:112868784-112868806 ATCTTACCATATAAAACCTTTGG - Intergenic
1075260194 10:120956767-120956789 CTCTTCAGATGTATGACCTTGGG + Intergenic
1075385749 10:122054152-122054174 CTCTTCCTATTGAAGAACTTTGG - Intronic
1081332593 11:41822987-41823009 CTGTCACCATGTAAGACCTGAGG + Intergenic
1081458080 11:43245057-43245079 CTCCTCCCATGGAAGACGTGGGG + Intergenic
1085052781 11:73388388-73388410 CTCTTCCCCTGGCAGACCTATGG - Intronic
1085394783 11:76201708-76201730 CTCTCTCCCTGTGAGACCTTGGG + Intronic
1087986740 11:104691698-104691720 CTCTTCCCATTTTTGACCTTGGG - Intergenic
1088159167 11:106847877-106847899 CTCTCCCCATTTAATACATTGGG - Intronic
1088395237 11:109360865-109360887 CTCTGCCAATTTATGACCTTGGG - Intergenic
1088748498 11:112824297-112824319 CTGTTCCCATTTAGGGCCTTGGG - Intergenic
1091643435 12:2254916-2254938 CTCTTCACTTAAAAGACCTTCGG - Intronic
1093484524 12:19639080-19639102 CTCTTCCTATTCATGACCTTTGG - Intronic
1095719732 12:45387385-45387407 CTCTTCCCCTGTAGGCCCTTAGG + Intronic
1096164606 12:49411240-49411262 CTCTTGCCATGTAATGCCCTTGG + Intronic
1099150762 12:79109860-79109882 GTCTTCCTGTGTAAGACTTTAGG + Intronic
1099845180 12:88019653-88019675 CTCTGCACATGTAAGAGATTGGG + Intronic
1106145584 13:27047107-27047129 CTCTCCCCGTGTAAGGTCTTGGG + Intergenic
1107890082 13:44906435-44906457 CTCTGCCAATGTGTGACCTTGGG - Intergenic
1109181351 13:59217680-59217702 CTCTTTTCATCTAAGACCTCAGG - Intergenic
1110433945 13:75458498-75458520 CTGTTCCCATTTAAGGCCATGGG + Intronic
1110714260 13:78683708-78683730 CTGTTCCCATTTAAGCCCATGGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1120890129 14:89484298-89484320 CTTTTCCCATAAAAGACCATAGG + Intronic
1123779035 15:23607162-23607184 CTCTTTCCATGTCAGACCACTGG - Intronic
1124221533 15:27853987-27854009 ATCTTCCCAAGTAAGCCCTAAGG - Intronic
1125926665 15:43568669-43568691 CTCTTCCCCTATAAATCCTTTGG - Intronic
1125939809 15:43668234-43668256 CTCTTCCCCTATAAATCCTTTGG - Intergenic
1128635038 15:69297784-69297806 CTCTTTCCCTTTAAGAACTTGGG + Intergenic
1128688487 15:69705362-69705384 CCATTCCCCTGTAAGACCTTAGG - Intergenic
1129349924 15:74949816-74949838 CTCATCCCATCTGAGCCCTTGGG - Intergenic
1129755425 15:78095376-78095398 TTCTTCCCAGGTGAGATCTTAGG + Intronic
1130221960 15:82027084-82027106 GTCTTACCTTGTAAGACCTCTGG - Intergenic
1130222099 15:82028316-82028338 GTCTTACCTTGTAAGACCTCTGG + Intergenic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1133720318 16:8488694-8488716 CTATTCCCTTGTAAGACCTGTGG - Intergenic
1134199769 16:12188330-12188352 CTCTACCTCTGTATGACCTTGGG - Intronic
1134264361 16:12680723-12680745 CTCTGCCCCTGTGAGACCTGGGG + Intronic
1134840524 16:17398148-17398170 CTCTTGCCTTGTCAGTCCTTTGG - Intronic
1137817731 16:51415039-51415061 CTCTACACATGTCAGTCCTTTGG + Intergenic
1140848946 16:78916384-78916406 GTCTTCCCATGTTTGACTTTTGG - Intronic
1141680107 16:85538829-85538851 CTCTTGCCCTGGAAGACCTCTGG + Intergenic
1143856287 17:9853000-9853022 CTCTTCAACTGTAAGACCGTGGG + Intronic
1144071830 17:11681006-11681028 TCCTTCCCATTTAGGACCTTTGG + Intronic
1145011044 17:19368039-19368061 CTCTCCCCATGTCAGACTCTAGG - Intronic
1145818881 17:27816051-27816073 CTCATCCCCTGTGTGACCTTGGG - Intronic
1155797263 18:30055513-30055535 CTCTTCCCATTTAATTCTTTAGG - Intergenic
1158290655 18:55938037-55938059 CACTTCACAAGTCAGACCTTTGG - Intergenic
