ID: 1060920197

View in Genome Browser
Species Human (GRCh38)
Location 9:127415027-127415049
Sequence TGAGGAGGGGAGATGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920197_1060920203 -3 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920203 9:127415047-127415069 TCACACCCGCTCTGGCTTACAGG No data
1060920197_1060920211 17 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920197_1060920206 0 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920206 9:127415050-127415072 CACCCGCTCTGGCTTACAGGGGG No data
1060920197_1060920205 -1 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920205 9:127415049-127415071 ACACCCGCTCTGGCTTACAGGGG No data
1060920197_1060920213 30 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
1060920197_1060920210 13 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920197_1060920204 -2 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920204 9:127415048-127415070 CACACCCGCTCTGGCTTACAGGG No data
1060920197_1060920209 4 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920197 Original CRISPR TGAGGAGGGGAGATGATAGA AGG (reversed) Intergenic