ID: 1060920196

View in Genome Browser
Species Human (GRCh38)
Location 9:127415019-127415041
Sequence GGAGATGATAGAAGGATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920196_1060920210 21 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920196_1060920206 8 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920206 9:127415050-127415072 CACCCGCTCTGGCTTACAGGGGG No data
1060920196_1060920203 5 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920203 9:127415047-127415069 TCACACCCGCTCTGGCTTACAGG No data
1060920196_1060920205 7 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920205 9:127415049-127415071 ACACCCGCTCTGGCTTACAGGGG No data
1060920196_1060920204 6 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920204 9:127415048-127415070 CACACCCGCTCTGGCTTACAGGG No data
1060920196_1060920209 12 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920196_1060920198 -3 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920196_1060920211 25 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920196 Original CRISPR GGAGATGATAGAAGGATTAT AGG (reversed) Intergenic