1158434278 18:57424148-57424170 TTATTCCCATCTAAGAACTTAGG - Intergenic
1159852094 18:73536336-73536358 CCCTTCCCAAGTAAGAAGTTAGG + Intergenic
1165283459 19:34817222-34817244 TTCTTCTCATGTAAGACTTAGGG + Intergenic
1166389490 19:42401287-42401309 CTCCTCCCCTTGAAGACCTTCGG - Intergenic
1166811142 19:45515321-45515343 CCCTTCCCCTGTGTGACCTTGGG + Intronic
1167732677 19:51270398-51270420 CTGTTCTCATGTCAGAGCTTAGG - Intergenic
926959231 2:18335917-18335939 CTCTTCTAATTGAAGACCTTGGG + Intronic
929303495 2:40332917-40332939 CTTTTCCTATGAAAAACCTTAGG - Intronic
929738874 2:44581614-44581636 GTAATCCCATGTTAGACCTTGGG - Intronic
930159276 2:48137756-48137778 TTATTCCCATGTAGGACTTTTGG - Intergenic
935181679 2:100696435-100696457 CTTTTCCCTTGTATGGCCTTAGG + Intergenic
939356950 2:141114686-141114708 CTCTTCCCATTTAGGGCCATGGG + Intronic
940984201 2:160036605-160036627 CTCTTTCTATGTGAGGCCTTGGG + Intronic
942598951 2:177620522-177620544 CTCTACCCATGTACCTCCTTGGG - Intergenic
946828683 2:223705575-223705597 CCCTCCCCATGGAAGTCCTTGGG + Intergenic
1169696964 20:8400357-8400379 CTCTTGCCATTTATGACCTTTGG + Intronic
1171328837 20:24319232-24319254 CTCTTCACAGTTAAGTCCTTTGG + Intergenic
1172121497 20:32601619-32601641 CTCTTGCCTGGTGAGACCTTGGG - Exonic
1173409510 20:42797454-42797476 ATATTCTCATGAAAGACCTTGGG - Intronic
1174160575 20:48547559-48547581 CTCTTCCCATGCAACCCCTGTGG + Intergenic
1174203046 20:48820383-48820405 CTCTTCCCCTGTGTGACCTTGGG - Intronic
1177474709 21:21604826-21604848 CTTTACCCAAGTCAGACCTTGGG - Intergenic
1183667420 22:39253791-39253813 CTCTTCCCAGCTCAGACCCTTGG + Intergenic
1183958733 22:41398072-41398094 CTCTTTCCAAGTAAGCACTTTGG - Exonic
951812674 3:26717925-26717947 CTCTTACCAGGGAACACCTTGGG - Intergenic
953845027 3:46420106-46420128 CTCTGCCCATGCAAGACATTTGG - Intergenic
953969125 3:47333349-47333371 CTCTTCCCTGCTTAGACCTTTGG - Intronic
955457072 3:59134815-59134837 CTCTAACAATGTATGACCTTGGG - Intergenic
955961036 3:64341628-64341650 CTCTGGCCATGTAAGGCCATGGG - Intronic
956740720 3:72273704-72273726 TTTTTCCCTTGTAAGACCTGAGG + Intergenic
957685887 3:83502926-83502948 CCCTGCCCATGCAAGACATTTGG - Intergenic
957817614 3:85322341-85322363 GTCTTCCCATGCAAAACCTAGGG + Intronic
958023720 3:88026554-88026576 CTGTTCCCATTTAGGTCCTTGGG + Intergenic
961054592 3:123777537-123777559 CTCTTCCCCTGTGAAACTTTGGG + Intronic
962650901 3:137489717-137489739 CTTTTCTCAGGTAAGACCCTTGG - Intergenic
963761017 3:149287461-149287483 CTGTTCCCATTTAAGGCCATGGG - Intergenic
965668609 3:171122583-171122605 CTCTTCACATGAAAAGCCTTAGG - Intronic
966023373 3:175243812-175243834 ATCTTCCCATTTCAGACCTTGGG - Intronic
966654428 3:182339025-182339047 CTCTTCCAATGACAGAGCTTGGG - Intergenic
971250359 4:24969104-24969126 CCCTGCCCATGCAAGACATTTGG + Intronic
971643620 4:29166960-29166982 CTCTTCCCAACCAACACCTTAGG + Intergenic
972637724 4:40899097-40899119 CTCTTACCATTTTTGACCTTGGG + Intronic
973571391 4:52243237-52243259 CTCTACCAACATAAGACCTTAGG - Intergenic
973692232 4:53448148-53448170 CTCTTCACATTTAAGTCATTTGG + Intronic
976927957 4:90525399-90525421 TTCTTCTCATCTAAGAACTTTGG - Intronic
979153640 4:117354239-117354261 TTCTTTCATTGTAAGACCTTTGG - Intergenic
980983135 4:139671036-139671058 CCCTTGCCTTGTAAGGCCTTAGG + Intronic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
