ID: 1060920194

View in Genome Browser
Species Human (GRCh38)
Location 9:127415014-127415036
Sequence TGATAGAAGGATTATAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920194_1060920204 11 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920204 9:127415048-127415070 CACACCCGCTCTGGCTTACAGGG No data
1060920194_1060920198 2 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920194_1060920205 12 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920205 9:127415049-127415071 ACACCCGCTCTGGCTTACAGGGG No data
1060920194_1060920211 30 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920194_1060920203 10 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920203 9:127415047-127415069 TCACACCCGCTCTGGCTTACAGG No data
1060920194_1060920206 13 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920206 9:127415050-127415072 CACCCGCTCTGGCTTACAGGGGG No data
1060920194_1060920210 26 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920194_1060920209 17 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920194 Original CRISPR TGATAGAAGGATTATAGGGT TGG (reversed) Intergenic