985937057 5:3105680-3105702 CACTTCCCATCTAGGACCCTAGG - Intergenic
989076709 5:37571557-37571579 CTCTTCCAATGTAAACCCTTGGG - Intronic
991262496 5:64682472-64682494 CTATATCCATGTAAGACTTTTGG - Intergenic
992174176 5:74133557-74133579 CTCTTCCCCTGCTAGACCCTGGG - Intergenic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
996491396 5:124102070-124102092 CTCTTCCCCTGTTAGATCATAGG + Intergenic
997447675 5:133953336-133953358 CTGTTCCCTTGGAAGACATTTGG + Intergenic
998881585 5:146650757-146650779 CTTTTCCTATGGAAGATCTTTGG - Intronic
999766725 5:154746658-154746680 CTCTCTCCATGAAAGCCCTTTGG + Intronic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1003072676 6:2957291-2957313 CTCTTCCCATGTGTTACCCTAGG - Intronic
1005204654 6:23388237-23388259 GTCACCCCATGTAAGACATTCGG + Intergenic
1007015074 6:38457454-38457476 CTCTTCACATTTCAGTCCTTTGG - Intronic
1007829173 6:44625143-44625165 CTCTTCCCAGGGAACACTTTGGG - Intergenic
1008829999 6:55747434-55747456 CTCTTGCCATGTAACACGCTGGG + Intergenic
1013279949 6:108626828-108626850 CACTTCCAATGTTAAACCTTAGG - Intronic
1016543845 6:145197905-145197927 TTCTTCCCTTGTATGAGCTTCGG - Intergenic
1016902097 6:149113226-149113248 CTATTCCCATTTAAGGCCTTGGG - Intergenic
1018928836 6:168226053-168226075 CCCTTCTCTTGTAAGACTTTTGG + Intergenic
1021230861 7:18085612-18085634 CTCTGCCACTGTGAGACCTTGGG + Intergenic
1023033422 7:36110033-36110055 CCCTTCCCATGTACGACCCATGG + Intergenic
1026826172 7:73583185-73583207 CTCTCCACCTGTATGACCTTGGG - Intergenic
1030386510 7:108873959-108873981 CTGTTCCCATTTAGGACCGTGGG - Intergenic
1030825020 7:114144747-114144769 CTCTTTCCATGTAAAATATTTGG - Intronic
1032012070 7:128353219-128353241 CTCTGCCCATTTGTGACCTTGGG - Intronic
1032443191 7:131958110-131958132 CTCTTTGCTTGTAAGACTTTAGG - Intergenic
1032823454 7:135546034-135546056 CTCTTGCCGTGTGATACCTTCGG - Intergenic
1033603513 7:142908139-142908161 CTCTTCCCACGTAAGCCCTGGGG + Exonic
1034532210 7:151702832-151702854 CCCTTCCCAGGAGAGACCTTTGG - Intronic
1035976113 8:4313484-4313506 ATTTTGACATGTAAGACCTTTGG - Intronic
1038258489 8:25972318-25972340 CTCTTCCCATCTCAGACCCAAGG - Intronic
1038503796 8:28067172-28067194 CTTTTCTCATGTAAGAGGTTTGG - Intronic
1045965388 8:108018641-108018663 CTGTTCCTATTTAAGACATTTGG - Intronic
1046866319 8:119154668-119154690 CTATTCCCATGTATAACCTTGGG + Intergenic
1051572390 9:18574198-18574220 CGCGTACCATCTAAGACCTTAGG - Exonic
1051813223 9:21074543-21074565 CCCTTCCCATATCACACCTTAGG - Intergenic
1053262375 9:36679497-36679519 ATCATGCAATGTAAGACCTTTGG + Intergenic
1058397914 9:104577266-104577288 CTCTTGCCTTCTAATACCTTTGG - Intergenic
1060495284 9:124113717-124113739 CTCTTAGCAGGTAAGAGCTTGGG - Intergenic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1186488712 X:9954222-9954244 CTCTGGCCATGTAAGACATGCGG - Intergenic
1188220614 X:27536888-27536910 TTCTTCCCATGTAAGTACTTGGG + Intergenic
1189425453 X:40896336-40896358 CTCTCTCCATGTAAGACATGAGG - Intergenic
1194312724 X:92333292-92333314 ATCTTCTCATGCAAGACATTAGG - Intronic
1194385036 X:93242346-93242368 TTCTTCCCATCTATGAGCTTGGG - Intergenic
1195981680 X:110585187-110585209 CTCTTCCCTTGCATGGCCTTAGG - Intergenic
1197900886 X:131370181-131370203 CCCTTCCAATGAAAGACCCTTGG + Intronic
1200620992 Y:5447433-5447455 ATCTTCTCATGCAAGACATTAGG - Intronic